An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule...
Transcript of An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule...
![Page 1: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/1.jpg)
An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator
by
Meng-Jung Chiang
A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy
Baltimore, Maryland
August 2014
![Page 2: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/2.jpg)
ii
Abstract
Small molecules as well as protein drugs have demonstrated tremendous
success in clinical applications. Despite this success, their off-target effects diminish
their pharmacologic value. Decades ago, innovations in molecular biology and
recombinant DNA technology have generated a new revolution of protein-based
therapeutics, with treatments applicable to a wide range of diseases including
cancers, cardiovascular disorders, and autoimmune diseases. Protein-based drug
therapy has shown the ability to achieve high potency and specificity towards cell
surface. However, protein drugs usually lack the homogenicity and precise chemical
synthetic manipulation, which are characteristic of small molecules. Chemical
modification of proteins has historically suffered from a lack of site-specificity,
uneven stoichiometry and the challenge of general applicability. In an effort to take
full advantage of the best aspects of both protein drug and small molecule drug
fields, this thesis research focuses on the development of a protein-small molecule
conjugate, which we hope will be a precise and effective therapeutic in targeting
immune-related diseases.
Activation of adenosine 2a receptor (A2AR) suppresses the immune system,
especially in T cells. A2AR has thus been identified as a potential target to treat
inflammation and autoimmune diseases. A2AR agonists usually suffer from short
half-lives and high toxicity in central nervous system and cardiac tissues. Here we
have tethered CGS 21680 (CGS), a potent but short-lived synthetic A2AR agonist in
vivo, to the immunoglobulin Fc domain using expressed protein ligation (EPL)
![Page 3: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/3.jpg)
iii
secreted from Sf9 cell, to form the bivalent protein-small molecule conjugate Fc-CGS.
Fc-CGS is stabilized by glycosylation and forms a dimer. By conjugating CGS to the Fc
domain, not only is CGS half-life increased, but also its potency and specificity by
Fc/FcγRI binding. In cell-based assays, Fc-CGS can trigger cAMP production
intracellularly, has lower IC50 than CGS in suppressing IL-2 production at longer
time points, stable in both cell culture medium and mouse serum. In vivo, we used a
pneumonitis disease mouse model, to show that administering Fc-CGS prolonged
survival rates. Moreover, Fc-CGS can be detected at the area of inflammatory
pulmonary tissue by immunohistochemistry staining 18 days post intraperitoneal
injection.
Taken together, our data suggest Fc-CGS shows enhanced pharmacokinetic
and pharmacodynamic performance. The conjugation approach EPL can be a novel
technique to generate protein-small molecule bivalent conjugate for
pharmacological development in the future.
Thesis Readers: Philip A. Cole, M.D. Ph.D., Jonathan D. Powell, M.D. Ph.D.
![Page 4: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/4.jpg)
iv
Acknowledgements
Thesis Advisor: Philip A. Cole, M.D. Ph.D.
Thesis Reader: Jonathan D. Powell, M.D. Ph.D.
Thesis Committee Members: Jonathan D. Powell, M.D. Ph.D., Maureen Horton, M.D.,
Jin Zhang, Ph.D.
Collaborators: Lai-Xi Wang, Ph.D., Daniel J. Leahy, Ph.D., Sam Collins, Ph.D., Adam
Waickman, Ph.D., Xin Gao, Ph.D., Mohammed N. Amin, Ph.D., John Giddens, Yee Chan-
Li
Colleagues: Marc Holbert, Ph.D., Young-Hoon Ahn, Ph.D., David Bolduc, Ph.D., Jay
Kalin, Ph.D., You Sang Hwang, Ph.D., Mary-Katherine Tarrant Connacher, Ph.D.,
Kannan Karukurichi, Ph.D. Rong Huang, Ph.D., Beverly Dancy, Ph.D., Blair Dancy,
Ph.D., Isabel Ferrando, Ph.D., Shonoi Ming, Ph.D., Zhihong Wang, Ph.D., Yun Wang,
Ph.D., Beth Zucconi, Ph.D., Shridhar Bhat, Ph.D., Zan Chen, Dominique Figueroa,
Robert Hsiao, Polina Prusevich, Sam Henager, Dawn Hayward
Pharmacology Staff: Robin Hart, Amy Paronto, Amy Forcier, Mimi Guercio, Brenda
Figueroa, Paula Mattingly, Frank Williams
![Page 5: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/5.jpg)
v
To Dr. Jim Stivers, without him, I could not have the chance to be here. He
opened the door for my Ph.D. career.
Dr. Philip Cole, my thesis advisor, he is a great mentor and has been exactly
what I need. Without his support and guidance, I cannot walk through of this tough
path. Thanks for giving me the opportunity to work on this challenging but exciting
project, I felt grateful learning from him.
All my collaborators, colleagues and departmental staff listed above, I
appreciate all of their assistance. They made my life in Hopkins smoothly and
delightful. Without any single one of them, my thesis project cannot be done by now.
Thanks for letting me stand on their shoulders.
The last but the most important is my family in Taiwan, my father Y. C.
Chiang and my mother Sophia Tsai. Thanks for long term support and unconditional
love that helped me pursue my dreams here in the United States. A special thank of
my wife to be, Serena Yang, I appreciate your company and time. You worked with
me in the labs in numerous late nights and the weekends, walked me through all the
difficult processes. Beside the science, I believe you are the most beautiful finding in
my life.
![Page 6: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/6.jpg)
vi
Table of Contents
Abstract………………………………………………………………………………….……………………………ii
Acknowledgements………………………………………………………………..………………….………...iv
List of Tables…………………………………………………...…………………………………..…………….viii
List of Figures……………………………………………………………………………………………….……..ix
Chapter 1: Introduction………………………………………………………………………………………..1
Protein Based Therapeutics………………………………………………………………………..….1
1. Enzymes and Regulatory Proteins…………………………………………………………….4
2. Targeted Proteins………………………………………………………………………………..…..5
3. Protein Vaccines…………………………………………………………………………………..….6
Fc- Fusion Protein Therapeutics…………………………………………………………….………8
Antibody Drugs and Antibody-Small Molecule Conjugates (ADCs)…………….…..11
Linker Conjugation Chemistry…………………………………………………………………..….16
Examples of Noncleavable Linkers………………………………………………….……………16
Examples of Cleavable Linkers…………………………………………………………..…………20
Summary of Linker Chemistry……………………………………………………………...………22
Biology of Adenosine 2A Receptor……………………….……………………………………….25
General Structure of the Adenosine Receptors ……………………………………….…….28
Agonist and Antagonist of the Adenosine 2A Receptor…………………………...……..31
Expressed Protein Ligation………………………………………………………………….………37
Fc Domain of Immunoglobulin G and Its Glycosylation………………………………….40
Summary………………………………………………………………………………………..……..…….44
![Page 7: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/7.jpg)
vii
Chapter 2: Generation of Protein-Small Molecule Conjugate Fc-CGS………………..…….46
Introduction………………………………………………………………………………...…….……46
Methods…………………………………………………………………………………...……………..48
Results and Discussion…………………………………………………………………………….70
Chapter 3: Characterization of Fc-CGS and ex vivo and in vivo Assays……………..…….77
Introduction………………….…………….……………………………………….……..…………...77
Methods………………………………………………………………………………………………….79
Results and Discussion…………………………………………………………………………..101
Bibliography……………………………………………………………………………………………….……106
Curriculum Vitae………………………………………………………………………………….….……….116
![Page 8: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/8.jpg)
viii
List of Tables
Table 1……………………………………………………………………………………………………………….10
Fc-fusion proteins and monoclonal antibodies (mAbs) in the clinic
![Page 9: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/9.jpg)
ix
List of Figures
Figure 1…………………………………………………………………………………………………….…………3
Recombinant DNA technology
Figure 2……………………………………………………………………………..………………………………15
Structure of the three FDA approved antibody-drug conjugates
Figure 3………………………………………………………………………………………..……………………19
Maleimide chemistry of ADCs
Figure 4……………………………………………………………………………………………………………..23
Formation of cleavable disufilde linkage
Figure 5……………………………………………………………………………………………………………..24
Chemistry of the cleavable hydrazone linkage
Figure 6……………………………………………………………………………………………………………..30
Crystal structure of human adenosine 2A receptor
Figure 7……………………………………………………………………………………………………………..35
Agonists of the A2A receptor
Figure 8……………………………………………………………………………………………………………..36
Antagonist of the A2A receptor
Figure 9……………………………………………………………………………………………………………..39
Expressed protein ligation (EPL)
Figure 10……………………………………………………………….…………………………………………..43
Glycosylation on Fc domains of immunoglobulin G
Figure 11……………………………………………………………………………………………...……………45
The schematic model of Fc-CGS in immune system
![Page 10: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/10.jpg)
x
Figure 12…………………...………………………………………………………………………………………58
Synthesis process of CGS21680
Figure 13………………………………………………………………………...…………………………………59
The 1H-NMR (500 MHz, CD3CN) of CGS21680
Figure 14……………………………………………………………………………………………………...……60
MALDI-TOF mass spectrum of the CGS21680
Figure 15………………………………………………………………...…………………………………………61
The 1H-NMR (500 MHz, CDCl3) of C-CGS intermediate: tert-Butyl (14-amino-5-oxo-
1,1,1-triphenyl-9,12-dioxa-2-thia-6-azatetradecan-4-yl) carbamate
Figure 16…………………………………………………………………………………………...………………62
Synthetic scheme
Figure 17……………………………………………………………...……………………………………………63
Characterization of C-CGS
Figure 18……………………………………………...……………………………………………………………64
SDS-PAGE analysis (Coomassie blue) of refolded and dimerized Fc and Fc-CGS
Figure 19………………………………………………………………...…………………………………………65
Schematic representation of the Fc-intein-CBD construct expressed by the Sf9 cells
Figure 20……………………………………………………………………………………...……………………66
Expressed protein ligation for the generation of Fc-CGS
Figure 21…………………………………………………………………………………...………………………67
LC-MS analysis of Fc and Fc-CGS
Figure 22………………………………………………………………………...…………………………………68
Extracellular IL-2 ELISA assay
![Page 11: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/11.jpg)
xi
Figure 23………………………………………………………………………………………...…………………69
In vivo clonal CD4+ T cell expansion inhibition by Fc-CGS
Figure 24…………………………………………………………………………………………...………………75
Glycosylation of Fc domains
Figure 25……………………………………………………………………………...……………………………76
Gel filtration analysis of Fc-CGS
Figure 26………………………………………………………………………………………………...…………86
Glycan analysis of Fc by LC-MS
Figure 27…………………………………………………………………………………………...………………87
The HPAEC-PAD analysis of the glycan for semi-quantification purposes
Figure 28……………………………………………………………………………………………...……………88
Intracellular cAMP levels after incubation with different CGS forms of wild type
C57BL6 splenocytes
Figure 29……………………………………………………………………………...……………………………89
Intracellular cAMP levels after incubation with different CGS forms of A2AR-/-
C57BL6 splenocytes
Figure 30…………………………………………………………………………………………………...………90
Surface-plasmon resonance binding assay of Fc-CGS and Fc to the Fcγ receptor I
Figure 31…………………………………………………………………………………...………………………91
Surface-plasmon resonance binding assay of commercial full length antibody
containing the same Fc isotype and deglycolsyalated Fc to the Fcγ receptor I.
Figure 32………………………………………………………………………………...…………………………92
Extracellular IL-2 secretion modulated by Fc-CGS
![Page 12: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/12.jpg)
xii
Figure 33……………………………………………………………………………………………...……………93
Fc-CGS and Fc stability in blood
Figure 34………………………………………………………………...…………………………………………94
Schematic representation of autoimmune pneumonitis disease model
Figure 35……………………………………………………………………………...……………………………95
Kaplan-Meier survival curve in response to several therapies following induction of
autoimmune pneumonitis in mice
Figure 36……………………………………………………………………………………………...……………96
Hematoxylin and eosin staining of the pulmonary tissue from mice
Figure 37……………………………………………………………………………………………...……………97
Immunohistochemistry staining with anti-Flag of pulmonary tissues from C3HA
mice at different time points
Figure 38………………………………………………………………………………………...…………………98
Immunohistochemistry staining with anti-Flag of pulmonary tissues from both
healthy and pneumonitis C3HA mice
Figure 39……………………………………………………………………………...……………………………99
Immunohistochemistry staining with anti-Flag of heart tissues from both healthy
and pneumonitis C3HA mice
Figure 40……………………………………………….…………………...……………………………………100
Immunohistochemistry staining with anti-Flag of brain tissues from both healthy
and pneumonitis C3HA mice
![Page 13: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/13.jpg)
1
Chapter 1:
Introduction Protein-Based Therapeutics
Since the FDA approval in 1982 of the protein drug, human insulin developed
by recombinant DNA technology, protein-based drugs have become increasingly
common in treating a wide range of diseases including diabetes mellitus,
autoimmune disease, cancers, and cardiovascular disorders.
Although now manufactured through recombinant DNA technology, the first
insulin was isolated from porcine and bovine pancreas and used in human patients
with type 1diabetes mellitus in 1922, this preparation was limited by the shortage
of its animal source, difficulty of purification, high cost, and the potential
immunogenicity in patients1. These difficulties have been overcome by the use of
recombinant DNA technology, which provides increased yield, reduced cost and
reduced immunogenicity due to the fully humanized protein sequence (Figure 1).
Stemming from insulin as the first protein drug, more than 130 protein or
peptide-based drugs have been approved by the FDA and have contributed
significantly to medicine; these drugs include several blockbuster such as
recombinant insulin2, 3, erythropoietin4, rituximab5, Herceptin6 and soluble TNF
receptor7, 8.
![Page 14: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/14.jpg)
2
Protein based therapeutics are superior to small molecule drugs in several
ways. First, proteins often have very high specificity for their targets, therefore, they
often have fewer adverse effects than do small molecules which commonly have
more than one target in vivo. The second and third advantages are due to the fact
that proteins lend themselves to the possibility of recombinant technology. Use of
recombinant proteins reduces the exposure to human or animal diseases, and can
enhance the yield and pharmacologic properties compared with animal sources. An
example is, Darbepoetin alfa, a synthetic analog of erythropoietin, which can serve
as a growth factor of red blood cells, used to treat anemia. The synthetic analog was
engineered with two more N-linked oligosaccharide chains. When expressed in
Chinese hamster ovary cells, Darbepoetin alfa contains five carbohydrate chains
rather than three of endogenous erythropoietin, and showed significantly improved
in vivo half-life (3-fold) in serum9.
The FDA approved protein/peptide drugs can be classified into three groups:
1. Enzymes and regulatory proteins; 2. targeted proteins; 3. protein vaccines10, each
of which is now reviewed.
![Page 15: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/15.jpg)
3
Figure 1 Recombinant DNA technology. Cell line generation and development for
cell culture processes for the generation of recombinant proteins of interest (o.i.).
The wavy lines indicate subcultivations of individual cell lines that are in a screening
program to obtain the final producer. Vials indicate banks of cells frozen in liquid
nitrogen. Spinner flasks represent scale-down systems for process optimization, and
bioreactors represent large-scale production processes. (Florian M. Wurm, Nature
Biotechnology, 22, 1393 – 1398, 2004)
![Page 16: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/16.jpg)
4
1. Enzymes and Regulatory Proteins
Protein therapeutics in this group are used when in a specific endogenous
protein is deficient in a disease state, and exogenous protein is used as treatment.
A classic example is, erythropoietin, a highly glycosylated protein hormone
secreted by kidney and liver. Erythropoietin stimulates red blood cell production
(erythropoiesis) in bone marrow by binding to its endogenous receptor,
erythropoietin receptor (EpoR). EpoR signaling involves the activation of a
receptor-associated tyrosine kinase, JAK2, and the subsequent phosphorylation and
activation of STAT5 (Signal Transducer and Activator of Transcription 5)11. Under
normal conditions, there is a low level of endogenous erythropoietin in the blood,
however under hypoxic stress, the erythropoietin levels can jump up significantly
over their baseline levels12.
Hypoxia-inducible factors (HIF) are responsible for transcriptional activation,
responding to oxygen level change in the cellular microenvironment of the
peritubular cells of the renal cortex13. Therefore, erythropoietin is administrated to
patients who have kidney failure or anemia, to stimulate erythropoiesis. Historically,
erythropoietin was purified from sheep and human urine14, 15. Subsequently, the
landmark technology involving expression of human proteins in Chinese Hamster
Ovary (CHO) cells led to human recombinant erythropoietin (rHuEPO, Epogen,
Amgen) becoming the first recombinant protein drug expressed from mammalian
![Page 17: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/17.jpg)
5
cells. This protein therapeutic has now become a mainstay in the treatment of
anemia.
2. Targeted Proteins
Targeted protein drugs use the antigen recognition site of an antibody or the
ligand binding domain of a receptor as a specific instrument by which to neutralize
or destroy the targeted protein or cells.
Examples of targeted protein drugs are the antibody drug (infliximab) and
decoy receptor drug (etanercept) that sequester the tumor necrosis factor alpha
(TNFα). Tumor necrosis factor alpha has been implicated in the pathogenesis of
many human diseases such as graft-versus-host disease (GVHD), Crohn’s disease,
and several autoimmune diseases. In late 1980s, researchers identified that TNFα as
the key proinflammatory cytokine in synovial fluid, and demonstrated that it has a
unidirectional role in inducing IL-1, IL-6 and IL-8 production16-18, and in this case,
the excessive IL-1 will further lead to destruction of bone and cartilage.
Infliximab was originally produced as a monoclonal antibody from mouse
that has high binding affinity against human TNF. However, murine protein is
immunogenic in humans, thus prompting the production of a chimeric antibody
with a murine antigen recognition chain and human constant region19. Infliximab
became commercially available in 1998.
![Page 18: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/18.jpg)
6
Soon after the release of infliximab, the decoy receptor drug etanercept
became commercially available. The precursor of etanercept was first designed by
Bruce A. Beutler and his colleagues in 1991. This precursor was a bivalent fusion
protein of human TNF extracellular domain (p55) and mouse Fc domain, produced
as an oligomer that contained a thrombin-sensitive peptide linker. This Fc-TNF
fusion was expressed in CHO cells7 and also transgenic mice8. The p55 domain of
TNF receptor is not soluble and stable in vivo due to its cysteine-rich structure. A
bivalent TNF inhibitor has also been produced by covalently linking human p55 TNF
receptor to the murine IgG1 heavy chain (hinge, CH2+CH3), and this bivalent TNF
inhibitor is several hundred times more potent than the soluble TNF receptor
prepared by anti-mouse IgG chromatography followed by thrombin treatment7.
Currently etanercept is produced as a recombinant protein of human tumor TNF
receptor 2 (p75) linked to the human Fc portion of human immunoglobulin G1 from
CHO cells, and comprises a total of 934 amino acids. Etanercept is used to treat
rheumatoid arthritis and psoriatic arthritis.
3. Protein Vaccines
For humans to develop adaptive immunity to defend against pathogens,
CD4+ helper T cells must be activated by antigen-presenting cells, which present
specific oligopeptides for T cell recognition. Early protein vaccines, such as those
against polio or measles, used heat-killed or attenuated forms of the original
![Page 19: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/19.jpg)
7
pathogens, thus putting recipients of the vaccine at risk of infection. Subsequently,
non-infectious protein vaccines have been developed, including the successful
vaccines against hepatitis B and HPV (human papillomavirus).
Hepatitis B is estimated to infect more than 350 million people worldwide.
This disease is, especially prevalent in China and South East Asia, regions in which
more than 10% of the population are infected, and in Eastern Europe, Russia and
Japan, where about 2-7% of population are infected. The genome of the hepatitis B
virus was sequenced by Galibert et al in 197920, and the first vaccine was tested in
1980. The hepatitis B vaccine, developed from hepatitis B surface antigen (HBsAg),
cloned and produced in yeast cells (Saccharomyces cerevisiae), was the first licensed
recombinant vaccine21.
Human papilloma virus (HPV) is the major cause of cervical cancer, with
approximately 500,000 cases diagnosed worldwide each year. The HPV 16 and HPV
18 strains are two of the strains most commonly associated with cervical cancer in
women22, 23. One example of the HPV vaccines, Gardasil (Merck & Co.), contains four
inactive L1 proteins (HPV capsid protein), one from each of four different strains (6,
11, 16, 18). These four strains cover 70% of cervical cancer and 90% of genital
warts. The four L1 proteins in Gardasil are synthesized individually from S.
cerevisiae to produce virus-like particles (VLPs).
![Page 20: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/20.jpg)
8
Fc- Fusion Protein Therapeutics
Among protein based therapeutics, Fc-fusion proteins are one of the most
intensively investigated groups. The fused partners attached to an Fc-domain have
significant therapeutic potential, and the Fc domain contributes additional
beneficial pharmacological properties. Fc domain prolongs plasma half-life and
therapeutic activity of their therapeutic partners, owing to its interaction with the
neonatal Fc-receptor (FcRn)24, as well as to the slower renal clearance for larger
sized molecules25. Usually, the half-life of Fc-fusions is typically shorter than intact
antibodies (1–2 weeks versus 3–4 weeks)26 but still significantly longer than the
fused parts. Most of these Fc-fusions target receptor-ligand interactions, working
either as agonists to directly stimulate receptor function to reduce or increase
immune activity or as antagonists to block receptor binding27. Table 1 lists some
examples of Fc-fusions licensed for clinical use that have the human IgG1-Fc domain,
which can bind with moderate to high affinity to FcγRs28. In contrast, the Fc domains
of human IgG2 and IgG4 have lower affinity compared with IgG1 towards FcγRs and
complement receptors28. The IgG2 and IgG4 subclasses are being developed as
therapeutic mAbs (e.g. denosumab, natalizumab, panitumumab and eculizumab)
since FcγRs and complement receptor interaction may be less important for such
applications27. The use of the IgG2 and IgG4 Fc domain in fusion proteins has been
increasingly studied since several groups have suggested that they may have
superior properties29, 30. One such case involves glucagon like peptide 1 (GLP-1),
that was fused to human IgG2 to avoid unwanted immunogenicity and was shown to
![Page 21: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/21.jpg)
9
have superior therapeutic and pharmacologic properties to native GLP-1 in a mouse
model of type I diabetes31.
![Page 22: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/22.jpg)
10
Table 1 Fc-fusion proteins and monoclonal antibodies (mAbs) in the clinic.
![Page 23: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/23.jpg)
11
Antibody Drugs and Antibody-Small Molecule Conjugates (ADCs)
The rise of monoclonal antibody drugs, the dream of “magic bullet” from Dr.
Paul Ehrlich, is considered one of the biggest triumphs in pharmacology over the
past five decades. These drugs have been successfully applied in cancers, heart
disease, and immune disorders.
Recently, oncology has become a major area of focus for development of
monoclonal antibodies, because tumor cells express specific antigens on their cell
surface which are different than those expressed by healthy cells. However, there
are key several obstacles in the development of antibody drugs to fight cancer: 1.
some early treatments with antibodies were not successful because of the
microenvironment of the solid tumors; 2. the extensive extracellular matrix in solid
tumors forms a barrier that prevents entry of macromolecules; 3. monoclonal
antibodies are inefficient cytocidal agents; and 4. unmodified murine monoclonal
antibodies are problematic because of their immunogenicity to humans. In humans,
murine monoclonal antibody drugs were unable to trigger the complement-
dependent cytotoxicity (CDC) or the antibody-dependent cytotoxicity (ADCC)32 in
humans. To avoid immunogenicity, researchers developed humanized antibodies33.
Examples of these FDA approved humanized antibody drugs are Palivizumab
(Synagis, anti F protein on respiratory syncytial virus), Daclizumab (Zenapax, anti-
CD25), and Trastuzumab (Herceptin, anti HER2).
![Page 24: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/24.jpg)
12
The discovery that monoclonal antibodies can bind selectively to tumor cells,
has opened up the option of using these antibodies as delivery vehicles for cytotoxic
drugs. The idea of arming antibodies with small molecule drugs such as toxins or
radionuclides was generated at least as far back as 197034, and there has
subsequently been a wide array of efforts to conjugate cytotoxic drugs to the
antibodies. The armed antibody, the so called antibody-drug conjugate (ADC), is a
new version of targeted therapy for cancer treatment. A variety of cytotoxic drugs
have been used in conjugation with antibodies, including DNA-acting agents
(duocarmycin, calicheamicin) and tubulin-acting agents (maytansinoids,
auristatins)35.
Antibody-drug conjugates to fight cancer have been developed by many
research groups. Chen et al. 36 showed that the monoclonal anti-MUC16 (cell surface
marker of ovarian cancer) antibody-auristatin conjugate inhibits cell proliferation
and increases cytotoxic effects compared with the individual unlinked molecules.
They also reported that the armed antibody that binds to multiple epitopes per
target antigen would enhance drug delivery compared to an antibody that binds to
only one epitope on the target antigen. Henry et al.37 used humanized anti-PMSA
(prostate-specific membrane antigen) antibody conjugating with mertansine (DM1)
through thiopentanoate linker to treat prostate cancer. Ma et al.38 also targeted the
PSMA but linked the mAb to MMAE (monomethylauristatin E) which leads to
picomolar potency in a prostate cancer cell based assay.
![Page 25: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/25.jpg)
13
Three ADCs have been approved by the FDA. The first ADC Mylotarg,
gemtuzumab ozogamicin (Figure 2), consists of a CD33 humanized antibody linked
to calicheamicin, and is used to treat acute myeloid leukemia. However, the linker is
acid-labile and the drug was easily released in the bloodstream before reaching the
target, which could limit the therapeutic window. Based on pharmacokinetic data
the mean half-life of Mylotarg is 72 hours39, 40. Mylotarg was withdrawn from the
market in June 2010 because there was no improvement in clinical benefit, and the
therapeutic window was very narrow. The remaining two approved ADCs are 1.
Brentuximab vedotin (Adcetris); (Figure 2), which targets CD30 conjugated with
MMAE, and is used to treat classical Hodgkin Lymphoma (HL) and systemic
anaplastic large cell lymphoma (sALCL)41, and 2. Trastuzumab emtansine (Kadcyla,
TDM1); (Figure 2), a herceptin monoclonal antibody armed with mertansine, used
for treating HER2 positive metastatic breast cancer42.
The hallmark of the ADCs is their ability to achieve potency and specificity
for the precise targeting of cell surface receptors. Although ADCs have promising
clinical therapeutic potential, at least six key challenges remain in their
development: (1) homogeneity: the drug to antibody ratio is usually not a fixed
number; (2) selectivity: the conjugation sites are not unique; (3) circulation: ideally,
the ADCs should behave like the original antibody in the circulation, the linker
should be stable and the cytotoxic drug should not affect, or only cause negligible
damage to, the healthy tissues; (4) antigen binding: the conjugation of the drug
should not interfere with the binding specificity and affinity of the antibody; (4)
![Page 26: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/26.jpg)
14
internalization: the internalization of the antibody-antigen complex is inefficient,
and results in insufficient intracellular drug concentrations; and (5) drug release:
once internalized, the intact drug should be released as an active form from the
linker43.
![Page 27: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/27.jpg)
15
Figure 2 Structure of the three FDA approved antibody-drug conjugates. Mylotarg
was withdrawn from the market in June, 2010. (Ravi V.J. Chari et al., Angew Chem Int
Ed Engl, 53, 3796–3827, 2014)
![Page 28: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/28.jpg)
16
Linker Conjugation Chemistry
Linker chemistry is a critical component of the successful development of
ADCs. Pharmacokinetic data should show the drugs to be persistent in circulation,
remaining intact and active at the target site. The choice of linkers is target
dependent, and based on properties such as antibody internalization and the
chemical structure of the cytotoxins.
There have been two categories of linkers of the ADCs that have undergone
clinical trials: non-cleavable and cleavable. To gain functionality non-cleavable ADCs
require proteolytic degradation to free the cytotoxins or to be internalized by target
cells. In contrast, to release the drug payloads, cleavable linkers rely on enzymes
such as cathepsin b, a reducing environment (glutathione in cytoplasm), or changes
in pH from lysosomes or endosomes.
Examples of Non-cleavable Linkers
Among the most common non-cleavable linkers used to bridge the drugs and
antibodies are the maleimide derivatives, which react with free thiol groups on
antibodies to form –S-C- bonds (Figure 3A). However, although antibodies generally
do not have free thiols, they do contain endogenous cysteine residues formed as
disulfide bridges.
![Page 29: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/29.jpg)
17
In the human IgG1 full length antibody, there are a total of 4 interchain and
12 intrachain disulfide bridges, and of these the 4 interchain disulfide bridges are
the more easily reduced and maintained as the free thiol state44. For conjugate
preparation, antibodies can be treated with 10 mM of dithiolthreitol (DTT) at 37 °C
for 30 minutes. After gel filtration chromatography purification, maleimido drug
derivatives are then added and reacted under cold conditions (0 °C) with
acetonitrile (ACN, 20% v/v) for 1 hr. Upon completion, the reaction is quenched by
cysteine, purified by gel filtration chromatography, and sterile filtered44, 45. It is
worth noting that the maleimdie linkage may suffer from serum instability, and
Alley et al. (2008)46 proposed that this is due to the alkyl-maleimide drug moiety
dissociating from the mAb and slowly re-conjugates onto the thiol-containing
albumin in serum.
Other than utilizing the thiol group from cysteine, another example of non-
cleavable linker is the use of the amino group from lysine to form a stable amide
bond. The carboxyl group from a cytotoxic drug such as melphalan can be pre-
activated as an ester such as a succinimdyl ester, prior to addition of the antibodies.
The carboxyl group can be first treated with acetic anhydride, followed by N-
hydroxysuccinimide mixed with N, N-dicyclohexylcarbodiimide, before reacting
with monoclonal antibodies47. The ADCs can be purified by gel filtration. As a
specific example, T-DM1 (Trastuzumab emtansine), a HER2 positive breast cancer
drug, first approved by the FDA in 2013 for the treatment of solid tumor, used the
bifunctional linker, SMCC or succinimidyl trans-4 (maleimidylmethyl)cyclohexane-
![Page 30: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/30.jpg)
18
1-carboxylate, which combines the chemistry of maleimide and an activated
carboxyl group (Figure 3B).
![Page 31: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/31.jpg)
19
Figure 3 Maleimide chemistry of ADCs. (A) Maleimide-derivative reacts with free
thiol on antibody. (B) Chemistry of bifunctional linker SMCC of forming ADC. (Ravi
V.J. Chari et al., 53, 3796–3827, Angew Chem Int Ed Engl, 2014)
![Page 32: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/32.jpg)
20
Examples of Cleavable Linkers
A conjugation linkage can be thiol-labile such as the disulfide bond, which
can be cleaved by glutathione, a thiol-containing tripeptide, abundant in the
cytoplasm (1-10 mM)48, while bloodstream contains much lower free thiol49. An
example of the disulfide bond linked ADCs is to use the maytansine derivative,
maytansinoid disulfide. Maytansinoid disulfide can be prepared from ansamitocin P-
3. Ansamitocin P-3 is first reduced with LiAl(OMe)3H then esterified with a
disulfide-containing carboxylic acid in the presence of coupling reagent (EDC) and
zinc chloride to give maytansinoid disulfide (Figure 4A)50. The antibodies of interest
are modified with N-succimidyl-3-(2-pyridyldithio) propionate (SPDP) (Figure 4B)
to introduce dithiopytidyl groups or with succinimidyl-4-(N-
maleimidomethyl)cyclohexane-1-carboxylate (SMCC) to introduce maleimido
groups. The maytansinoid disulfide is then further reduced by dithiothreitol (3mM)
at 4°C before mixing with modified antibodies to generate the antibody-S-S-drug
conjugate51, 52.
Another example of cleavable linkers is the acid-labile linker, hydrazone,
which was the focus of early development of ADCs. The hydrazone linker is
relatively stable at neutral pH such as the bloodstream (pH=7.3-7.4), but undergoes
hydrolysis at acidic conditions such as those found in endosomes (pH= 5.0-6.5) and
lysosomes (pH=4.5-5.0).
![Page 33: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/33.jpg)
21
In 1990s, Trail et al.53 covalently linked doxorubicin, a DNA intercalating
agent, to the humanized mAb BR96 that recognizes Lewis Y antigens expressed on
various human carcinomas such as those of the lung, breast and colon called BR96-
DOX by hydrazone linkage (Figure 5A). One of the methods to generate hydrazone-
linked doxorubicin-antibody conjugate is, doxorubicin first to be conjugated by a
hydrazone linker containing a pyridyl-protected disulfide, by reacting with the
hydrazine activated heterobifunctional reagent SPDP (Figure 4B), to form the
derivative, doxorubicin 13-[3-(2-pyridyldithio)propionyl]hydrazone hydrochloride.
The MAbs can be thiolated by SPDP separately. During the conjugation, the release
of free thiol from the MAbs by DTT treatment, results in the conjugation of
doxorubicin derivative previously synthesized. The number of doxorubicins
covalently bound to the antibody depend on the number of thiol groups installed on
MAbs. Usually this method can introduce up to 20 drugs per antibody due to the
abundance of lysine resides in IgG54.
A disadvantage of cleavable linkers is that they are usually of only limited
serum stability. To address this problem, the peptide linkage was developed to be
specifically digested by lysosomal proteases such as cathepsin b or plasmin55.
Peptide linkage has superior serum stability compared to cleavable linkers and the
pH in the bloodstream is unfavorable for protease activity. To provide high serum
stability, the valine-citrulline dipeptide linker was designed (half-life: 6 and 9.6 days
in mice and monkey respectively)44. Furthermore, the valine-citrulline linker is 100-
times more stable than the hydrazone linkage44, as well as showing reduced in vivo
![Page 34: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/34.jpg)
22
toxicity56. After enzymatic cleavage of the valine-citrulline linkage, the strong
electron-donating 4-aminobenzyl group undergoes 1,6-elimination. This self-
eliminating spacer is necessary to spatially separate the drug from the enzymatic
cutting site57 (Figure 5B).
Summary of Linker Chemistry
The linker technology significantly impacts ADC potency, specificity and
safety. Early linker design focused on an acid-labile hydrazone but its effects were
usually not site-specific. Subsequently, disulfide and peptidic linkers were designed
as more site-specific and with reduced in vivo toxicity. However, non-cleavable ADCs
must be internalized by the target cells, and then further released intracellularly to
be effective. In contrast, cleavable ADCs can be active against the target cells, even if
they are poorly internalized.
There are advantages and disadvantages to both non-cleavable and cleavable
linkers, and thus there is no general optimal linker design that is applicable to all
ADCs used to treat cancers.
![Page 35: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/35.jpg)
23
Figure 4 Formation of cleavable disufilde linkage. (A) Synthesis of Maytansinoid
disulfide. (Ravi V.J. Chari et al., 53, 3796–3827, Angew Chem Int Ed Engl, 2014). (B)
N-succimidyl-3-(2-pyridyldithio) propionate (SPDP) crosslinker.
![Page 36: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/36.jpg)
24
Figure 5 Chemistry of the cleavable hydrazone linkage. (A) Hydrazone linker of
antibody-doxorubicin conjugate. (B) Probable mechanism of monomethyl auristatin
E (MMAE) release from the antibody after enzymatic cleavage of valine-citrulline
from the ADC. (Laurent Ducry and Bernhard Stump, Bioconjugate Chem, 21, 5-13,
2010)
![Page 37: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/37.jpg)
25
Biology of the Adenosine 2A Receptor
The endogenous ligand of Adenosine 2A receptor (A2AR) is adenosine. The
first step in generating extracellular adenosine is the hydrolysis of ATP by CD39
(ENTPD1; ectonucleoside triphosphate dephosphohydrolase 1) and CD73 (ecto-5’-
nucleotidase)58. The CD39 is an integral membrane protein that hydrolyzes ATP or
ADP (less efficiently) to yield AMP by Ca2+ and Mg2+ dependent reaction59. The
second step in formation of adenosine is performed by CD73 which
dephosphorylates the AMP. Extracellular adenosine can be also regulated by
nucleoside transporters60.
Extracellular adenosine levels are approximately 300 nM, and quickly
elevated to 600-1,200 nM in the mircroenvironment in response to tissue damage
such as ischemia and inflammation61-64. The half-live of adenosine is extremely
short due to cellular uptake and enzymatic metabolism: (1) adenosine kinase (ADK)
reverses the action of CD73 to generate AMP; (2) adenosine deaminase converts
adenosine into inosine65-67.
There are four subtypes of adenosine receptors: A1, A2A, A2B and A3. All four
of which are G-protein (GTP-binding protein) coupled receptors with seven
transmembrane domains. Each adenosine receptor influences adenylyl cyclase
activity. The A1 and A3 receptors are linked to Gi-mediated inhibition of adenylyl
cyclase that inhibits cAMP production. In contrast, the A2A and A2B receptors are
linked to Gαs protein that stimulates adenylyl cyclase to increase intracellular cAMP
![Page 38: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/38.jpg)
26
level. The distribution of these adenosine receptors in different organs is as follows:
A1R is highly expressed in the brain, spinal cord, eye, and adrenal gland; A2AR is
predominately expressed in lymphocytes, GABAergic neurons, heart, spleen and the
thymus; A2BR is found in the cecum, colon and bladder; and A3R is distributed in
testis and mast cells68.
Once A2AR signaling is activated, the intracellular cAMP level is elevated by
adenylyl cyclase for activation of protein kinase A (PKA), which further
phosphorylate the serine 133 residue on CREB (cAMP response element-binding
protein)69. The phospho-CREB then turns on genes which have a cAMP responsive
element (CRE sites) in their promoter regions.
The A2AR is selectively localized on striatopallidal neurons and is involved in
functional heteromeric complexes with dopamine D2 and metabotropic glutamate
mGlu5 receptors70 among four adenosine receptors. Cheng et al. (2002) showed that
A2AR /PKA/CREB-mediated pathways induce neurite outgrowth and that the A2AR -
selective agonist CGS21680 (CGS) can rescue the blockage of nerve growth factor
(NFF)-induced neurite outgrowth when the NGF-induced MAPK cascade is blocked
by MEK inhibitor, PD9805971. Blockade of the adenosine A2AR in striatopallidal
neurons reduces the postsynaptic effects of dopamine depletion, which in turn
lessens the motor deficits of Parkinson’s disease (PD). Therefore, A2AR is considered
to be a therapeutic target for PD72.
![Page 39: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/39.jpg)
27
The A2AR is also known for its cardiovascular role. The A2AR selective agonist
CGS21680 has been shown to cause coronary artery vasodilation and can also lead
to hypotension. These effects can be reversed by the A2AR antagonist, SCH5826173.
A2AR is considered to be a therapeutic target for postischemic injury in cardiac
tissue74.
In addition to the critical roles in the central nervous system and the heart, it
has been known for over a decade that adenosine/ A2AR signaling can serve an
immunoregulatory function. Raskovalova et al.75 showed that adenosine suppresses
production of cytokines and chemokines, and inhibits the cytotoxic activity of
murine and human NK cells activated with IL-2. Ohta and Sitkovsky used A2AR -/-
mouse model to show the enhanced pro-inflammatory cytokines including TNF-α,
IFN-γ and IL-6 accumulation and tissue damage compared with wild type mice,
which suggested that A2AR plays a critical, non-redundant role of negative regulation
in immune system76. These effects are A2AR dependent, via stimulation of adenylyl
cyclase, increased production of cAMP, and activation of PKA. By blocking the
regulatory domain of PKA (cAMP binding domain), the inhibitory effects of
adenosine are reversed. Sevigny et al.77 showed that A2AR’s potent agonist, ATL313
suppresses the inflammatory cytokines, IL-2 and IFN-gamma, and increases the
negative co-stimulatory molecules, programmed death-1 and CTLA-4, expressed on
T cells. In addition, ATL313 inhibits T cell activation by preventing the
phosphorylation of ZAP70 (Zeta-chain-associated protein kinase 70)77, therefore the
T cell activation signaling is inhibited. The ATL313 induced inhibition can be
![Page 40: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/40.jpg)
28
reversed by protein kinase A inhibitor, H-89. Zarek et al.78 showed that CD4+ T cells
initially stimulated in the presence of an A2AR agonist fail to proliferate and produce
interleukin-2 (IL-2) and interferon (IFN)-gamma when rechallenged in the absence
of the A2AR agonist (anergy) but to promote the generation of adaptive regulatory T
cells.
Use of A2AR signaling as a promising pathway for suppression of the immune
system, was tested by Lappas et al.79 to treat acute graft-versus-host disease in a
murine model, and by Scheibner et al.80, also in a murine model, to alleviate low
molecular weight hyaluronan induced lung inflammatory and fibrosis.
General Structure of the Adenosine Receptors
Adenosine receptors have the canonical topology of G protein coupled
receptors (GPCRs) comprising seven transmembrane helices (TM1-7), each of which
is α-helical and composed of 20-27 amino acids (Figure 6). Each TM is connected by
three intracellular and three extracellular loops. In addition, there is one short
transmembrane helix, TM-8, which is parallel to the cytoplasmic surface of the
membrane.
Among the four different adenosine receptor subtypes, there are critical
areas that contribute to ligand selectivity: cysteine residues on TM3 and
extracellular loop 2 that form a disulfide bridge, the N-terminal extracellular domain,
![Page 41: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/41.jpg)
29
the C-terminal intracellular domain, and several intra- and extra-cellular loops.
Amino acid alignment indicates that the human A2AR sequence is 49%, 58% and
41% identical to human A1, A2B and A3 receptor, respectively. The extracellular
ligand binding pocket is highly conserved among the four subtypes with an average
amino acid sequence identity of 71% 81, 82.
![Page 42: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/42.jpg)
30
Figure 6 Crystal structure of human adenosine 2A receptor: it has the canonical
topology of G protein coupled receptors (GPCRs) comprising seven transmembrane
helices. Each TM is connected by three intracellular and three extracellular loops.
In addition, there is one short transmembrane helix, which is parallel to the
cytoplasmic surface of the membrane.
![Page 43: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/43.jpg)
31
Agonists and Antagonists of the Adenosine 2A Receptor
As the endogenous agnoist of the adenosine receptors, adenosine has a very
short half-life and fairly high affinity for the human A1, A2A and A3 receptors with
Kd's=310 nM, 700 nM, and 290 nM, respectively. In contrast, the binding affinity for
human A2B receptor is lower, with Kd > 10 µM83.
In order to synthesize the analog agonist of adenosine, SAR (structure
activity relationship) studies have been performed and revealed that the adenosine
core structure must largely be maintained to preserve agonist activity84-87. Most of
the better analogs contain a modification at the N6 or the 2-position of the purine
and at the 5’-position of the ribose (Figure 7A). However, these adenosine-based
ligands have very little oral bioavilability, and short half-lives, due to the presence of
three hydrogen bond donors in the sugar moiety which are important for A2AR
activation. The hydroxyl groups in the ribose also make them subject to enzymatic
metabolism.
N-ethylcarboxamidoadenosine (NECA, Figure 7B) has an ethyl amide group
at the 5’-position of the ribose, however, NECA is a nonselective agonist among the
hA1R (Kd =14 nM), hA2AR (Kd=20 nM) and hA3R(Kd =6.2 nM) receptors82. The
carbonyl group of NECA forms a hydrogen bonding with Ser277 on the TM7 domain
of the activated conformation A2AR 88. The ribose group of NECA to extends deep
into the ligand-binding pocket, forming hydrophilic interactions with His27889. The
NECA derivative, 2-Hexynyl-NECA (HEN-NECA) (Figure 7C) maintains high affinity
![Page 44: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/44.jpg)
32
toward hA2A receptor (Kd=6.4 nM), and is 10-fold more selective over the hA1
receptor90. The HEN-NECA has therapeutic potential for cardiovascular disease
because it causes a dose-dependent decrease in blood pressure91.
The 2’ position of the purine-modified adenosine analog CGS21680 (CGS,
Figure 7D), first synthesized by Hutchison et al., and found to be a moderately
selective A2AR agonist with binding affinities of 27 nM and 19 nM at the human and
rat A2A receptor, respectively92, 93. CGS is about 10-fold selective for hA2A receptor
against the hA1 receptor, more than 10,000-fold selective for hA2A receptor against
the hA3 receptor. However, it has similar potency on hA3 receptor (Kd=67 nM)82.
CGS has been reported to have an elimination half-life of only 15 min after the
intravenous administration of a 0.3-mg/kg dose94, and has good brain penetration
to bind to the caudate–putamen, nucleus accumbens, and olfactory tubercle. At high
concentration, CGS can be also found in cerebral cortex, hippocampus, and thalamus,
based on [3H]CGS-21680 quantitative autoradiography 95, 96. Although some
successful preclinical studies have shown that CGS can reduce the progression of
murine type II collagen-induced arthritis97, ameliorate the ovalbumin-sensitized
airway inflammation and reduce the eosinophil / neutrophil counts in the BAL
(bronchoalveolar lavage) fluid in a rat model98, entry into the clinical trials has been
limited by the considerable cardiovascular and CNS side-effects including
hypotension and depression of locomotor activity99.
![Page 45: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/45.jpg)
33
Antagonists of adenosine receptors usually lack the sugar moiety but contain
mono-, bi- or tricyclic heterocycles that mimic the core adenine structure of
adenosine, therefore, these antagonists have longer in vivo half-life (~hours to days)
compared to agonists (~minutes).
The structure of the antagonist can be classified as either xanthine or non-
xanthine families (Figure 8A); the natural occurring, non-selective antagonists in the
xanthine family are caffeine (Figure 8B) and theophylline (Figure 8C). The xanthine
moiety has been an important starting point for developing selective and more
water soluble AR antagonists. The most extensively studied A2AR selective xanthine
derivative is istradefylline (KW6002, Figure 8D)100, which shows about 56-fold
selectivity for A2AR versus A1 receptor in rat caudate-putamen membranes in
vitro101. Istradefylline blocks A2AR -mediated striatopallidal medium spiny neuron
modulation with the facilitation of neurotransmitter release. It increases levels of γ-
aminobutyric acid (GABA) and glutamate in the substantia nigra pars reticulate in
the 6-hydroxydopamine (OHDA) induced PD-like rat model102. Istradefylline has
also been found to increase nucleus accumbens extracellular dopamine overflow
almost 4-fold in rat in vivo101. Istradefylline has a half-life of approximately 64-69
hours in healthy subjects and has been approved in Japan to use as an adjunctive
therapy for treating Parkinson’s disease103, 104.
In the non-xanthine family, ZM241385 (Figure 8E) is one example of a potent,
bicyclic, selective A2AR antagonist over the A1 and A3 receptors, with sub-
![Page 46: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/46.jpg)
34
nanomolar Ki (hA2AR Ki=0.8 nM, hA2BR Ki=50 nM)105. In a ZM241385 bound hA2AR
crystal structure, the furan ring of ZM241385 sits deep inside the ligand-binding
cavity with its oxygen atom forming a hydrogen bond to Asn253. The furan ring
forms hydrophobic-hydrophobic interactions with His250 and Leu249. The furan
ring is in close proximity (3Å ) to the highly conserved Trp246. By restricting the
motion of Trp246, the furan ring helps to constrain the receptor in the inactive
conformation106, 107. Consistent with the distribution of A2AR in striatum, ZM241385
dose-dependently increased the L-DOPA-induced dopamine release in intact and
malonate-lesioned rats108. In a mouse cancer model, ZM241385 showed an antigen-
specific CD8+ T cells antitumor immune response by eradicating tumor metastasis
and growth109.
![Page 47: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/47.jpg)
35
Figure 7 Agonists of the A2A receptor: (A) Adenosine; (B) N-
ethylcarboxamidoadenosine (NECA); 2-Hexynyl-NECA (HEN-NECA); (D) 3-[4-[2-
[ [6-amino-9-[(2R,3R,4S,5S)-5-(ethylcarbamoyl)-3,4-dihydroxy-oxolan-2-yl]purin-
2-yl]amino]ethyl]phenyl]propanoic acid (CGS21680, CGS). (de Lera Ruiz, M., Lim,
Y.H. & Zheng, J., J Med Chem, 57, 3623-3650, 2013)
![Page 48: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/48.jpg)
36
Figure 8 Antagonist of the A2A receptor: (A) Xanthine; (B) Caffeine; Theophylline; (D)
8-[(E)-2-(3,4-dimethoxyphenyl)vinyl]-1,3-diethyl-7-methyl-3,7-dihydro-1H-purine-
2,6-dione (Istradefylline); (E) 4-(2-[7-Amino-2-(2-furyl)[1,2,4]triazolo[2,3-
a][1,3,5]triazin-5-ylamino]ethyl)phenol (ZM241385). (de Lera Ruiz, M., Lim, Y.H. &
Zheng, J., J Med Chem, 57, 3623-3650, 2013)
![Page 49: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/49.jpg)
37
Expressed Protein Ligation
Expressed protein ligation (EPL) is a technique that allows for an N-terminal
cysteine-containing peptide to be ligated to the C-terminus of a recombinant protein
fragment possessing a C-terminal thioester group generated through the action of
an intein (internal protein sequence)110. Inteins are protein domains analogous to
introns in RNA, which can splice themselves out from two flanking protein domains
or polypeptide chains (exteins, external protein sequence) resulting in the joining of
the two flanking parts together111.
In this way, EPL has been used by researchers for various purposes such as
flourophore labeling112, isotope incorporation for NMR spectrometry113, generating
protein chips114, and incorporation of peptides containing posttranslational
modifications115. As relevant to this thesis research, EPL is used to install a potent
A2A receptor, selective agonist CGS, onto the C terminus of truncated mouse IgG3 Fc
domain, for the extending of CGS half-life and the reduction of non-specific toxicity
in vivo116.
The intein for the EPL reaction has been engineered as stalled in the first step
of the self-splicing reaction. In this thesis project, the protein of interest is the
mouse IgG3 Fc domain, fused with an intein-CBD (chitin binding domain) at the C
terminus of Fc protein. The CBD domain is used as an affinity tag for chitin bead
binding. The junction between Fc and the intein is catalyzed by the intein to form a
C-terminal thioester, which is in equilibrium state with the native amide bond. By
![Page 50: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/50.jpg)
38
adding the reactive thiol, sodium mercaptoethanesulfonate (MESNA), the transient
thioester between Fc domain and the intein can be replaced by the MESNA thioester
at full stoichiometry. The small molecule, C-CGS (CGS modified with a six
polyethylene glycol linker containing a cysteine) can be added to further displace
the thioester between Fc domain and MESNA, followed by an acyl rearrangement to
form the amide bond (Figure 9).
![Page 51: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/51.jpg)
39
Figure 9 Expressed protein ligation (EPL). The Fc domain is expressed as a fusion
with the intein-CBD domains, and purified over a column of chitin beads. The Fc
domain is cleaved from the intein with a thiol-containing small molecule such as
MESNA (mercaptoethanesulfonate). The C-CGS, CGS modified with a hexameric
ethylene glycol linker containing a cysteine, is then ligated to the C-terminus of the
thioester containing Fc to form the Fc-CGS.
![Page 52: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/52.jpg)
40
Fc Domain of Immunoglobulin G and Its Glycosylation
Immunoglobulin G 117 is a Y-shaped protein produced by plasma cells that is
composed of light chains and heavy chains and has a molecular weight of
approximately 150 kDa (two 50 kDa heavy chains and two 25 kDa light chains). IgG
is the most prevalent class in the serum and non-mucosal tissues out of five
antibody subclasses: IgA, IgD, IgE, IgG and IgM.
IgG possesses two functional units: the region of antigen recognition known
as the Fab (fragment, antibody binding) that is made up of one constant and one
variable domain from each heavy and light chain of the antibody118. The second
region is called the Fc (fragment, crystallizable) region. It is composed of two heavy
chains and has three constant domains (CH1, CH2 and CH3). The Fab and Fc regions
are bridged by a flexible hinge. By binding to a specific class of Fc receptors and
other immune molecules such as complement proteins, Fc can mediate different
immune responses including lysis of cells, and the degranulation of mast cells,
basophils and eosinophils119-121.
IgG plays an important role in combatting various pathogens and toxins, and
is the only class of immunoglobulins known to be transferred from mother to
offspring to provide short-term passive immunity122, 123. The specific Fc receptor
type carrying out this process is the neonatal Fc receptor, FcRn124, which is located
in the intestinal epithelial cells, and which helps in the first few weeks of neonatal
life in mammals to take up the IgG from milk125.
![Page 53: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/53.jpg)
41
The FcRn is a heterodimer consisting of an MHC class I-like heavy chain and a
β2 microglobulin light chain. The FcRn binds to the CH2-CH3 hinge region of IgG24.
The Fc portion of IgG binds with high affinity to FcRn at an acidic pH (<6.5) as found
in the endosome but not at the pH of =7.4 and therefore, FcRn can protect IgG from
protease dependent degradation126. In FcRn-deficient mice, the serum IgG is
reduced to 20 to 30% of the level in the wild type, and the half-life of IgG is reduced
from about 6–8 days to about 1 day, which is the typical half-life of other serum
proteins that are not freely filtered by the kidneys127, 128. This evidence strongly
suggests that FcRn selectively extends the half-life of IgG by bypassing its
degradation in the circulation.
The Fc domain is a homodimer carrying two N-glycans at the conserved
N297 site of the CH2 domain. The core glycan is usually biantennary with 2 N-
acetylglucosamines (GlcNAc) linked to 3 mannoses. There are two more GlcNAcs a
linked to mannose in the human IgG, N-linked heptasaccharide core, and this can be
differentially decorated with a core fucose (1, 6-linkage), a bisecting GlcNAc, a
terminal galactose, and then a terminal sialic acid129 (Figure 10A). The N297
glycosylation has been proven to maintain the open conformation of the CH2
domain and this can enhance interaction with Fcγ receptors130. Upon removal of the
N297 glycan, the open conformation is shifted to a closed conformation and this
weakens Fcγ receptor binding (Figure 10B). Not only do the Fc domains lacking
glycosylation at N297 have diminished Fcγ receptor binding, they also lack the
![Page 54: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/54.jpg)
42
ability to initiate a robust ADCC response131. Compared to the CH2 domains, the CH3
domains are more rigid and do not change their structure between the open and
closed conformation of the Fc.
![Page 55: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/55.jpg)
43
Figure 10 Glycosylation on Fc domains of immunoglobulin G. (A) The structure of a
full-length biantennary complex type N-glycan attached to the Asn297-glycan in the
Fc domain. (Huang, W. et al. J Am Chem Soc, 134, 12308-12318, 2013) (B) Schematic
representation of Fc conformation in glycosylated and deglycosyaltion states.
(Borrok, M. J. et al., ACS Chem Biol, 9, 1596-1602, 2012)
![Page 56: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/56.jpg)
44
Summary
The small molecules drug, CGS21680, has an extremely short half-life and
varied cell targets in the immune system, the heart and the central nervous system.
Recently, antibody-drug conjugates (ADCs) have shown promise in cancer
treatment research but still suffer from the non-specific conjugation and a non-
homogeneous drug to antibody ratio. In the present thesis project, we have
successfully generated an Fc-small molecule conjugate, Fc-CGS, by a site-specific
method called expressed protein ligation. The Fc-CGS retains the agonist properties,
and in a mouse model of inflammatory pneumonitis it shows enhanced
pharmacokinetic and pharmacodynamic performance compared with CGS itself.
Expressed protein ligation may be broadly applicable for generating bivalent
protein-based drugs to improve the pharmacokinetic properties of small molecule
therapeutics (Figure 11).
![Page 57: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/57.jpg)
45
Figure 11 The schematic model of Fc-CGS in immune system. Fc-CGS is a bivalent
drug which crosslinks between antigen presenting cell (APC) and T cell. By
conjugating Fc domain to CGS, the in vivo half-life of CGS is enhanced and the non-
specific toxicity is reduced by Fc/FcR binding.
![Page 58: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/58.jpg)
46
Chapter 2
Generation of Protein-Small Molecule Conjugate Fc-CGS
Introduction
As discussed in chapter 1, protein-based drugs have been given considerable
attention, revolutionizing the treatment of a wide range of diseases including
cancers, cardiovascular disorders, and autoimmune diseases. Examples of the
medicinal triumphs in this regard include the generation of recombinant insulin for
diabetes mellitus, erythropoietin for anemia, rituximab for non-Hodgkins
lymphomas, Herceptin for breast cancer, and soluble TNF receptor for Crohn’s
disease and rheumatoid arthritis132. By including Fc domain fusion proteins (for
example fusing the TNF receptor to the Fc portion of Ig) the half-life of the
aforementioned compounds is dramatically increased133. Recently antibody-drug
conjugates (ADCs) development has emerged as an important new technology,
becoming an integral part of pharmaceutical industry drug development and
showing tremendous success in clinical applications. ADCs combine the advantages
of both protein and small molecule drugs: they can show increased serum stability
and improved the target specificity relative to conventional protein and small
molecule agents. However, challenges such as non-specific conjugation and
inconsistent stoichiometries remain.
In this thesis project we study the small molecule, CGS21680 (CGS), a
synthetic potent agonist of adenosine 2A receptor (A2AR), which mediates negative
![Page 59: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/59.jpg)
47
feedback of the immune system, suppressing inflammation and T cell effector
functions.134, 135. Although CGS is a potent and selective A2AR agonist, its short half-
life in vivo (10-20 min)94 renders it a challenge for clinical development. In addition
to its short half-life, CGS has pharmacodynamics limitations as it targets not only
lymphocytes, but also the brain and heart. Because of these additional targets,
immunomodulatory A2AR agonists could result in neuro- or cardio-toxicity. We
apply expressed protein ligation technology to link the small molecule CGS21680 to
the immunoglobulin Fc region for use as a therapeutic strategy for immune
disorders.
As a stabilizing group in the anti-TNFα drug etanercept, the Fc domain of an
antibody is highly resistant to proteolytic degradation in vivo, with a multiday half-
life in part due to interactions with the neonatal Fc receptor (FcRn). Attaching CGS
to an Fc domain from immunoglobulin G could thus confer greater stability to CGS,
preventing CGS internalization and thus metabolism by cells. In addition to
prolonged drug stability, an Fc-CGS conjugate might show enhanced localization to
immune complexes given the presence of Fc receptors on antigen presenting cells.
To express Fc-intein-CBD (chitin binding domain) recombinant protein, we
initially chose E. coli as a fast, high-yield expression system. However, although
bacteria provide the advantage of being able to produce more than 30 mg of
recombinant protein per liter of culture, the lack of posttranslational modification
(PTM) in E. coli rendered the recombinant protein highly insoluble and unfolded. A
![Page 60: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/60.jpg)
48
refolding technique has thus been used to generate the folded and functional Fc-CGS
conjugate. The poor stability of refolded Fc-CGS led us to shift our expression
system from E. coli to Spodoptera frugiperda (Sf9) insect cells, using the secretion
signal Honey Bee Melittin (HBM) to get Fc-intein-CBD secreted and glycosylated. As
such, the resulting Fc-CGS is a folded, functional, and highly stable protein-drug
conjugate that is compatible with applications in cell culture and in vivo.
Methods
Chemical synthesis
CGS21680
CGS21680 (Figure 7D) was synthesized as previously described (Figure 12)92.
Briefly, 2,2-dimethoxypropane and a camphorsulfonic acid catalyst were used to
protect the 2’,3’-diol of 2-chloroadenosine as an acetonide. Oxidation of the 5’-
hydroxyl substituent to the corresponding carboxylic acid was achieved using
potassium permanganate and aqueous potassium hydroxide. The carboxylic acid
was then converted to the acid chloride with thionyl chloride and a catalytic amount
of N,N-dimethylformamide. Gaseous ethylamine was bubbled through a solution of
the crude acid chloride in dichloromethane to generate the desired amide
intermediate. tert-Butyl 3-[4-(2-aminoethyl)phenyl]propionate was freshly
prepared from p-bromophenylacetonitrile and tert-butyl acrylate via a Heck
reaction and then immediately reacted with the aforementioned amide intermediate
to generate the penultimate ester. Simultaneous hydrolysis of the ketal and the tert-
![Page 61: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/61.jpg)
49
butyl ester in the presence of aqueous hydrochloric acid yielded the final product,
CGS, as a hydrochloride salt. CGS produced in this way showed spectroscopic data
consistent with those reported previously (Figure 13&14).
tert-Butyl (14-amino-5-oxo-1,1,1-triphenyl-9,12-dioxa-2-thia-6-
azatetradecan-4-yl) carbamate
N-[(1,1-Dimethylethoxy)carbonyl]-S-(triphenylmethyl)-L-cysteine (1.00 g,
2.15 mmol) and carbonyldiimidazole (CDI, 0.40 g, 2.47 mmol) were dissolved in
anhydrous THF (20 mL) and allowed to stir at room temperature for 2 hours. This
solution was then added dropwise via an addition funnel to 2,2'-[1,2-
ethanediylbis(oxy)]bis-ethanamine (6.28 mL, 43.0 mmol) dissolved in anhydrous
THF (60 mL) at 0 C. The flask was purged with argon and the reaction was stirred
at 0 C for 1 hour after which it was allowed to warm to room temperature and
stirring was continued overnight (~ 16 hours). After completion, as evidenced by
thin-layer chromatography, the reaction was concentrated to half the volume in
vacuo and then dichloromethane (250 mL) was added and the organic layer was
washed with brine (5 x 50 mL), dried over Na2SO4, filtered and concentrated in
vacuo. The oily residue obtained was dissolved in dichloromethane and purified
using flash column chromatography (basic Al2O3, 5% methanol/dichloromethane).
The title compound was isolated as a pale yellow, viscous oil (0.80 g, 63%). 1H-NMR
(500 MHz, CDCl3): δ 7.42 (m, 6H), 7.29 (m, 6H), 7.22 (m, 3H), 6.75 (br, 1H), 5.37 (d, J
= 8.2 Hz, 1H), 4.00 (br, 1H), 3.47 (m, 11H), 2.85 (t, J = 5.2 Hz, 2H), 2.65 (br, 1H), 2.54
![Page 62: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/62.jpg)
50
(m, 1H), 1.43 (s, 9H) (Fig. 14). ESI-MS: [M+H]+ = 593.3 m/z , found: [M+H]+ = 594.3
m/z (Figure 15).
C-CGS (Figure 16)
tert-Butyl (14-amino-5-oxo-1,1,1-triphenyl-9,12-dioxa-2-thia-6-
azatetradecan-4-yl)carbamate (1, 0.20 g, 0.33 mmol) was dissolved in anhydrous
tetrahydrofuran (3 mL) and added to PAL resin (MidWest Bio-Tech) (0.10 g, 0.09
mmol) suspended in anhydrous THF (2 mL). Glacial acetic acid (0.10 mL) was added
to this mixture and the reaction was allowed to stir at room temperature for 1 hour.
Then, NaBH(OAc)3 (0.16 g, 0.77 mmol) was added and stirring was continued
overnight. The resin was then washed with methanol (5 x 5 mL),
dimethylformamide (5 x 5 mL) and dichloromethane (5 x 5 mL) in a Bio-Rad Poly-
Prep Chromatography Column.
The following Fmoc-8-amino-3,6-dioxaoctanoic acid (139 mg, 0.35 mmol
each reaction) and CGS 21680 (CGS, 22.5 mg, 0.041 mmol prepared as previously
described) coupling reactions were based on standard solid phase peptide synthesis
methodology. Coupling was carried out at room temperature for 3 hours with 5%
diisopropylethylamine (1.8 mL) and O-(Benzotriazol-1-yl)-N,N,N′,N′-
tetramethyluronium hexafluorophosphate (HBTU, 133 mg, 0.35 mmol).
Fluorenylmethoxycarbonyl deprotection was carried out at room temperature for 1
hour with 20% piperidine (3 mL). The solvent used for both reactions was N-
![Page 63: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/63.jpg)
51
methyl-2-pyrrolidone (NMP). The crude product was cleaved from the PAL resin
with 4 mL of a 95% TFA (trifluoroacetic acid), 2.5% ddH2O and 2.5% tri-isopropyl-
silane solution at room temperature for 1 hour, dried under vacuum, resuspended
in 12 mL of ddH2O containing 0.05% TFA and then filtered through a 0.2 µm filter to
remove all insoluble particles. The filtrate was further purified by reverse-phase
HPLC, Varian Dynamax Microsorb 100-5 C18 column (250 x 21.4 mm), gradient:
5%-60% acetonitrile/H2O,45 min; 60%-100% acetonitrile/H2O,10 min, 100%
acetonitrile, 10 min; 100%-5%, 10 minutes, the flow rate was 10 mL per minute.
The final purified product, C-CGS, was lyophilized and isolated as a fine white
powder (35 mg, 59 %). Compound characterization was done using matrix assisted
laser desorption ionization (MALDI) mass spectrometry (Figure 17).
Protein Purification & Expressed Protein Ligation
E. coli Expression
The Fc domain of mouse IgG3 gene (aa 104-330), originally from the pFUSE-
mIgG3-Fc1 plasmid (InvivoGen), was subcloned in frame into the pTXB1 vector
(NEB) by restriction enzymes NdeI and EcoRI, which contains the GyrA intein from
Mycobacterium xenopi and the chitin-binding domain (CBD). This plasmid construct
was used for E. coli (BL21) expression. Initial O.D. (600 nm) was 0.15-0.2 and
growth allowed until O.D.=0.6-0.8 was reached at 37 °C. IPTG (Isopropyl β-D-1-
thiogalactopyranoside, Fisher Scientific) was then added with the final
![Page 64: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/64.jpg)
52
concentration at 1 mM, the culture was harvested after 3 hours, 37 °C in the shaking
incubator (200 rpm). Cell pellets were collected by centrifugation at 6,000 rpm for
10 minutes before mechanical lysis.
A french press was used for bacterial lysis (lysis buffer: 20 mM Tris-
HCl, pH=7.5, 500 mM NaCl, 1 mM EDTA, 0.1 mg/mL PMSF), inclusion bodies were
pelleted at 27,000g / 30 minutes at 4 °C. The pellets were washed twice with a
buffer of 100 mM Tris-HCl, pH=7.5, 1M urea, 2% Triton X-100, and 1mM EDTA to
remove impurities such as membrane proteins. The final wash was in 100 mM Tris-
HCl, pH=7.0, 5 mM EDTA, 1 mM TCEP and 0.1 mg/mL PMSF. The recombinant Fc-
intein-CBD inclusion body protein was then extracted in a buffer of 50 mM Tris-HCl,
pH=8.0, 8 M urea, 2 mM EDTA, and 0.5 mM TCEP at 4 °C overnight. The solution was
then dialyzed against 50 mM Tris-HCl, pH=7.0, 2 mM EDTA, 500 mM NaCl, 3.75 M
urea stepwise for further chitin bead (NEB) binding overnight. 200 mM MESNA
(sodium 2-sulfanylethanesulfonate) in the same buffer condition was used to
generate Fc-MESNA intermediate through thioester exchange in the presence of
3.75M urea at room temperature for 72 hours in a plastic column (BioRad, 2.5 cm
diameter) containing the chitin-beads. The eluent of Fc-MESNA was concentrated by
10 KDa MWCO amicon (Millipore) to 5 mg/mL. C-CGS (1-2 mM) was then added to
the Fc-MESNA solution for ligation over 72 hours at room temperature.
![Page 65: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/65.jpg)
53
The ligated Fc-CGS product was then further purified using an FPLC (AKTA)
system, Superdex 200 (GE Healthcare) gel filtration column, eluted with 50 mM Tris
pH=7.0, 500 mM NaCl, 2 mM EDTA, 3M Urea, 0.4 mL/ min condition. The size and
purity of Fc-CGS was characterized by 10% SDS PAGE stained with Coomassie and
collected for refolding. Refolding was initiated with dialysis against 1X PBS, 500 mM
NaCl, 1mM EDTA, 10% glycerol, 2M urea, and 5 mM BME for 8 hours. The dialysis
buffer was then changed to 1X PBS, 500 mM NaCl, 1mM EDTA, 10% glycerol, 1 M L-
arginine, and 5 mM BME, followed by a similar buffer that contained 0.5M L-arginine
--> 0.4 M L-arginine. Under the 0.4 M L-arginine conditions, Fc dimerization was
performed under 1X PBS, 500 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.4 M Arg, 4 mM
Cysteine, and 0.5 mM Cystine at 10 °C for 10 days. After Fc dimerization, the protein
was further dialyzed and stored in 1X PBS, 250 mM NaCl, 1 mM EDTA, 10% glycerol,
0.4 M L-arginine, 4 °C . Whenever needed, Fc-CGS was further dialyzed in 1X PBS, 0.1
M L-arginine, 1 mM BME right before cell-based assays or animal studies136-138, the
C-CGS was replaced by cysteine to generate Fc as a control (Figure 18).
Spodoptera frugiperda (Sf9) insect cell expression of Fc-intein-CBD
The Fc-intein-CBD construct in pTXB1 vector as stated above was then used
as a PCR template for insertion of the secretion signal Honey Bee Melittin (HBM:
MKFLVNVALVFMVVYISYIYA )-M2 FLAG-HisX8-TEV cleavage site-KpnI site at the N-
terminus (Figure 19). The nested PCR was performed with the following primers:
5’-His-TEV-KpnI site Fc:
![Page 66: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/66.jpg)
54
TCACCATCACCATCACGAAAACCTGTATTTTCAGGGTACCCCTAGAATACCCAAGCCCAG
5’-HBM_FLAG-His-TEV:
CATCTATGCGGATTACAAGGATGACGATGACAAGCATCACCATCACCATCACCATCACGA
5’-HBM-FLAG-His:
TTTATGGTCGTATACATTTCTTACATCTATGCGGATTACAAGGATGACGATGACAAGCA
T
5’-BamHI-HBM:
ATAACTGGATCCATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTATACATT
3’-CBD-HindIII:
ATAATTAAAAGCTTTCATTGAAGCTGCCACAAGG
The resulting PCR product was inserted into plasmid pFAST Bac 1
(Invitrogen), by digesting with BamHI and HindIII and then ligating using T4 DNA
ligase. The generation of baculovirus was carried out according to manufacturer’s
instructions (Bac-to-Bac Baculovirus Expression System, Invitrogen, 10359-016)139.
Sf9 insect cells were grown in serum-free media (Sf-900 III, Invitrogen) in
suspension culture at 27°C. Fc-intein-CBD recombinant protein was expressed and
secreted by Sf9 insect cells using a multiplicity of infection (M.O.I.) equal to 1 over
![Page 67: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/67.jpg)
55
72 hours. The supernatant was collected by centrifugation of the insect cell media
mixture at 1,500 rpm for 10 minutes and the cell pellet was discarded. The
supernatant containing the fusion protein was then passed through a 0.2 µm filter to
remove all cell debris and EDTA (1 mM) and phenyl-methyl-sulfonyl fluoride (PMSF,
85 µg/mL) were added to the filtrate as protease inhibitors. Fc-intein-CBD fusion
protein was purified by passing the supernatant over a bed of chitin beads (NEB, 2
mL bed volume per liter culture) by gravity flow. The beads were washed with 50
mL of phosphate buffered saline (PBS) 5 times. To initiate the ligation reaction, two
column volumes of 400 mM sodium 2-mercaptoethanesulfonate in PBS (pH = 7.2-
7.3) containing 500 µM of C-CGS was added to the column. The column was purged
with argon and the mixture was left to stand at room temperature over 72 hours.
Reaction progress was monitored by coomassie blue stained SDS-PAGE, and upon
completion (72 hours), the product was eluted from the column with one column
volume of PBS 5 times, and then dialyzed against 5 liters of PBS with a total of four
buffer exchanges in the cold room (4˚C). Each buffer exchange was performed for at
least 8 hours, using 10 kDa molecular weight cutoff (MWCO) SnakeSkin dialysis
tubing from Thermo Scientific. The dialyzed Fc-CGS protein solution concentrated to
0.5-1 mg/mL and further dialyzed again in a 10 kDa MWCO dialysis cassette
(Slidealyzer) into 2 liters of PBS twice over 24 hours to remove excess unreacted
small molecule and reducing agent. Fc-CGS, estimated to be about 90% pure by
Coomassie-stained SDSPAGE (Figure 20), was flash frozen and stored at -80 ˚C. Mass
spectrometry analysis of the deglycosylated sample was consistent with the correct
structure (Figure 21).
![Page 68: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/68.jpg)
56
Liquid chromatography mass spectrometry (LC-MS) analysis of Fc and Fc-CGS
LC-MS was performed on a LXQ system (Thermo Scientific) with a Poroshell
300SB-C8 column (5 um, 75 x 1.0 mm). The Fc samples were treated with 50 mM
DTT and heated at 55 °C for 20 minutes then subjected to LC-MS analysis. The LC
was performed at 60 °C eluting with a linear gradient of 20-40% acetonitrile : water
containing 0.1% formic acid within 10 minutes at a flow rate of 0.25 mL/min.
Size exclusion chromatography
25 μg of Fc-CGS in 50 μL phosphate-buffered saline (PBS) was injected into a
Superdex 75 column (10x300 mm) through a 125 μL injection loop on an AKTA
FPLC. The flow rate = 0.5 mL/min, total elution volume was 1.5 column volumes
with fraction volumes of 0.5 mL.
Pharmacologic characterization of Fc-CGS from E. coli
IL-2 secretion
Spleens and inguinal lymph nodes from naïve 5C.C7 (TCR transgenic, specific
to Pigeon Cytochrome C, PCC) mice140 were harvested and pulverized in a cell
strainer (BD Bioscience). The red blood cells were removed by using ACK lysis
buffer. The remaining of cells were then suspended in complete media containing
45% RPMI 1640, 45% Click’s Medium Eagle-Hank’s amino acid, 10% fetal calf serum,
4 mM glutamine, 2.5µg/ml gentamycin, 100 U of penicillin, 100 µg/ml streptomycin,
![Page 69: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/69.jpg)
57
and 50µM 2-mercaptoethanol. Anti-CD3 monoclonal antibody was coated on a 96-
well flat bottom plate by adding 100 µL of 1µg/mL anti-CD3 at 37 ˚C for 3 hours, and
then washed with 1X PBS three times. 500,000 total cells were cultured in each well
and spiked with 3µg/mL anti-CD28. After incubation with different CGS forms at 37
˚C for 3 hours, cell culture supernatant was harvested for IL-2 ELISA quantification.
Adoptive transfer
Clonotypic CD4+ T cells were harvested from 6.5+ transgenic mice with a
B10.D2 background (using the same protocol as described for the 5C.C7 cells). The
unfractionated population was eluted through a CD4+ MACS cell separation column
(Miltenyl Biotec) to enrich for CD4+/6.5+/Thy1.1+ cells. The presence and quantity
of clonotypic T cells were confirmed by staining with FITC (fluorescein
isothiocyanate)-conjugated anti-CD4, PE (R-phycoerythrin)-conjugated anti-6.5, and
APC (Allophycocyanin)-conjugated anti-Thy1.1 antibodies followed by flow
cytometry analysis. Cells were washed and resuspended in 200 µL PBS buffer
containing 1 million clonotypic T cells for retro-orbital injection into wild type
(B10.D2) mice along with 5 x 106 PFU (Plaque-forming unit) HA peptide-expressing
vaccina virus for T cell activation. Recipient mice were given either no drug, a single
dose intraperitoneally of CGS (5 µmol/kg, 2.5 mg/kg), daily CGS (5 days in a row), or
Fc-CGS (20 nmol/kg, 0.5 mg/kg). The drug injection volume used for all treatments
was 200 µL.
![Page 70: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/70.jpg)
58
Figure 12 Synthesis process of CGS21680. a: 2,2-dimethoxypropane
camphorsulfonic acid, RT, 16 hrs; b: KMnO4/KOH/H2O, 72 hrs; c: (i) SOCl2, DMF, 0 °C
→ 50 °C, 90 mins; ethylamine, DCM, 0 °C → RT, 1 h; d: tbutyl acrylate, Pd(OAc)2, (o-
Tol)3P, ET3N, 90 °C, 6 hrs; e: H2, Pd/C, HCl, 2-propanol, RT, 7 hrs; f: neat, 130 °C, 4
hrs, g: 1 N HCl, 65 °C, 1hr.
![Page 71: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/71.jpg)
59
Figure 13 The 1H-NMR (500 MHz, CD3CN) of CGS21680: 3-[4-[2-[ [6-amino-9-
[(2R,3R,4S,5S)-5-(ethylcarbamoyl)-3,4-dihydroxy-oxolan-2-yl]purin-2-
yl]amino]ethyl]phenyl]propanoic acid.
![Page 72: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/72.jpg)
60
Figure 14 MALDI-TOF mass spectrum of the CGS21680 (matrix: 2,5-
dihydroxybenzoic acid).
![Page 73: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/73.jpg)
61
Figure 15 The 1H-NMR (500 MHz, CDCl3) of C-CGS intermediate: tert-Butyl (14-
amino-5-oxo-1,1,1-triphenyl-9,12-dioxa-2-thia-6-azatetradecan-4-yl) carbamate.
![Page 74: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/74.jpg)
62
Figure 16 Synthetic scheme for C-CGS. The hexa-poly(ethylene) glycol linker is
approximately 100 Å .
![Page 75: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/75.jpg)
63
Figure 17 Characterization of C-CGS. Left: The chromatogram of HPLC from the C-
CGS purification. Right: The MALDI-TOF spectrum of C-CGS (matrix: 2,5-
dihydroxybenzoic acid).
![Page 76: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/76.jpg)
64
Figure 18 SDS-PAGE analysis (Coomassie blue) of refolded and dimerized Fc and
Fc-CGS. Left: The Fc and Fc-CGS after L-arginine refolding and stored in [L-
arginine]=100 mM condition; Right: The Fc and Fc-CGS under non-reducing
condition after cysteine/cystine dimerization.
![Page 77: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/77.jpg)
65
Figure 19 Schematic representation of the Fc-intein-CBD construct expressed by
the Sf9 cells. The Fc-intein-CBD fusion protein is secreted from Sf9 insect cells with a
Honey Bee Mellitin (HBM) secretion signal, followed by a FLAG and 8X His tag, TEV
cleavage site and a spacer sequence N-terminal to the start of the Fc-intein-CBD
fusion protein. The HBM directs the protein into secretory pathway where the Fc
portion is glycosylated.
![Page 78: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/78.jpg)
66
Figure 20 Expressed protein ligation for the generation of Fc-CGS. (A) Generation of
Fc-CGS: C-CGS is ligated to the Fc-intein-CBD expressed and secreted from Sf9 cells.
(B) SDSPAGE analysis (Coomassie blue) of the ligated products.
![Page 79: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/79.jpg)
67
Figure 21 LC-MS analysis of Fc (left) and Fc-CGS (right). Fc was treated with
PNGase F at 37 °C for 18 hours, followed by treatment with 50 mM DTT at 55 °C for
20 minutes to reduce disulfide bonds prior to LC-MS analysis. The measured [M+H]+
of deglycosylated Fc and Fc-CGS are 29934 and 31271 (m/z) and the calculated M.W.
of Fc and Fc-CGS are 29933 and 31271, respectively.
![Page 80: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/80.jpg)
68
Figure 22 Extracellular IL-2 ELISA assay: 18 hours post drug incubation of naïve
5C.C7 (TCR transgenic, specific to Pigeon Cytochrome C, PCC) CD4+ T cells activated
by plate bound anti-CD3 (1 µg/mL) and soluble anti-CD28 (3 µg/mL) with different
CGS forms (Fc-CGS was expressed from E. coli) as indicated.
![Page 81: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/81.jpg)
69
Figure 23 In vivo clonal CD4+ T cell expansion inhibition by Fc-CGS. HA-specific TCR
transgenic CD4+ T cells (6.5) were adoptively transferred into B10.D2 recipient
mice. Transferred cells were activated by injecting vaccine HA and the recipient
mice were given different drugs as indicated. [CGS] = 4.5 nmoles/g ; [Fc-CGS] = 0.02
nmoles/g (Fc-CGS was expressed from E. coli).
![Page 82: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/82.jpg)
70
Results and Discussion
Initial attempts to produce large amount of Fc-intein-CBD fusion protein in E.
coli were not accomplished. Although efficient and high-yielding, the major protein
of E. coli expression resulted in insolubility in inclusion bodies. Protein solubility
was not increased by reducing the temperature of bacterial culture. In order to
make functional Fc-CGS, the Fc-intein-CBD recombinant protein containing the
mouse IgG3 Fc domain was extracted from the inclusion bodies with 8M urea. After
extraction, the extract was dialyzed into 3 M urea for chitin resin binding. The CBD
was functional under these conditions, allowing further purification. To determine
the functionality of the intein under partially unfolded condition, several urea
concentrations (from 1 to 5 M) were tested with 200 mM MESNA. The 3.75 M
urea+200 mM MESNA yielded the most Fc-MESNA intermediate based on 10% SDS
PAGE analysis stained with Coomassie.
After the generation of Fc-MESNA, the refolding procedures had been
performed in different buffer conditions. The first trial was to remove urea or
glycerol gradually by dialysis, however this method failed to refold the protein and
induced major protein precipitation after the urea and glycerol was fully removed.
The final product was hardly visible by Coomassie-stained SDS PAGE. The 1 M L-
arginine method was somewhat successful in producing folded Fc-CGS, and the
overall Fc-CGS generated was, in principle, sufficient initiate cell-based assays and
animal models necessary for this project. However, insoluble protein precipitation
was observed upon complete removal of L-arginine. 100 mM L-arginine was the
![Page 83: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/83.jpg)
71
minimum concentration needed to maintain the protein in solution. Unfortunately,
attempts with cysteine/cystine redox treatment did not lead to significant
improvement of protein solubility and stability. Yet another drawback, L-arginine
has also been shown to induce T cell proliferation at concentration of 100 µM-
arginine or higher141 and has also been demonstrated to induce the T cell
immunity142, 143. Such effects were of significant concern for our pharmacologic
studies.
Other than instability and insolubility of the Fc domain, one potential
challenge for the renatured Fc protein is, each mouse lgG3 Fc domain has 5
cysteines and an extra cysteine from EPL reaction. During the refolding and
renaturing processes, each of the cysteines may randomly form a disulfide bridge
with another cysteine either intra- or inter-molecularly. Without properly formed
disulfide bonds, the protein would likely not be functional and would also be
unstable.
Despite the challenges encountered with the E. coli expression system for the
generation of Fc-CGS, preliminary ex vivo and in vivo experiments were performed.
Results from these experiments suggested that Fc-CGS might have enhanced
properties as an immunomodulator compared with CGS alone. To investigate the
functional effects of Fc-CGS on immune response, we stimulated T cells (5C.C7
splenocytes treated with canonical stimulation, anti-CD3 and anti-CD28) and
measured interleukin 2 (IL-2) secretion by ELISA. This experiment showed a
![Page 84: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/84.jpg)
72
significant (approximately 70%) reduction in IL-2 24 hours after treatment with
62.5 nM Fc-CGS. In comparison, higher doses of CGS and C-CGS were needed to show
similar effect (Figure 22). In the in vivo adoptive transfer experiment, 6.5+ CD4+ T
cells were transferred and activated in the host mice for 5 days. The daily CGS
treatment group showed similar efficacy with single dose Fc-CGS in terms of
suppressing clonotypic T cell expansion. However, each CGS dose was > 200 times
that of Fc-CGS (Figure 23). Over time, it proved difficult to rely on bacterially
produced Fc-CGS because of its instability in storage, batch-to-batch variability, and
low production efficiency. However, as we were sufficiently encouraged by the high
potency of Fc-CGS in pharmacologic assays, we pursued a better way to make the
Fc-CGS conjugate with a eukaryotic expression system, ultimately settling on the use
of a baculovirus/Sf9 cell expression approach.
As the importance of the glycosylation of Fc has been stated above130, 131, we
hypothesized that rough endoplasmic reticulum- Golgi apparatus secretory pathway
may be effective for the appropriate post-translational modifications. Hence, we
used a baculovirus expression system and Sf9 cells115 to express the same Fc-intein-
CBD with an N-terminal secretion signal sequence (honey bee mellitin, HBM) and a
FLAG tag (for immunostaining). The secreted Fc-intein-CBD protein from the insect
cell culture supernatant was isolated and purified with chitin resin and then the Fc
thioester was formed by treatment with MESNA, releasing the Fc moiety as the free
thioester into solution. The Fc thioester was subsequently reacted with C-CGS (CGS
synthetically fused to a hexa-ethylene glycol spacer followed by a Cys, (Figure 16),
![Page 85: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/85.jpg)
73
to generate Fc-CGS. The length of the spacer, about 100 Å in extended conformation,
and its connection site on CGS, were designed based in part on the A2AR X-ray
structure as well as agonist studies on prior synthetic CGS analogs87, 144. This
arrangement was intended to provide for an adequate bridge of the Fc and CGS to
allow for dual receptor occupancy by the Fc-CGS conjugate. As a control, the Fc
protein was prepared in a similar fashion but cysteine was used in place of C-CGS
during the ligation step.
In summary, both E. coli and Sf9 can express Fc-intein CBD recombinant
protein. However, E. coli does not have the secretory pathway necessary to properly
incorporate post-translational modifications into the Fc domain. Although the
addition of L-arginine successfully refolded Fc, the shelf-life of the resulting
conjugate was approximately two weeks or less. This abbreviated length of time
compromises pharmaceutical development. By using a eukaryotic expression
system and installing the HBM tag, we generated a pure, well-folded, glycosylated Fc
domain with a substantially extended shelf-life-- either frozen in -80 ˚C or 4 ˚C. The
increased stability of the Fc domain can be partially attributed to its post-
translational glycosylation. Indeed peptide-N-Glycosidase F (PNGase F) treatment of
eukaryotic produced Fc-CGS showed clear evidence of N-linked glycosylation
(Figure 24).
Use of the baculovirus system gave improved stability, reproducibility, purity
(> 90%), and yield (1 to 2 milligrams per liter of Sf9 cell culture). Produced in this
![Page 86: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/86.jpg)
74
way, Fc-CGS eluted as a stable dimer using size exclusion chromatography (Figure
25). This Fc-CGS was investigated with in vitro cyclic AMP production and cytokine
suppression assays, an in vivo animal disease model and glycan analysis, as
described in the following chapter.
![Page 87: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/87.jpg)
75
Figure 24 Glycosylation of Fc domains. Fc-CGS was previously heat and SDS buffer
denatured according to NEB BioLabs protocol followed by the addition of 500 units
of PNGase for 2 hour digestion at 37 ˚C. The treated Fc-CGS was then identified by
anti-FLAG western blotting.
![Page 88: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/88.jpg)
76
Figure 25 Gel filtration analysis of Fc-CGS. 25 μg Fc-CGS was injected into a
Superdex 75 column on an AKTA FPLC system. Flow rate = 0.5mL/min; buffer:
phosphate-buffered saline (PBS). The insert shows the anti-FLAG western blot from
fraction 17 to 22 (Elution volume 8.5 mL to 11 mL).
![Page 89: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/89.jpg)
77
Chapter 3
Characterization of Fc-CGS and ex vivo and in vivo Assays
Introduction
In chapter 2, we generated our target Fc domain in a glycosylated, disulfide-
linked form using a baculovirus expression system and Sf9 cells to express an Fc-
intein-chitin binding domain (CBD) construct containing the mouse IgG3 Fc domain
and an N-terminal secretion signal sequence (honey bee mellitin). In order to
improve the half-life and the targeting of CGS, we used a truncated mouse IgG3 Fc.
The advantages of using this truncated version relative to the intact antibody is its
smaller size and inability to trigger complement-dependent cytotoxicity, The
isolated Fc domain is expected to, retaining standard binding affinity toward the
specific Fcγ receptor, Fcγ RI. Fcγ RI is exclusively expressed in monocyte-derived
dendritic cells, responsible for antibody-dependent cell cytotoxicity (ADCC)145 that
are present in most tissues that are in contact with the external environment,
including the skin ( also called the Langerhans cell) and the inner lining of
the nose, lungs, stomach and intestines.
To confirm that the CGS has been installed onto Fc domain successfully, we
performed LC-MS analysis and the measured mass corresponds precisely to the
calculated mass (Figure 21). In addition, the LC-MS and High-performance anion-
exchange chromatography with pulsed amperometric detection (HPAEC-PAD)
techniques indicated that the glycans on the Fc domain are mainly 2GlcNAc and
3mannose, with or without the branch fucose that connects to the first N-linked
![Page 90: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/90.jpg)
78
GlcNAc (Figure 27). In order to measure the binding affinity of the Fc domain
towards Fc receptor, we used surface plasmon resonance with immobilized Fc
constructs. As shown in Figure 30 and 31, we observed that both Fc or Fc-CGS/ Fcγ
RI binding affinity, approximately 400 nM are within error identical to that of the
full length antibody containing mouse IgG3146. As expected, the partially
deglycosylated Fc domain diminished the binding affinity.
The Fc-CGS also showed a superior pharmacodynamic effect vs. free CGS in
the cell based assay to suppress IL-2 production from 48 to 72 hours time points
(Figure 32). In addition, Fc-CGS appeared to be stable for > 72 hours in whole mice
blood (Figure 33).
In a mouse model of autoimmune pneumonitis disease model (C3HA),
massive lung inflammation was induced by transferring TCR transgenic CD4+ T cells
to recognize HA antigen expressed in the pulmonary tissue. Mice receiving Fc-CGS
showed enhanced overall survival rate relative to control animals (Figure 34 & 35).
Interestingly, we showed that Fc-CGS concentrated in the inflamed pulmonary
tissue (Figure 38).
![Page 91: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/91.jpg)
79
Methods
Glycan Analysis
PNGase F digestion of IgG3 Fc for glycan analysis
IgG3 Fc (10 µg) was digested with 500 units of PNGase F (New England
Biolabs) in G7 reaction buffer (50 mM sodium phosphate, pH = 7.5) with a total
volume of 25 µL at 37 °C for 16 hours. The reaction mixture was dissolved in 1 mL
water and the released glycans were purified using a Sep-Pak Vac RC C18 cartridge
(500 mg, Waters) that was prewashed 4 times with 2.5 mL of 10% acetic acid, 50%
methanol, 100% methanol and then 8 times with 2.5 mL of ddH2O. After loading the
sample, the column was washed 3 times with 1 mL ddH2O to elute released N-
glycans. The elution was then loaded onto a Hypersep Hypercarb PGC column (50
mg, Thermo Scientific) which had been prepared with 3 washes of 1 mL 60%
acetonitrile, 1 mL 30% acetonitrile, and 1 mL ddH2O. After loading, the column was
washed with 3 ml of ddH2O and the glycans were then eluted with 1 mL of 30%
acetonitrile, 1 mL of 60% acetonitrile, and 1 mL 100% acetonitrile. The elutions
were pooled then dried under reduced pressure and resuspended in ddH2O for
further LC-MS analysis.
High-performance anion-exchange chromatography with pulsed amperometric
detection
![Page 92: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/92.jpg)
80
HPAEC-PAD was performed on a Dionex ICS-5000 system (Fischer Scientific)
equipped with an electrochemical detector (ED50 and an anion exchange column
(CarboPac PA200, 3 x 250 mm). The mobile phase (flow rate, 0.5 mL/min) was
composed of 100 mM NaOH (eluent A) and 100 mM NaOH/250 mM NaOAc (eluent
B). The gradient used was as follows: 0 to 20 mM NaOAc in 50 mM NaOH in 20
minutes (Figure 27).
Endoglycosidases (A/D/S) digestion of IgG3 Fc for Surface Plasmon Resonance
binding experiments
EndoA from Arthrobacter protophormiae, EndoD from Streptococcus
pneumoniae, and EndoS from Streptococcus pyogenes were overexpressed and
purified using previously described procedures147, 148. 1 µg of each Endo A/D/S was
added to 25 µg Fc in 50 µL PBS buffer, pH = 7.4 for 1 hour incubation at 37 °C.
Surface Plasmon Resonance Binding Experiments
The binding between different forms of mouse IgG3 Fc and mouse Fcγ
receptors type I (from Creative BioMart) was measured on a Biacore T100
instrument (GE Healthcare, USA). Protein A was immobilized on a CM5 biosensor
chip (GE Healthcare) using standard (ethyl-dimethylamino-carbodiimide/N-
hydroxy-succinimidyl ester) amine coupling reactions at pH of 4.5 to achieve a level
![Page 93: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/93.jpg)
81
of 1200-1500 RU129, 149. Each individual mouse IgG3 Fc in HBS-P buffer (10 mM
HEPES pH 7.4, 0.15 M NaCl, 0.05% v/v surfactant P20) was captured onto the
protein A surface until reached the capture level of 150 RU. A 2-fold serial dilution
of mouse FcγRI was flown through for 3 min at a flow rate of at 10 μL/min and
allowed to dissociate for another 3 min. After each cycle, the surface was
regenerated by injecting 20 mM HCl at 10 μL/min for 30 seconds. The carrier buffer
system in the Biacore T100 instrument is HBS-P buffer. Data was evaluated using
Biacore T100 evaluation software. Replicate experiments showed agreement within
20%.
Ex vivo assays: ELISA (enzyme-linked immunosorbent assay) of IL-2 and cAMP
Intracellar cAMP (cyclic AMP) measurement
Wild type (C57BL/6) and A2AR-/- splenocytes were isolated from harvested
spleens using a similar protocol to that used for the 5C.C7 cells. Splenocytes were
activated by soluble anti-CD3 (1 μg/mL) for 24 hours and this was followed by
treatment with fresh medium without anti-CD3 for another 24 hours. To determine
the effects of Fc, CGS, C-CGS, and Fc-CGS on A2AR function, the amount of total cAMP
produced in wild type (C57BL/6) or A2AR-/- knockout splenocytes was assayed
with the cAMP Biotrak EIA system (GE Healthcare Life Science) according to
manufacturer’s instructions (Figure 28 & 29).
![Page 94: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/94.jpg)
82
IL-2 (interleukin-2) measurement
5C.C7 mice were originally purchased from Taconic (Petersburgh, NY). 5C.C7
mice are B10.A TCR-5C.C7 transgenic140. These TCR transgenic mice on a Rag 2
deficient background specifically recognize pigeon cytochrome c (PCC) peptide.
Spleens and inguinal lymph nodes were harvested from 5C.C7 mice and crushed on
a cell strainer (BD Bioscience). The red blood cells were then removed using ACK
lysis buffer. Cell suspensions were activated with 5 µM PCC peptide in complete
medium containing 45% RPMI 1640, 45% Click’s Medium Eagle-Hank’s amino acid,
10% fetal calf serum, 4 mM glutamine, 2.5µg/ml gentamycin, 100 U of penicillin, 100
µg/ml streptomycin, and 50 µM 2-mercaptoethanol. Total IL-2 secreted from 5C.C7
splenocytes was measured by mouse IL-2 ELISA kit (eBioscience) according to
manufacturer’s instructions.
Mouse pneumonitis disease model
C3-HAhigh transgenic mice expressing hemagglutinin (HA) under rat C3
promoter were used as the recipients117. The C3-HAhigh line contains 30-50
transgene copies and was established in a B10.D2 genetic background. The donor
mice were the TCR-transgenic line 6.5, which expresses a TCR that recognizes an I-
Ed-restricted HA class II epitope (110SFERFEIFPKE120), that were backcrossed onto
![Page 95: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/95.jpg)
83
the Thy1.1+/+ B10.D2 genetic background150. The mice used for experiments were
male, between 7 to 12 weeks old. All experiments involving the mice were
performed under the protocols approved by the Animal Care and Use Committee of
The Johns Hopkins University School of Medicine.
Adoptive transfer
Clonotypic CD4+ T cells were harvested from 6.5+ transgenic mice (using the
same protocol as described for the 5C.C7 cells). The unfractionated population was
stained by PE (R-phycoerythrin)-conjugated anti-6.5 and APC (Allophycocyanin)-
conjugated anti-CD4 antibodies and checked by flow cytometry. Cells were washed
and resuspended into PBS containing 1.5 million 6.5+ T cells in 200 µL PBS for tail
vein injection into C3HA mice. Recipient mice were given a single dose
intraperitoneally of vehicle (PBS alone), CGS (5 µmol/kg, 2.5 mg/kg), Fc (50
nmol/kg, 1.6 mg/kg), or Fc-CGS (50 nmol/kg, 1.6 mg/kg) on days 1 (same day as
adoptive transfer) and 3 after the transfer. The drug injection volume used for all
treatments was 200 µL.
Fc-CGS Stability Test in Blood
Blood was collected from C3HA mice by performing a cardiac puncture.
EDTA was added into 3 mL blood as an anticoagulant to a final concentration of 50
mM. Fc-CGS was then diluted in mouse blood to a final concentration of 100 nM.
![Page 96: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/96.jpg)
84
After 24, 48 and 72 hours incubation at 37 °C, 100 μL of serum was isolated from
200 μL of blood by centrifugation (1,500 rpm, 5 minutes) then incubated with 10 μL
of anti-FLAG agarose beads to immnunoprecipitate the Fc-CGS. The binding was
performed by rotating at 4 °C for 2 hours. Fc-CGS bound to the beads was then
washed with 1 mL PBS twice, further eluted by using 20 μL of SDS denaturing buffer
and boiled at 95 °C for 10 minutes prior to being run on an 10% SDS PAGE gel and
visualized by western blotting. The primary antibody (anti-FLAG M2 antibody,
Sigma-Aldrich F3165) was used at a 1:1,000 dilution and the secondary antibody
(anti-mouse IgG, GE Healthcare NXA931) was employed at a 1:5,000 dilution.
Immunohistochemistry Staining
Mouse organs (brain, heart, lung) were harvested after systemic perfusion.
Briefly, mice were anesthesized with 200 μL of sodium pentobarbital (20 mg/mL)
intraperitoneally. The left ventricle was perfused with 30 mL of 1X PBS then 30 mL
of formalin for tissue fixation. Paraffin-embedded tissue slides were first dewaxed
by soaking into propar (Anatech, #511) 3 times, then soaked in 100% EtOH, 95%
EtOH, 70% EtOH and H2O for 5 minutes in each solution. Antigen retrieval was
performed by soaking slides in 1X Dako Target Retrieval Solution (citrate buffer, pH
=6.0, Dako #S1699) in a high pressure cooker with heating at 121 °C for 20 minutes.
Slides were cooled down to room temperature for 20 minutes, then rinsed with
deionized water followed by 1x Dako Wash Buffer (Dako #S3006). After rinsing
with Dako Wash Buffer, slides were then blocked with goat serum (Vector, PK6101)
![Page 97: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/97.jpg)
85
for 20 minutes. The slides were incubated with anti-FLAG tag primary antibody
(DYKDDDDK Tag, Cell Signaling #2368 diluted in 1:500 in Dako Antibody Diluent.
Dako # S0809) for 2 hours at room temperature. Slides were then washed with 1x
Dako Wash Buffer three times, 5 minutes each. Slides were incubated with
secondary antibody (Alexa Fl 555 Goat anti-Rabbit IgG H+L. Invitrogen #A21429
diluted 1:1000 in TBS) for one hour, then washed with 1x Dako Wash Buffer 3 times,
5 minutes each. DAPI stain (Vector #H1500) was added according to manufacturer’s
instructions. All slides were air-dried before imaging. Each image is representative
of stained tissues from at least two mice under each treatment condition.
![Page 98: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/98.jpg)
86
Figure 26 Glycan analysis of Fc by LC-MS. Glycan was released from Fc by PNGase F
digestion and purified by Waters Sep-Pak Vac RC C18 column and then Hypersep
Hypercarb PGC column for LC-MS analysis. Asterisk peaks are [M+Na]+.
![Page 99: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/99.jpg)
87
Figure 27 The HPAEC-PAD analysis of the glycan for semi-quantification purposes.
The result showed the most abundant glycans are GlcNAc2 Man3 and
GlcNAc2(Fuc)Man3.
![Page 100: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/100.jpg)
88
Figure 28 Intracellular cAMP levels after incubation with different CGS forms (5 μM
and 1μM; concentration of Fc-CGS based on monomeric Fc determined by using
Coomassie-stained SDS-PAGE referenced to standard bovine serum albumin) after
anti-CD3 stimulation of wild type C57BL6 splenocytes (The asterisks represent
p<0.05).
![Page 101: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/101.jpg)
89
Figure 29 Intracellular cAMP levels after incubation with different CGS forms (5 μM;
concentration of Fc-CGS based on monomeric Fc determined by using Coomassie-
stained SDS-PAGE referenced to standard bovine serum albumin) after anti-CD3
stimulation of A2AR-/- C57BL6 splenocytes.
![Page 102: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/102.jpg)
90
Figure 30 Surface-plasmon resonance binding assay of Fc-CGS and Fc to the Fcγ
receptor I. Fc-CGS (left) and Fc (right) were captured with Protein A on the surface
of a CM5 chip. Mouse Fcγ receptor I was passed through as the analyte. The surface-
plasmon resonance sensograms were recorded with 2-fold serial dilutions, starting
at the highest concentration of 2 μM Fc receptor.
![Page 103: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/103.jpg)
91
Figure 31 Surface-plasmon resonance binding assay of commercial full length
antibody containing the same Fc isotype and deglycolsyalated Fc to the Fcγ receptor
I. (A) and endoglycosidase mixture (EndoA, EndoD, EndoS) treated Sf9 expressed Fc
(B) were captured with Protein A on the surface of a CM5 chip. Mouse Fcγ receptor I
was passed through as the analyte. The surface-plasmon resonance sensograms
were recorded with 2-fold serial dilutions, starting at the highest concentration of 2
μM (A) or 2.5 μM (B) Fc receptor.
![Page 104: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/104.jpg)
92
Figure 32 Extracellular IL-2 secretion modulated by Fc-CGS: IL-2 measurement by
ELISA was carried out 24-72 hours post drug incubation of naïve 5 cc7 (TCR
transgenic, specific to Pigeon Cytochrome C, PCC) CD4+ T cells with different CGS
forms (30 nM) as indicated.
![Page 105: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/105.jpg)
93
Figure 33 Fc-CGS and Fc stability in blood. Both Fc-CGS and Fc were diluted in
mouse blood ex vivo indicidually to a final concentration of 100 nM. At 24, 48 and 72
hour time points, serum was incubated with anti-FLAG agarose beads to isolate the
Fc-CGS protein. Fc-CGS bound to the beads was then eluted using SDS denaturing
buffer and boiled at 95°C for 10 minutes prior to being run on SDS-PAGE,
transferred to membrane, and visualized by western blotting using an anti-FLAG
antibody.
![Page 106: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/106.jpg)
94
Figure 34 Schematic representation of autoimmune pneumonitis disease model:
C3HA transgenic recipient mice, which express the hemagglutinin (HA) antigen
under the control of the C3 (lung-selective) promoter, were injected with HA-
specific TCR transgenic CD4+ T cells (6.5). In about 4-5 days, these mice experience
massive pulmonary inflammation.
![Page 107: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/107.jpg)
95
Figure 35 Kaplan-Meier survival curve in response to several therapies following
induction of autoimmune pneumonitis in mice. C3HA mice were given 1.5 million
CD4+ 6.5+ cells and two doses of vehicle, CGS, Fc-CGS, or Fc. Drug dose: CGS: 5
nmol/g; Fc & Fc-CGS: 50 pmol/g. Vehicle (n = 12), CGS (n = 11), Fc-CGS (n = 10), and
Fc (n = 8).
![Page 108: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/108.jpg)
96
Figure 36 Hematoxylin and eosin staining of the pulmonary tissue from (left) an
untreated healthy mouse, a CGS treated mouse (died on day 6), and (right) an Fc-
CGS treated mouse (survived over 3 weeks) after the 1.5 million CD4+ 6.5+ cells and
the drugs were given.
![Page 109: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/109.jpg)
97
Figure 37 Immunohistochemistry staining with anti-Flag of pulmonary tissues from
C3HA mice treated as in Figure 35. Left, an untreated healthy C3HA mouse; middle,
11 days post-adoptive transfer; right, 21 days post-adoptive transfer.
![Page 110: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/110.jpg)
98
Figure 38 Immunohistochemistry staining with anti-Flag of pulmonary tissues from
C3HA mice. Left, 8 days post adoptive transfer of the 1.2 million CD4+ 6.5+ cells into
mice treated with single doses of Fc-CGS (50 nmol/kg) by intraperitoneal injection
on days 1 and 3; right, a healthy C3HA mouse treated with single doses of Fc-CGS
(50 nmol/kg) by intraperitoneal injection on days 1 and 3. Both groups were
harvested on the same day.
![Page 111: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/111.jpg)
99
Figure 39 Immunohistochemistry staining with anti-Flag of heart tissues from
C3HA mice as in figure 38.
![Page 112: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/112.jpg)
100
Figure 40 Immunohistochemistry staining with anti-Flag of brain tissues from
C3HA mice as in figure 38.
![Page 113: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/113.jpg)
101
Results and Discussion
Fc and Fc-CGS were treated with peptide-N-glycosidase (PNGase F) to
remove N-linked glycosylation and then the samples were reduced by treatment
with 50 mM DTT. Both Fc and Fc-CGS showed the correct molecular weight and
confirmed that C-CGS was successfully installed onto the Fc domain (Figure 21). LC-
MS and HPAEC-PAD analyses revealed the expected levels of N-linked glycosylation
on Fc, and showed the major glycan profile are 2GlcNAc and 3mannose, with or
without the branch fucose that connects to the first N-linked GlcNAc (Figure 26 &
Figure 27).
To explore the potential of Fc-CGS to serve as an A2AR agonist, we exposed
activated splenocytes (1 µ g/mL anti-CD3 treated overnight) to Fc-CGS and control
compounds for 6 hours and measured subsequent intracellular cyclic AMP
production78, a known second messenger response to A2AR activation. These
experiments revealed that 5 μM Fc-CGS treatment resulted in a 5-fold increase in
cAMP production, similar to that of free CGS but slightly greater than that of C-CGS
(Figure 28). Under these conditions, Fc alone had no effect. With A2AR−/−
splenocytes, the effect of CGS-containing compounds on cAMP production was
abolished (Figure 29). However, 1 μM free CGS showed a somewhat greater cAMP
stimulation effect than Fc-CGS on wt splenocytes, whereas C-CGS was less effective
under these conditions (Figure 28). These results suggest that substitution of the
side chain of CGS with the long linker somewhat reduces its strength as an A2AR
agonist in this short-term assay, but conjugation to Fc helps restore agonist activity.
![Page 114: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/114.jpg)
102
Based on these findings, we envisioned that Fc-CGS could be a promising
immunomodulator.
As the CGS part on the Fc-CGS appeared functional based on the cAMP ELISA,
we next examined whether the Fc domain remains binding capacity for the mouse
Fcγ receptor I. We performed surface plasmon resonance to measure the affinity of
Fc-CGS and Fc129, and these experiments revealed that Kd’s of 388 ± 67 nM and 405
±34 nM (Figure 30), respectively, equivalent to that of commercial immunoglobulin
containing the same Fc isotype (Kd of 384 ± 69 nM) (Figure 31). These data show
that the EPL-produced Fc interacts normally with the Fc receptor and that the CGS
and linker do not interfere with this interaction. As expected, partial deglycosylation
by a mixture of endoglycosidases led to the reduced affinity of Fc for the mouse FcR
gamma I (Kd of 1330 ± 50 nM, Figure 31), indicating a role for N-linked glycosylation
in mediating interactions with this receptor subtype.
To investigate the functional effects of Fc-CGS on immune response, we
stimulated naïve CD4+ T cells (5C.C7 splenocytes treated with 5 μM pigeon
cytochrome C antigenic peptide) and measured interleukin 2 (IL-2) production by
ELISA. These experiments revealed a sharp, 70% reduction in IL-2 72 hours after
treatment with 30 nM Fc-CGS (Figure 32). In contrast, treatment with free CGS, C-
CGS, and Fc induced less than a 30% reduction of IL-2. This cell-based assay
suggested that Fc-CGS is more resistant to metabolism than CGS and C-CGS in cell
culture medium for 72 hours. However, there was no obvious IL-2 inhibition at 24
![Page 115: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/115.jpg)
103
hours but moderate effect at 48 hours mainly due to short of A2A receptors
expression on cell surface 48 hours post stimulation. Moreover, in an ex vivo
experiment, Western blots with anti-FLAG antibody revealed that Fc-CGS was quite
stable in blood for at least 72 hours (Figure 32). These results suggest that the
stability of Fc-CGS might contribute to its 72 hour effects on IL-2 production, and its
relatively greater potency than CGS in the cAMP responses in the first 6 hours
assays.
Encouraged by these ex vivo results with Fc-CGS, we investigated the effects
of Fc-CGS in a mouse autoimmune model of pneumonitis. C3HA transgenic recipient
mice, which express the hemagglutinin (HA) antigen under the control of the C3
(lung-selective) promoter, were injected with 1.5 million CD4+ T cells with HA-
specific TCR (6.5) and experience pulmonary inflammation resulting in death within
about two weeks (Figure 34), but this outcome can be rescued by dosing twice daily
with 5 μmol/kg intraperitoneal CGS for four days after adoptive transfer78.
Anticipating enhanced pharmacokinetic stability of Fc-CGS versus CGS, we designed
a related pneumonitis therapeutic trial in which treatment with Fc-CGS involved
two intraperitoneal injections total (day 1 and day 3) of 50 nmol/kg. Control arms of
the study involved treating mice with vehicle, 50 nmol/kg Fc, or 5000 nmol/kg CGS,
also on days 1 and 3. As shown in Figure 35, mice treated with Fc-CGS showed
significantly enhanced overall survival rate over animals injected with vehicle, CGS,
or Fc. Necropsy of the animals that succumbed showed a lymphocytic infiltrate in
the lungs that appeared less severe in surviving mice treated with Fc-CGS (Figure
![Page 116: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/116.jpg)
104
36).
Immunocytochemistry staining (anti-Flag) revealed that Fc-CGS could be
detected in the pulmonary tissue on day 11 and at a lower level on day 21 (post
adoptive transfer) of the experiment, 8 and 18 days after the Fc-CGS second
treatment (Figure 37). These images suggested the tremendous stabilization of the
Fc-containing conjugate at the critical site of action versus that previously
established for the untethered small molecule CGS, which could be more easily
metabolized by enzymes. It is noteworthy that mice receiving Fc-CGS showed an
improved outcome relative to CGS, even though a 100-fold lower dose of the
protein−small molecule conjugate was administered. It is not fully understood the
extent to which the various FcR isoforms (FcRn or Fc gamma receptor I) are
important for Fc-CGS pharmacology, nor the relative importance of pharmacokinetic
stabilization versus immune cellular targeting conferred by the Fc domain. FcRn
would be expected to be more important to the Fc stabilizing functions whereas Fc
gamma receptor I might have more influence on immuno-targeting of disease area27,
151, 152. Fc-CGS appeared to be more abundant in the lung tissue of mice with
pneumonitis compared with healthy controls Fc-CGS showing that the Fc/Fcγ
receptors binding may contribute the targeting (Figure 38). In other A2AR
expressing areas, Fc-CGS was readily (5 days after second Fc-CGS treatment)
detected in the heart by immunohistochemistry and it was appeared to be reduced
in the mice with pneumonitis compared with healthy controls (Figure 39). In
contrast, Fc-CGS was barely detectable in the brain of both healthy and pneumonitis
![Page 117: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/117.jpg)
105
mice (Figure 40). Low detection of Fc-CGS in the brain may be related to the
presence of the blood-brain barrier to large molecules153. Taken together, these
data suggest that the lung immune
response facilitated recruitment of Fc-CGS to the site of inflammation, although
further studies will be needed to fully explore these mechanisms.
In summary, we have successfully generated an Fc-small molecule conjugate
(Fc-CGS) that not only retains the agonist properties but shows enhanced
pharmacokinetic and pharmacodynamic performance in a mouse model of
inflammatory pneumonitis. Conjugating a small molecule to the immunologically
relevant Fc domain may prove to be a general method to enhance small molecule
delivery to areas of inflammation. The bivalency of such Fc conjugates may also be
beneficial for receptor binding. Expressed protein ligation with Sf9 cell secreted
proteins thus offers a straightforward, site-specific, homogeneous and efficient
technique to generate such Fc conjugates in functional, glycosylated form, placing
the chemical modification at the C-terminus of the natural antibody domain. This
approach may be broadly applicable for improving the pharmacokinetic properties
of small molecule therapeutics and the production of next generation bivalent
protein-based drugs.
![Page 118: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/118.jpg)
106
References 1. Banting, F.G., Best, C.H., Collip, J.B., Campbell, W.R. & Fletcher, A.A. Pancreatic
extracts in the treatment of diabetes mellitus: preliminary report. 1922. CMAJ 145, 1281-1286 (1991).
2. Johnson, I.S. Human insulin from recombinant DNA technology. Science 219, 632-637 (1983).
3. Keefer, L.M., Piron, M.A. & De Meyts, P. Human insulin prepared by recombinant DNA techniques and native human insulin interact identically with insulin receptors. Proc Natl Acad Sci U S A 78, 1391-1395 (1981).
4. Liu, S. et al. Efficacy of erythropoietin combined with enteral nutrition for the treatment of anemia in Crohn's disease: a prospective cohort study. Nutr Clin Pract 28, 120-127 (2013).
5. Scott, S.D. Rituximab: a new therapeutic monoclonal antibody for non-Hodgkin's lymphoma. Cancer Pract 6, 195-197 (1998).
6. Hudis, C.A. Trastuzumab--mechanism of action and use in clinical practice. N Engl J Med 357, 39-51 (2007).
7. Peppel, K., Crawford, D. & Beutler, B. A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity. J Exp Med 174, 1483-1489 (1991).
8. Peppel, K., Poltorak, A., Melhado, I., Jirik, F. & Beutler, B. Expression of a TNF inhibitor in transgenic mice. J Immunol 151, 5699-5703 (1993).
9. Egrie, J.C. & Browne, J.K. Development and characterization of novel erythropoiesis stimulating protein (NESP). Br J Cancer 84 Suppl 1, 3-10 (2001).
10. Leader, B., Baca, Q.J. & Golan, D.E. Protein therapeutics: a summary and pharmacological classification. Nat Rev Drug Discov 7, 21-39 (2008).
11. Middleton, S.A. et al. Shared and unique determinants of the erythropoietin (EPO) receptor are important for binding EPO and EPO mimetic peptide. J Biol Chem 274, 14163-14169 (1999).
12. Eckardt, K.U. et al. Rate of erythropoietin formation in humans in response to acute hypobaric hypoxia. J Appl Physiol (1985) 66, 1785-1788 (1989).
13. Fisher, J.W. Erythropoietin: physiology and pharmacology update. Exp Biol Med (Maywood) 228, 1-14 (2003).
14. Goldwasser, E. & Kung, C.K. Purification of erythropoietin. Proc Natl Acad Sci U S A 68, 697-698 (1971).
15. Miyake, T., Kung, C.K. & Goldwasser, E. Purification of human erythropoietin. J Biol Chem 252, 5558-5564 (1977).
16. Brennan, F.M., Chantry, D., Jackson, A., Maini, R. & Feldmann, M. Inhibitory effect of TNF alpha antibodies on synovial cell interleukin-1 production in rheumatoid arthritis. Lancet 2, 244-247 (1989).
17. Butler, D.M., Maini, R.N., Feldmann, M. & Brennan, F.M. Modulation of proinflammatory cytokine release in rheumatoid synovial membrane cell cultures. Comparison of monoclonal anti TNF-alpha antibody with the interleukin-1 receptor antagonist. Eur Cytokine Netw 6, 225-230 (1995).
![Page 119: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/119.jpg)
107
18. Feldmann, M. Development of anti-TNF therapy for rheumatoid arthritis. Nat Rev Immunol 2, 364-371 (2002).
19. Knight, D.M. et al. Construction and initial characterization of a mouse-human chimeric anti-TNF antibody. Mol Immunol 30, 1443-1453 (1993).
20. Galibert, F., Mandart, E., Fitoussi, F., Tiollais, P. & Charnay, P. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281, 646-650 (1979).
21. Hilleman, M.R. Yeast recombinant hepatitis B vaccine. Infection 15, 3-7 (1987).
22. Hamzi Abdul Raub, S. et al. Distribution of HPV Genotypes in Cervical Cancer in Multi- ethnic Malaysia. Asian Pac J Cancer Prev 15, 651-656 (2014).
23. Karunaratne, K. et al. Human papillomavirus prevalence and type-distribution in women with cervical lesions: a cross-sectional study in Sri Lanka. BMC Cancer 14, 116 (2014).
24. Roopenian, D.C. & Akilesh, S. FcRn: the neonatal Fc receptor comes of age. Nat Rev Immunol 7, 715-725 (2007).
25. Kontermann, R.E. Strategies for extended serum half-life of protein therapeutics. Curr Opin Biotechnol 22, 868-876 (2011).
26. Suzuki, T. et al. Importance of neonatal FcR in regulating the serum half-life of therapeutic proteins containing the Fc domain of human IgG1: a comparative study of the affinity of monoclonal antibodies and Fc-fusion proteins to human neonatal FcR. J Immunol 184, 1968-1976 (2010).
27. Czajkowsky, D.M., Hu, J., Shao, Z. & Pleass, R.J. Fc-fusion proteins: new developments and future perspectives. EMBO Mol Med 4, 1015-1028 (2012).
28. Bruhns, P. et al. Specificity and affinity of human Fcgamma receptors and their polymorphic variants for human IgG subclasses. Blood 113, 3716-3725 (2009).
29. Soltani, N., Kumar, M., Glinka, Y., Prud'homme, G.J. & Wang, Q. In vivo expression of GLP-1/IgG-Fc fusion protein enhances beta-cell mass and protects against streptozotocin-induced diabetes. Gene Ther 14, 981-988 (2007).
30. Cox, G.N. et al. Enhanced circulating half-life and hematopoietic properties of a human granulocyte colony-stimulating factor/immunoglobulin fusion protein. Exp Hematol 32, 441-449 (2004).
31. Wang, Q. et al. Novel GLP-1 fusion chimera as potent long acting GLP-1 receptor agonist. PLoS One 5, e12734 (2010).
32. Waldmann, T.A. Immunotherapy: past, present and future. Nat Med 9, 269-277 (2003).
33. Queen, C. et al. A humanized antibody that binds to the interleukin 2 receptor. Proc Natl Acad Sci U S A 86, 10029-10033 (1989).
34. Moolten, F.L. & Cooperband, S.R. Selective destruction of target cells by diphtheria toxin conjugated to antibody directed against antigens on the cells. Science 169, 68-70 (1970).
35. Lambert, J.M. Drug-conjugated antibodies for the treatment of cancer. Br J Clin Pharmacol 76, 248-262 (2013).
![Page 120: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/120.jpg)
108
36. Chen, Y. et al. Armed antibodies targeting the mucin repeats of the ovarian cancer antigen, MUC16, are highly efficacious in animal tumor models. Cancer Res 67, 4924-4932 (2007).
37. Henry, M.D. et al. A prostate-specific membrane antigen-targeted monoclonal antibody-chemotherapeutic conjugate designed for the treatment of prostate cancer. Cancer Res 64, 7995-8001 (2004).
38. Ma, D. et al. Potent antitumor activity of an auristatin-conjugated, fully human monoclonal antibody to prostate-specific membrane antigen. Clin Cancer Res 12, 2591-2596 (2006).
39. van Der Velden, V.H. et al. Targeting of the CD33-calicheamicin immunoconjugate Mylotarg (CMA-676) in acute myeloid leukemia: in vivo and in vitro saturation and internalization by leukemic and normal myeloid cells. Blood 97, 3197-3204 (2001).
40. Burris, H.A., 3rd et al. Phase II study of the antibody drug conjugate trastuzumab-DM1 for the treatment of human epidermal growth factor receptor 2 (HER2)-positive breast cancer after prior HER2-directed therapy. J Clin Oncol 29, 398-405 (2011).
41. Bross, P.F. et al. Approval summary: gemtuzumab ozogamicin in relapsed acute myeloid leukemia. Clin Cancer Res 7, 1490-1496 (2001).
42. LoRusso, P.M., Weiss, D., Guardino, E., Girish, S. & Sliwkowski, M.X. Trastuzumab emtansine: a unique antibody-drug conjugate in development for human epidermal growth factor receptor 2-positive cancer. Clin Cancer Res 17, 6437-6447 (2011).
43. Ducry, L. & Stump, B. Antibody-drug conjugates: linking cytotoxic payloads to monoclonal antibodies. Bioconjug Chem 21, 5-13 (2010).
44. Doronina, S.O. et al. Development of potent monoclonal antibody auristatin conjugates for cancer therapy. Nat Biotechnol 21, 778-784 (2003).
45. Dubowchik, G.M. et al. Cathepsin B-labile dipeptide linkers for lysosomal release of doxorubicin from internalizing immunoconjugates: model studies of enzymatic drug release and antigen-specific in vitro anticancer activity. Bioconjug Chem 13, 855-869 (2002).
46. Alley, S.C. et al. Contribution of linker stability to the activities of anticancer immunoconjugates. Bioconjug Chem 19, 759-765 (2008).
47. Smyth, M.J., Pietersz, G.A. & McKenzie, I.F. Selective enhancement of antitumor activity of N-acetyl melphalan upon conjugation to monoclonal antibodies. Cancer Res 47, 62-69 (1987).
48. Wu, G., Fang, Y.Z., Yang, S., Lupton, J.R. & Turner, N.D. Glutathione metabolism and its implications for health. J Nutr 134, 489-492 (2004).
49. Mills, B.J. & Lang, C.A. Differential distribution of free and bound glutathione and cyst(e)ine in human blood. Biochem Pharmacol 52, 401-406 (1996).
50. Benechie, M. & Khuong-Huu, F. Total Synthesis of (-)-Maytansinol. J Org Chem 61, 7133-7138 (1996).
51. Carlsson, J., Drevin, H. & Axen, R. Protein thiolation and reversible protein-protein conjugation. N-Succinimidyl 3-(2-pyridyldithio)propionate, a new heterobifunctional reagent. Biochem J 173, 723-737 (1978).
![Page 121: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/121.jpg)
109
52. Chari, R.V. et al. Immunoconjugates containing novel maytansinoids: promising anticancer drugs. Cancer Res 52, 127-131 (1992).
53. Trail, P.A. et al. Cure of xenografted human carcinomas by BR96-doxorubicin immunoconjugates. Science 261, 212-215 (1993).
54. Greenfield, R.S. et al. Evaluation in vitro of adriamycin immunoconjugates synthesized using an acid-sensitive hydrazone linker. Cancer Res 50, 6600-6607 (1990).
55. Koblinski, J.E., Ahram, M. & Sloane, B.F. Unraveling the role of proteases in cancer. Clin Chim Acta 291, 113-135 (2000).
56. Sanderson, R.J. et al. In vivo drug-linker stability of an anti-CD30 dipeptide-linked auristatin immunoconjugate. Clin Cancer Res 11, 843-852 (2005).
57. Toki, B.E., Cerveny, C.G., Wahl, A.F. & Senter, P.D. Protease-mediated fragmentation of p-amidobenzyl ethers: a new strategy for the activation of anticancer prodrugs. J Org Chem 67, 1866-1872 (2002).
58. Zimmermann, H. Extracellular metabolism of ATP and other nucleotides. Naunyn Schmiedebergs Arch Pharmacol 362, 299-309 (2000).
59. Heine, P. et al. The C-terminal cysteine-rich region dictates specific catalytic properties in chimeras of the ectonucleotidases NTPDase1 and NTPDase2. Eur J Biochem 268, 364-373 (2001).
60. Williams, T.C. & Jarvis, S.M. Multiple sodium-dependent nucleoside transport systems in bovine renal brush-border membrane vesicles. Biochem J 274 ( Pt 1), 27-33 (1991).
61. Berne, R.M. & Rubio, R. Adenine nucleotide metabolism in the heart. Circ Res 35 Suppl 3, 109-120 (1974).
62. Cronstein, B.N. Adenosine, an endogenous anti-inflammatory agent. J Appl Physiol (1985) 76, 5-13 (1994).
63. Latini, S., Bordoni, F., Corradetti, R., Pepeu, G. & Pedata, F. Effect of A2A adenosine receptor stimulation and antagonism on synaptic depression induced by in vitro ischaemia in rat hippocampal slices. Br J Pharmacol 128, 1035-1044 (1999).
64. Latini, S., Bordoni, F., Pedata, F. & Corradetti, R. Extracellular adenosine concentrations during in vitro ischaemia in rat hippocampal slices. Br J Pharmacol 127, 729-739 (1999).
65. De Jong, J.W. Partial purification and properties of rat-heart adenosine kinase. Arch Int Physiol Biochim 85, 557-569 (1977).
66. Singh, L.S. & Sharma, R. Purification and characterization of intestinal adenosine deaminase from mice. Mol Cell Biochem 204, 127-134 (2000).
67. Lloyd, H.G. & Fredholm, B.B. Involvement of adenosine deaminase and adenosine kinase in regulating extracellular adenosine concentration in rat hippocampal slices. Neurochem Int 26, 387-395 (1995).
68. Fredholm, B.B., AP, I.J., Jacobson, K.A., Klotz, K.N. & Linden, J. International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol Rev 53, 527-552 (2001).
69. Fredholm, B.B., Chern, Y., Franco, R. & Sitkovsky, M. Aspects of the general biology of adenosine A2A signaling. Prog Neurobiol 83, 263-276 (2007).
![Page 122: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/122.jpg)
110
70. Ferre, S. et al. Synergistic interaction between adenosine A2A and glutamate mGlu5 receptors: implications for striatal neuronal function. Proc Natl Acad Sci U S A 99, 11940-11945 (2002).
71. Cheng, H.C., Shih, H.M. & Chern, Y. Essential role of cAMP-response element-binding protein activation by A2A adenosine receptors in rescuing the nerve growth factor-induced neurite outgrowth impaired by blockage of the MAPK cascade. J Biol Chem 277, 33930-33942 (2002).
72. Schwarzschild, M.A., Agnati, L., Fuxe, K., Chen, J.F. & Morelli, M. Targeting adenosine A2A receptors in Parkinson's disease. Trends Neurosci 29, 647-654 (2006).
73. Belardinelli, L. et al. The A2A adenosine receptor mediates coronary vasodilation. J Pharmacol Exp Ther 284, 1066-1073 (1998).
74. Vinten-Johansen, J. et al. Adenosine in myocardial protection in on-pump and off-pump cardiac surgery. Ann Thorac Surg 75, S691-699 (2003).
75. Raskovalova, T., Lokshin, A., Huang, X., Jackson, E.K. & Gorelik, E. Adenosine-mediated inhibition of cytotoxic activity and cytokine production by IL-2/NKp46-activated NK cells: involvement of protein kinase A isozyme I (PKA I). Immunol Res 36, 91-99 (2006).
76. Ohta, A. & Sitkovsky, M. Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature 414, 916-920 (2001).
77. Sevigny, C.P. et al. Activation of adenosine 2A receptors attenuates allograft rejection and alloantigen recognition. J Immunol 178, 4240-4249 (2007).
78. Zarek, P.E. et al. A2A receptor signaling promotes peripheral tolerance by inducing T-cell anergy and the generation of adaptive regulatory T cells. Blood 111, 251-259 (2008).
79. Lappas, C.M., Liu, P.C., Linden, J., Kang, E.M. & Malech, H.L. Adenosine A2A receptor activation limits graft-versus-host disease after allogenic hematopoietic stem cell transplantation. J Leukoc Biol 87, 345-354 (2010).
80. Scheibner, K.A. et al. The adenosine a2a receptor inhibits matrix-induced inflammation in a novel fashion. Am J Respir Cell Mol Biol 40, 251-259 (2009).
81. Costanzi, S.I., A.A.; Tikhonova, I.G.; Jacobson, K.A. Structure and function of G protein-coupled receptors studied using sequence analysis, molecular modeling and receptor engineering: adenosine receptors. Front Drug Des. Discov 3, 63-79 (2007).
82. de Lera Ruiz, M., Lim, Y.H. & Zheng, J. Adenosine A Receptor as a Drug Discovery Target. J Med Chem (2013).
83. Valls, M.D., Cronstein, B.N. & Montesinos, M.C. Adenosine receptor agonists for promotion of dermal wound healing. Biochem Pharmacol 77, 1117-1124 (2009).
84. Muller, C.E. & Jacobson, K.A. Recent developments in adenosine receptor ligands and their potential as novel drugs. Biochim Biophys Acta 1808, 1290-1308 (2011).
85. Cristalli, G., Muller, C.E. & Volpini, R. Recent developments in adenosine A2A receptor ligands. Handb Exp Pharmacol, 59-98 (2009).
![Page 123: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/123.jpg)
111
86. Cristalli, G., Lambertucci, C., Taffi, S., Vittori, S. & Volpini, R. Medicinal chemistry of adenosine A2A receptor agonists. Curr Top Med Chem 3, 387-401 (2003).
87. Siddiqi, S.M. et al. Search for new purine- and ribose-modified adenosine analogues as selective agonists and antagonists at adenosine receptors. J Med Chem 38, 1174-1188 (1995).
88. Tuccinardi, T., Ortore, G., Manera, C., Saccomanni, G. & Martinelli, A. Adenosine receptor modelling. A1/A2a selectivity. Eur J Med Chem 41, 321-329 (2006).
89. Lebon, G. et al. Agonist-bound adenosine A2A receptor structures reveal common features of GPCR activation. Nature 474, 521-525 (2011).
90. Monopoli, A. et al. Pharmacology of the highly selective A1 adenosine receptor agonist 2-chloro-N6-cyclopentyladenosine. Arzneimittelforschung 44, 1305-1312 (1994).
91. Monopoli, A., Casati, C., Lozza, G., Forlani, A. & Ongini, E. Cardiovascular pharmacology of the A2A adenosine receptor antagonist, SCH 58261, in the rat. J Pharmacol Exp Ther 285, 9-15 (1998).
92. Hutchison, A.J. et al. 2-(Arylalkylamino)adenosin-5'-uronamides: a new class of highly selective adenosine A2 receptor ligands. J Med Chem 33, 1919-1924 (1990).
93. Hutchison, A.J. et al. CGS 21680C, an A2 selective adenosine receptor agonist with preferential hypotensive activity. J Pharmacol Exp Ther 251, 47-55 (1989).
94. Chovan, J.P., Zane, P.A. & Greenberg, G.E. Automated-extraction, high-performance liquid chromatographic method and pharmacokinetics in rats of a highly A2-selective adenosine agonist, CGS 21680. J Chromatogr 578, 77-83 (1992).
95. Jarvis, M.F. & Williams, M. Direct autoradiographic localization of adenosine A2 receptors in the rat brain using the A2-selective agonist, [3H]CGS 21680. Eur J Pharmacol 168, 243-246 (1989).
96. Johansson, B. & Fredholm, B.B. Further characterization of the binding of the adenosine receptor agonist [3H]CGS 21680 to rat brain using autoradiography. Neuropharmacology 34, 393-403 (1995).
97. Mazzon, E. et al. CGS 21680, an agonist of the adenosine (A2A) receptor, reduces progression of murine type II collagen-induced arthritis. J Rheumatol 38, 2119-2129 (2011).
98. Fozard, J.R., Ellis, K.M., Villela Dantas, M.F., Tigani, B. & Mazzoni, L. Effects of CGS 21680, a selective adenosine A2A receptor agonist, on allergic airways inflammation in the rat. Eur J Pharmacol 438, 183-188 (2002).
99. Barraco, R.A., Martens, K.A., Parizon, M. & Normile, H.J. Adenosine A2a receptors in the nucleus accumbens mediate locomotor depression. Brain Res Bull 31, 397-404 (1993).
100. Jenner, P. Istradefylline, a novel adenosine A2A receptor antagonist, for the treatment of Parkinson's disease. Expert Opin Investig Drugs 14, 729-738 (2005).
![Page 124: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/124.jpg)
112
101. Harper, L.K., Beckett, S.R., Marsden, C.A., McCreary, A.C. & Alexander, S.P. Effects of the A 2A adenosine receptor antagonist KW6002 in the nucleus accumbens in vitro and in vivo. Pharmacol Biochem Behav 83, 114-121 (2006).
102. Ochi, M., Shiozaki, S. & Kase, H. Adenosine A(2A) receptor-mediated modulation of GABA and glutamate release in the output regions of the basal ganglia in a rodent model of Parkinson's disease. Neuroscience 127, 223-231 (2004).
103. Rao, N. et al. A study of the pharmacokinetic interaction of istradefylline, a novel therapeutic for Parkinson's disease, and atorvastatin. J Clin Pharmacol 48, 1092-1098 (2008).
104. Dungo, R. & Deeks, E.D. Istradefylline: first global approval. Drugs 73, 875-882 (2013).
105. Poucher, S.M. et al. The in vitro pharmacology of ZM 241385, a potent, non-xanthine A2a selective adenosine receptor antagonist. Br J Pharmacol 115, 1096-1102 (1995).
106. Zhukov, A. et al. Biophysical mapping of the adenosine A2A receptor. J Med Chem 54, 4312-4323 (2011).
107. Jaakola, V.P. et al. The 2.6 angstrom crystal structure of a human A2A adenosine receptor bound to an antagonist. Science 322, 1211-1217 (2008).
108. Golembiowska, K. & Dziubina, A. Striatal adenosine A(2A) receptor blockade increases extracellular dopamine release following l-DOPA administration in intact and dopamine-denervated rats. Neuropharmacology 47, 414-426 (2004).
109. Ohta, A. et al. A2A adenosine receptor protects tumors from antitumor T cells. Proc Natl Acad Sci U S A 103, 13132-13137 (2006).
110. Muir, T.W., Sondhi, D. & Cole, P.A. Expressed protein ligation: a general method for protein engineering. Proc Natl Acad Sci U S A 95, 6705-6710 (1998).
111. Raghavan, R. & Minnick, M.F. Group I introns and inteins: disparate origins but convergent parasitic strategies. J Bacteriol 191, 6193-6202 (2009).
112. Ghosh, I. et al. Site-specific protein labeling by intein-mediated protein ligation. Methods Mol Biol 705, 87-107 (2011).
113. Zuger, S. & Iwai, H. Intein-based biosynthetic incorporation of unlabeled protein tags into isotopically labeled proteins for NMR studies. Nat Biotechnol 23, 736-740 (2005).
114. Camarero, J.A., Kwon, Y. & Coleman, M.A. Chemoselective attachment of biologically active proteins to surfaces by expressed protein ligation and its application for "protein chip" fabrication. J Am Chem Soc 126, 14730-14731 (2004).
115. Bolduc, D. et al. Phosphorylation-mediated PTEN conformational closure and deactivation revealed with protein semisynthesis. Elife 2, e00691 (2013).
116. Chiang, M.J. et al. An Fc domain protein-small molecule conjugate as an enhanced immunomodulator. J Am Chem Soc 136, 3370-3373 (2014).
117. Huang, C.T. et al. CD4+ T cells pass through an effector phase during the process of in vivo tolerance induction. J Immunol 170, 3945-3953 (2003).
![Page 125: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/125.jpg)
113
118. Putnam, F.W., Liu, Y.S. & Low, T.L. Primary structure of a human IgA1 immunoglobulin. IV. Streptococcal IgA1 protease, digestion, Fab and Fc fragments, and the complete amino acid sequence of the alpha 1 heavy chain. J Biol Chem 254, 2865-2874 (1979).
119. Woof, J.M. & Burton, D.R. Human antibody-Fc receptor interactions illuminated by crystal structures. Nat Rev Immunol 4, 89-99 (2004).
120. Heyman, B. Complement and Fc-receptors in regulation of the antibody response. Immunol Lett 54, 195-199 (1996).
121. Nimmerjahn, F. & Ravetch, J.V. Fcgamma receptors as regulators of immune responses. Nat Rev Immunol 8, 34-47 (2008).
122. Morphis, L.G. & Gitlin, D. Maturation of the maternofoetal transport system for human gamma-globulin in the mouse. Nature 228, 573 (1970).
123. Brambell, F.W. The transmission of immunity from mother to young and the catabolism of immunoglobulins. Lancet 2, 1087-1093 (1966).
124. Simister, N.E. & Rees, A.R. Isolation and characterization of an Fc receptor from neonatal rat small intestine. Eur J Immunol 15, 733-738 (1985).
125. Simister, N.E. & Mostov, K.E. An Fc receptor structurally related to MHC class I antigens. Nature 337, 184-187 (1989).
126. Rodewald, R. pH-dependent binding of immunoglobulins to intestinal cells of the neonatal rat. J Cell Biol 71, 666-669 (1976).
127. Roopenian, D.C. et al. The MHC class I-like IgG receptor controls perinatal IgG transport, IgG homeostasis, and fate of IgG-Fc-coupled drugs. J Immunol 170, 3528-3533 (2003).
128. Waldmann, T.A. & Strober, W. Metabolism of immunoglobulins. Prog Allergy 13, 1-110 (1969).
129. Huang, W., Giddens, J., Fan, S.Q., Toonstra, C. & Wang, L.X. Chemoenzymatic glycoengineering of intact IgG antibodies for gain of functions. J Am Chem Soc 134, 12308-12318 (2012).
130. Krapp, S., Mimura, Y., Jefferis, R., Huber, R. & Sondermann, P. Structural analysis of human IgG-Fc glycoforms reveals a correlation between glycosylation and structural integrity. J Mol Biol 325, 979-989 (2003).
131. Borrok, M.J., Jung, S.T., Kang, T.H., Monzingo, A.F. & Georgiou, G. Revisiting the role of glycosylation in the structure of human IgG Fc. ACS Chem Biol 7, 1596-1602 (2012).
132. Brunton, L.L., Lazo, J. S.; Parker, K. L. (ed.) Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 11th edition, McGraw-Hill, NY. (2006). 133. Olafsen, T., Kenanova, V.E. & Wu, A.M. Tunable pharmacokinetics: modifying
the in vivo half-life of antibodies by directed mutagenesis of the Fc fragment. Nat Protoc 1, 2048-2060 (2006).
134. Sitkovsky, M.V. Use of the A(2A) adenosine receptor as a physiological immunosuppressor and to engineer inflammation in vivo. Biochem Pharmacol 65, 493-501 (2003).
135. Lappas, C.M., Sullivan, G.W. & Linden, J. Adenosine A2A agonists in development for the treatment of inflammation. Expert Opin Investig Drugs 14, 797-806 (2005).
![Page 126: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/126.jpg)
114
136. Tsumoto, K. et al. Role of arginine in protein refolding, solubilization, and purification. Biotechnol Prog 20, 1301-1308 (2004).
137. Buchner, J. & Rudolph, R. Renaturation, purification and characterization of recombinant Fab-fragments produced in Escherichia coli. Biotechnology (N Y) 9, 157-162 (1991).
138. Chen, J. et al. Cooperative effects of urea and L-arginine on protein refolding. Protein Expr Purif 66, 82-90 (2009).
139. King, L.A. The baculovirus expression system: a laboratory guide. (1992). 140. Winders, B.R., Schwartz, R.H. & Bruniquel, D. A distinct region of the murine
IFN-gamma promoter is hypomethylated from early T cell development through mature naive and Th1 cell differentiation, but is hypermethylated in Th2 cells. J Immunol 173, 7377-7384 (2004).
141. Popovic, P.J., Zeh, H.J., 3rd & Ochoa, J.B. Arginine and immunity. J Nutr 137, 1681S-1686S (2007).
142. Bronte, V. & Zanovello, P. Regulation of immune responses by L-arginine metabolism. Nat Rev Immunol 5, 641-654 (2005).
143. Rodriguez, P.C. et al. L-arginine consumption by macrophages modulates the expression of CD3 zeta chain in T lymphocytes. J Immunol 171, 1232-1239 (2003).
144. Xu, F. et al. Structure of an agonist-bound human A2A adenosine receptor. Science 332, 322-327 (2011).
145. Bruhns, P. Properties of mouse and human IgG receptors and their contribution to disease models. Blood 119, 5640-5649 (2012).
146. Gavin, A.L., Barnes, N., Dijstelbloem, H.M. & Hogarth, P.M. Identification of the mouse IgG3 receptor: implications for antibody effector function at the interface between innate and adaptive immunity. J Immunol 160, 20-23 (1998).
147. Collin, M. & Olsen, A. EndoS, a novel secreted protein from Streptococcus pyogenes with endoglycosidase activity on human IgG. EMBO J 20, 3046-3055 (2001).
148. Collin, M. & Olsen, A. Effect of SpeB and EndoS from Streptococcus pyogenes on human immunoglobulins. Infect Immun 69, 7187-7189 (2001).
149. Zou, G. et al. Chemoenzymatic synthesis and Fcgamma receptor binding of homogeneous glycoforms of antibody Fc domain. Presence of a bisecting sugar moiety enhances the affinity of Fc to FcgammaIIIa receptor. J Am Chem Soc 133, 18975-18991 (2011).
150. Huang, C.T. et al. Role of LAG-3 in regulatory T cells. Immunity 21, 503-513 (2004).
151. Jefferis, R. Isotype and glycoform selection for antibody therapeutics. Arch Biochem Biophys 526, 159-166 (2012).
152. Bumbaca, D., Boswell, C.A., Fielder, P.J. & Khawli, L.A. Physiochemical and biochemical factors influencing the pharmacokinetics of antibody therapeutics. AAPS J 14, 554-558 (2012).
153. Carman, A.J., Mills, J.H., Krenz, A., Kim, D.G. & Bynoe, M.S. Adenosine receptor signaling modulates permeability of the blood-brain barrier. J Neurosci 31, 13272-13280 (2011).
![Page 127: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/127.jpg)
115
154. Frutos, S., Goger, M., Giovani, B., Cowburn, D. & Muir, T.W. Branched intermediate formation stimulates peptide bond cleavage in protein splicing. Nat Chem Biol 6, 527-533 (2010).
![Page 128: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/128.jpg)
116
Curriculum Vitae
Meng-Jung Chiang
1915 E. Madison St., 316 Hunterian Building,
The Johns Hopkins University SOM, Baltimore, MD 21205 Office: (410) 614-0322. Cell: (347) 832-6321. E-mail: [email protected]
EDUCATION The Johns Hopkins University School of Medicine Baltimore, MD Ph.D. candidate in Pharmacology and Molecular Science August, 2014 University of Pennsylvania Philadelphia, PA Master of Biotechnology 2006 National Taiwan University Taipei, Taiwan B.S. in Chemistry 2004 PUBLICATIONS Meng-Jung Chiang et al. “An Fc Domain Protein-Small Molecule Conjugate as an Enhanced Immunomodulator.” J. Am. Chem. Soc. 136(9), 3370-3373. Feb., 2014 Wang WJ, Kuo JC, Ku W, Lee YR, Lin FC, Chang YL, Lin YM, Chen CH, Huang YP, Chiang MJ, Yeh SW, Wu PR, Shen CH, Wu CT, Chen RH. “The Tumor Suppressor DAPK Is Reciprocally Regulated by Tyrosine Kinase Src and Phosphatase LAR.” Mol. Cell, 27( 5), 701-716. Sep., 2007 RESEARCH EXPERIENCES The Johns Hopkins University School of Medicine, Dept. of Pharmacology and Molecular Science Baltimore, MD Thesis student, Dr. Philip A. Cole’s lab April, 2009 - Present Dissertation: Protein-small molecule conjugate for therapeutic development The Johns Hopkins University School of Medicine, Dept. of Biophysics and Biophysical Chemistry Baltimore, MD Rotation student, Dr. L. Mario Amzel’s lab Dec., 2008 - April, 2009 Research Project: Crystallization of negative regulator of SRE1 (sterol regulatory
element), Ofd1, a prolyl hydroxlase family member.
![Page 129: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/129.jpg)
117
Academia Sinica, Institute of Biological Chemistry Taipei, Taiwan Research assistant, Dr. Ruey-Hwa Chen’s lab May, 2006 - June, 2008 Research Project: Study intermolecular interaction in death-associated protein
kinase (DAPK) by using surface plasmon resonance. Identification of the substrates of Cullin3-KLHL20, a ubiquitin E3 Ligase. Wistar Institute Philadelphia, PA Master research assistant, Dr. David W. Speicher’s lab May, 2005 - Dec., 2005 Research Project: Comparison of two methods: Four-dimensional fractionation
approach vs. Isotope-Coded Affinity Tag (ICAT), for discovery of serum cancer biomarkers.
National Taiwan University, Dept. of Chemistry Taipei, Taiwan Project research assistant, Dr. Chao-Tsen Chen’s lab June, 2003 – June, 2004 Research Project: Study of the interaction between lectins and sugars by using
silica nanoparticles and protein labeling via fluorescence energy transfer mechanism.
TECHNICAL SKILLS Organic Synthesis: Solid-phase synthesis, organic reactions and silica
nanoparticle synthesis/modifications. Spectrometry: NMR, UV-Visible, IR, Fluorescence, LC-MS/MS, MALDI-TOF. Protein Chemistry: Expressed protein ligation (intein chemistry), protein
folding and secretion, protein labeling including fluorescent dye and alkylation. Protein and Peptide Purification: FPLC (AKTA), ion exchange column, affinity
column, gel filtration and reverse-phase HPLC. Electrophoresis: Acrylamide SDS gel and DNA agarose gel. Molecular Biology: PCR, mutagenesis, cloning, DNA transformation, RT-PCR. Cell Culture: Mammalian cell (HEK 293, CHO, primary T cell and dendritic cell),
insect cell (Sf9, Sf21, High Five), yeast, and bacteria culture. Others: DNA transfection, western blotting 154, immunoprecipitation (IP), gel
pixilation & in gel digestion, ELISA, flow cytometry (FACS), MACS cell enrichment, Biacore SPR, adoptive transfer, animal disease model, mice genotyping, immnunohistochemistry (IHC) staining.
AWARDS Scheinberg Travel Award, The JHU School of Medicine, Dept. of Pharmacology
and Molecular Science 2012 Graduate Student Association Travel Award, The JHU School of Medicine 2012 Study Abroad Scholarship, Ministry of Education, Taiwan 2008
![Page 130: An Fc Domain Protein–Small Molecule Conjugate as an ... · An Fc Domain Protein–Small Molecule Conjugate as an Enhanced Immunomodulator by Meng-Jung Chiang A dissertation submitted](https://reader031.fdocuments.in/reader031/viewer/2022022722/5c68469e09d3f23a018d36f5/html5/thumbnails/130.jpg)
118
Outstanding Project Award, National Taiwan University, Dept. of Chemistry 2003 PROFESSIONAL PRESENTATIONS & CONFERENCES Attendee, High-Throughput Biology Center Symposium-Human Systems Biology
Baltimore, MD Nov., 2012 Presenter, Protein-small molecule conjugate for therapeutic development, Gordon
Research Conference in Bioorganic Chemistry Andover, NH June, 2012
Attendee, CAPA 2011 Taiwan Biotechnology Forum Rockville, MD June, 2011
Attendee, ACPA Conference on Biopharmaceutical Comparability Rockville, MD Oct., 2005
Representative, Taiwanese industry and government at Bio 2005 Philadelphia, PA June, 2005
Attendee, University of Pennsylvania Bioinformatics and microarray symposiums Philadelphia, PA June, 2005
OTHERS Activity: Vice president, The JHU Taiwanese Student Association 2010 – 2011 Language: Fluent in English and Mandarin Chinese