Virus Research, 13 (1989) 207-212

Ekevier

207

VIRUS 00502

Altered hepatitis A VP1 protein resulting from cell culture propagation of virus

Betty H. Robertson I, Vi&i K. Brown ’ and Bhawna Khanna 2 ’ Hepatitis Branch, lkision of Viral Diseases A33, Centem for Disease Control, A&n&, GA 30333, U.S.A.

and ’ Purdue Universiiy, West Lafaverte, irV, U.S.A.

(Accepted 17 March 1989)

The published sequence of hepatitis A virus (HAV), strain HAS-15, after 20-30 cell culture passages contains an 18 nucleotide deletion (Ovchinnikov et al., 1985) within the VP1 genome region. This results in a significant amino acid difference of the VP1 protein when this strain of HAV is compared with other published HAV sequences. Comparison of the polyac~l~de gel el~trophoretic migration of HAS-15 HAV and two other strains of HAV revealed that the HAS-15 VP1 molecule migrated faster than the VP1 molecule of the other two strains. Enzymatic amplification of viral RNA derived from the original stool suspension and cell culture adapted HAS-15 using the polymerase chain reaction followed by hybridiza- tion analyses with selected synthetic oligonucleotide probes revealed that the original wild type virus did not contain the deletion. These results confirm that cell culture adapted HAS-15 contains an eighteen nucleotide deletion which apparently was selected during cell culture adaptation.

Hepatitis A; Cell-culture adapted; Wild type; VP1

Hepatitis A virus (HAV), a member of the picomavirus family, contains three surface-exposed capsid polypeptides, VPl, VP2, and VP3 (Coulepis et al., 1978; Tratschin et al., 1981; Linemeyer et al., 1985; Wheeler et al., 1985). Currently thdre are six published sequences of the VP1 capsid region of different HAV strains

Correspondence to: B.H. Robertson, Hepatitis Branch, Division of Vial Diseases A33, Centers for Disease Controi, Atlanta, GA 30333, U.S.A.

208

(Najarian et al., 1985; Linemeyer et al., 1985; Ovchirmikov et al., 1985; Baroudy et al., 1985; Cohen et al., 1987; Robertson et al., 1987; Paul et al., 1987). Two of these strains as published, HAS-15 and LA, contain regions of nucleotide insertions or deletions within the VP1 genome which result in major regions of amino acid variability or deletions (Najarian et al., 1985; Ovchinnikov et al., 1985).

Verification of nucleotide-derived amino acid sequence by protein chemical techniques such as polyacrylamide gel electrophoresis (PAGE) or protein sequenc- ing is necessary when variability is found by nucleotide sequencing and provides confirmation that genetic changes are reflected in the translated product. The I8 nucleotide deletion within the VP1 region of the HAS-15, resulting in a six amino acid deletion, should affect the PAGE migration of the VP1 molecule_ A compari- son of the PAGE migration of the HAS-15 strain to that of Abbott HAV revealed the VP1 molecule of HAS-15 (Fig. lA, lane 1) migrated more rapidly than the VP1 of Abbott HAV (Fig. lA, lane 2). To verify that this observation was not restricted to these two cell culture derived strains, the migration of HAS-15 polypeptides was compared with MS-l HAV polypeptides from partially purified virus derived from marmoset livers. Despite the background staining derived from the liver prepara- tion, the results of this PAGE analysis, seen in Fig. lB, revealed that the VP1 molecule of HAS-15 (Lane 2) was smaller than the MS-1 VP1 (Lane 1). The identity of the stained bands and their relative migration was confirmed by Western blotting with anti-HAV specific antisera (data not shown).

The sequence of HAS-15 VP1 was determined from cloned cDNA of virus obtained after 20-30 cell culture passages (Ovchinnikov et al., 1985). The PAGE patterns obtained with passage 60 HAS-15 HAV could be explained by an 18 nucleotide deletion within the VP1 genome region. However, the deletion could have resulted from an artifact during the cloning process, or the altered PAGE migration of VP3 could be the result of aberrant cleavage or proteolytic processing. Therefore, the VP1 nucleotide sequence was determined using synthetic ohgonucleotide primers and dideoxynucleotide termination (Sanger, 1977) directly from viral RNA to verify that the observed difference in PAGE migration was the result of the 18 nucleotide deletion. The sequence of the first 700 nucleotides of the VP1 region (data not shown) reveals that the 18 nucleotide deletion was present within the passage 60 HAS-15 HAV, and differs from the published sequence by a single nucleotide difference (A to G) (position 2284) resulting in an isoleucine to methionine amino acid change. The remainder of the sequence is highly conserved, even after extensive cell culture growth.

The discrepancy between HAS-15 and other published strains of HAV that contain additional nucleotides in this region could reflect intrinsic genetic dif- ferences between HAV strains or could have arisen during the process of adaptation and passage in cell culture. Therefore, the sequence of this region of wild type RNA in the original stool sample and RNA derived from cell culture adapted virus was compared after in vitro enzymatic amplification. Intact viral particles were im- munoselected (Jansen et al., 1985) on an imrnunlon well (Dynatech, Chantilly, VA) coated with purified rabbit anti-160s HAV antibody. After proteinase K digestion of bound virus and antibody, viral RNA was extracted and precipitated in the

209

Fig. 1. Silver stained PAGE of different HAV strains. The MS-l strain was partially purified from marmoset livers after twenty passages (Robertson et al., 1987); Abbott strain, grown in Alexander

hepatoma cells (graciously provided by Emerson Chart, Abbott Laboratories, Abbott Park, Illinois), and

HAS-15 strain, grown in FRhM cells (Wheeler et al., 1986), were purified by gradient centrifugation

based on sedimentation and density. A gradient PAGE system developed by Tsang et al. (1984) and

described in detail by Wheeler et al. (1986) was used to separate HAV capsid polypeptides. Panel A:

Lane 1, HAS-15 HAV, Lane 2, Abbott HAV. Panel B: Lane 1, MS-l HAV, Lane 2, HAS-15 HAV.

presence of 1 pg of rabbit b-globin mRNA (Bethesda Research Laboratories, Gaithersburg, MD) as carrier. The RNA was converted to the ds cDNA form with the Gubler and Hoffmann (1983) cDNA synthesis kit (Boehringer Mannheim, Indianapolis, IN) using a synthetic oligonucleotide primer designed to bind to nucleotides 2339-2414 (PCR primer 1: 5’GGAAATGTCTCAGGTACTTICTITG 3’) of the VP1 region, Enzymatic amplification of viral cDNA by the polymerase chain reaction (Scharf et al., 1986; Saiki et al., 1988) was performed using Geneamp kit (Perkin Ehner Cetus, Norwalk, CT) reagents, PCR primer 1, and a second synthetic oligonucleotide primer containing nucleotides 2167-2192 of the VP3 C terminus (PCR primer 2: 5’GTTTTGCTCCTCTATGCTATG 3’). Thirty

210

cycles of denaturation at 98’C for 1 min, annealing at 42” C for 2 min, and extension at 70°C for 3 tin were performed. After dectrophoresis in a 2% agarose geI, the PCR amplified products were analyzed by ethidium bromide staining and

Pig. 2. Analysis of enzymatically amplified HAV genome Fragment codiug for nucleotides 2167 (within VP3) to 2414 (within VPl). The nomenclature for nucleotide numbering is based upon the published sequence of HM-17s HAV (Cohen et al., 1987). Panel A: Ethidium bromide stained 2% agarose gel analysis af ~~ymafi~al~y amplified products Panel B: Southern blot analysis of amplified products using kinase labeled synthetic oligonucfeotide probe designed to bind to nucleotides 2283-2300 of HAV VPI genome region. Panel C: Southern blot analysis of amplified products using kinase labeled synthetic oligonucleotide probe designed to bmd to nucleotides 2232~2251 of HAV VP1 genome region. Lane 1: P&X174 WueIII cui markers in descending order of migration - 1353bp, 1078bp, 876bp. 603bp, 310bp, doublet comprised of 271 and 281bp, 23Sbp, 194bp, Itgbp, and 72bp; Lanes 2,4,6: Amplified fragment

from cell culture adapted HAS-15; Lanes 3, S,7: Amplified fragment from wild type HAS-15

211

hybridization analyses using two discrete kinase labeled synthetic oligonucleotide probes: (a) PCR probe 1 designed to bind to nucleotides 2232-2251 of the VP1 genome region (5’TCAACAACAGTTTCTACAGA 3’) (b) a mixed PCR probe 2 desi

c? ed to pr to the 18 nucleotides deleted from the HAS-15 VP1 region

(5 ’ T AAAT C C CCCATGG’ITGT 3’).

The amplified products from wild-type and cell-culture adapted HAS-15 RNA are shown in Fig. 2A. The two distinct fragments (cell-culture adapted, lane 2; wild-type, lane 3) differ in length by approximately 20 base pairs, based on migration of the standards shown in lane 1 of Fig. 2A. A synthetic oligonucleotide

probe, designed to bind to the 18 nucleotide deletion, bound only to the amplified

product of wild type RNA (Figure 2B). In contrast, both amplified products bound

a probe containing the sequence of the amino terminus of the VP1 region common

to both wild type and attenuated genomes (Fig. 2C). These investigations demonstrate that the VP1 protein of HAS-15 HAV, after cell

culture adaptation, differs from other marmoset-derived and cell culture adapted strains. The deletion (between VP1 nucleotides 2283-2300) appears to have oc-

curred during the early growth of HAS-15 (between passages l-20, based upon the results of Ovchinnikov et al. (1985). Direct sequencing of viral RNA and enzymatic amplification of the specific genome region has confirmed that the uncloned cell culture adapted virus is homogeneous within this region and that the previously published sequence was not the result of clonal selection or a cloning artifact. As the original virus population contained sequences within this region which were deleted before the first twenty passages, it would be informative to have determined at what time(s) the deletion developed and if it is correlated with a discernable phenotypic

property. Unfortunately, aliquots from the first 20 passages of this strain were not saved.

Previous analysis of genetic variability in published sequences of HAV suggested that strains could be genotypically identified based upon geographic locality (Ro-

bertson et al., 1988). However, the analysis was complicated by passage and amplification of the original virus in marmosets and/or cell culture. Direct amplifi- cation of HAV specimens as described in this communication offers the opportunity to determine the genetic relatedness between geographically distinct isolates of HAV without having to amplify and passage virus in marmosets or cell culture. Studies are now underway to determine genotypic patterns of HAV present from epidemic and endemic outbreaks of HAV.

Acknowledgement

These investigations received financial support (B.K.) from the World Health Organization as part of its Programme for Vaccine Development.

212

References

Baroudy, B.M., Ticehurst, J.R., Miele, T.A., MaizeI, J,V., Jr., Purcell, R.H. and Fe&tone, S.M. (1985) Molecular cloning and partial sequencing of hepatitis A virus cDNA coding for capsid proteins and RNA polymerase. Proc. Natl. Acad. Sci. USA 82, 2143-2147.

Cohen, J.I., Ticehurst, J.R., Purcell, R.H., Buckler-White, A. and Baroudy, B.M. (1987) Complete nucleotide sequence of wild-type hepatitis A virus: comparison with different strains of hepatitis A virus and other picornaviruses. J. Virol. 61, 50-59.

Coulepis, A.G., Locarnini, S.A., Ferris, A.A., Lehmann, N.I. and Gust, I.D. (1978) The polypeptides of hepatitis A virus. Intervirology, 10, 24-31.

Gubler. U. and Hoffmann, B.J. (1983) A simple and very efficient method for generating cDNA libraries. Gene 25,263-269.

Jansen, R.W., Newbold, J.E. and Lemon, S.M. (1985) Combined immunoaffinity cDNA-RNA hybridiza- tion assay for detection of hepatitis A &US in clinical specimens. J. Chn. Microbial. 22, 984-989.

Linemeyer, D.L., Menke, J.G., M~tin-Gallardo, A., Hughes, J.V., Young, A. and Mitra, S.W. (1985) Molecular cloning and partial sequencing of hepatitis A viral DNA. J. Virol. 54, 247-255.

Najarian, R., Caput, D., Gee, W., Potter, S.J., Renard, A., Merryweather, J., Van Nest, G. and Dina, D. (1985) Primary structure and gene organization of human hepatitis A virus. Proc. Natl. Acad. Sci. USA 82, 2621-2631.

Ovchinnikov, LA., Sverdlov, E.D., Tsarev, S.A., Arsenian, S.G., Rokhlina, T.O., Chizhikov, V.E., Petrov, N.A., Prikhod’ko, G.G., Blinov, V.M., Vasilenko, SK., Sandakhchiev, L.S., Kusov, I.I., Grabko, V.I., Fleer, G.P., Balayan, M.S. and Drozdov, S.G. (1985) Sequence of 3372 nucleotide units of RNA of the hepatitis A virus, coding the capsids VP4-VP1 and some nonstructural proteins. Dokl. Akad. Nauk SSSR 285,1014-1018.

Paul, A.V., Tada, H., von der Helm, K., Wissel, T., Kiehn, R., Wimmer, E. and Deinhardt, F. (1987) The entire nucleotide sequence of the genome of human hepatitis A virus (isolate MBB). Virus Res. 8, 1533171.

Robertson, B.H., Brown, V.K. and Bradley, D.W. (1987) Nucleic acid sequence of the VP1 region of attenuated MS-l hepatitis A virus. Virus Res. 8, 309-316.

Robertson, B.H., Brown, V.K., Stramer, S.L., Hine, T.K., Khanna, B., Anderson, L.J., Fields, H.A., Bradley, D.W. and Margolis, H.S. (1988) Variation within hepatitis A VP1 ammo acid and nucleotide sequences. In: A.J. Zuckermann (Ed.), Viral Hepatitis and Liver Disease, pp. 48-54. Alan R. Liss, New York, NY.

Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors.. Proc. Natl. Acad. Sci. USA 74, 5463-5467.

Scharf, S.J., Horn, G.T. and Erhch, H.A. (1986) Direct cloning and sequence analysis of enzymatically amplified genomic sequences. Science 233,1076-1078.

Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-494.

Tratschin, J., Siegl, G., Frosner, G.G. and Deinhardt, F. (1981) Characterization and classification of virus particles associated with hepatitis A. Ill. Structural proteins. J. Virol. 38, 151-156.

Tsang, V.C.W., Hancock, K., Maddison, SE., Beatty, A.L. and Moss, D.M. (1984) Demonstration of species-specific and cross-reactive components of the adult microsomal antigens from Schisfosoma mansoni and S. juponicum (MAMB and JAMA) J. ImmunoI. 132, 2607-2613.

Wheeler, CM., Robertson, B.H., Van Nest, G., Dina, D., Bradley, D.W. and Fields, H.A. (1986) Structure of hepatitis A virion: peptide mapping of the capsid region. J. Virol. 58, 307-313.

(Received S December 1988; revision received 16 March 1989)