Abstract Ryegrasses, like many C3 plants, accumulatefructan, which plays an important role in assimilate par-titioning, as the major non-structural storage carbohy-drate. The present study describes the transformation ofa Bacillus subtilis sacB gene, with vacuolar targetingsignal sequences and driven by constitutive promoters,into Italian ryegrass (Lolium multiflorum Lam.) by mi-croprojectile bombardment of embryogenic suspensioncells. The expression of the chimeric sacB genes intransgenic ryegrass plants and the concomitant accumu-lation of low levels of bacterial levan were found to sub-stantially distort the native grass fructan synthesis pat-tern. High-molecular-weight native fructan was depleted,and the pattern of accumulation of oligosaccharides inthe range of 5–35 degree of polymerization was altered.The levan-accumulating sacB-transgenic ryegrass plantshad a lower level of total fructose, unchanged sucroselevels, and slightly reduced hexose levels compared tothe isogenic controls. Growth of the levan-accumulatingsacB-transgenic ryegrass plants slowed down with theonset of the reproductive phase. Flowering plants werestunted and had narrower leaves and poorly developedroots. The association between the manipulated fructanmetabolism and the phenotype of the levan-accumulatingsacB-transgenic ryegrass plants is discussed.

Keywords Ryegrass · Lolium multiflorum · Fructan · Levansucrase · Transgenic plants

Abbreviations DP Degree of polymerization · FEH Fructan exohydrolase · 1-FFT Fructan-fructan 1-fructosyltransferase · 6G-FFT fructan fructan 6-glucose fructosyltransferase · HPAEC-PAD High-performance anion exchange chromatography analysis with pulsed amperometric detection · RT-PCR Reverse transcription-polymerase chain reaction · 6-SFT Sucrose fructan 6-fructosyltransferase · 1-SST Sucrose-sucrose 1-fructosyltransferase · TLC Thin layer chromatography ·WSC Water-soluble carbohydrate

Introduction

Many C3 grasses of temperate origin accumulate highamounts of fructan, a fructose-containing polymer, as themajor storage carbohydrate (Chatterton et al. 1989). Syn-thesis of fructan occurs in the vacuole and is generallythought to be initiated by a fructosyltransfer from onesucrose molecule to another to form a trisaccharide and glucose. This reaction is catalyzed by sucrose-sucrose 1-fructosyltransferase (1-SST, EC 2.4.1.99). Var-ious fructan structures may subsequently arise as a resultof the position of attachment of further fructose units toeither the glucosyl or fructosyl moiety of sucrose or tothe terminal fructosyl moiety of the trisaccharide. Thelatter reaction is thought to be catalyzed by fructan-fruc-tan 1-fructosyltransferase (1-FFT, EC 2.4.1.100) to pro-duce a mixture of similar fructans – inulins with differ-ent chain lengths (Edelman and Jefford 1968). The en-zyme responsible for the hydrolysis of fructan in plantsis fructan exohydrolase (FEH, EC 3.2.1.80).

In most of the grass species studied so far, the lengthof the fructan polymer is limited to about 5–60 fructoseunits (Pollock and Cairns 1991). In grasses such asLolium, Festuca and Dactylis the predominant linkagepattern between adjacent fructose residues in the high-

Communicated by M. Beckert

X.D. Ye · X.L. Wu · H. Zhao · M. Frehner · J. NösbergerI. Potrykus · G. Spangenberg (✉ )Institute for Plant Sciences, Swiss Federal Institute of Technology, 8092 Zürich, Switzerlande-mail: German.Spangenberg@nre.vic.gov.auFax: +61-3-94793618

Present addresses:X.D. Ye, Agracetus-Monsanto, 8520 University Green, Middleton, WI 53705, USA

G. Spangenberg, Plant Biotechnology, Centre Agriculture Victoria, Department of Natural Resources and Environment, and CRC for Molecular Plant Breeding, La Trobe University, Bundoora, Victoria 3083, Australia

Plant Cell Reports (2001) 20:205–212DOI 10.1007/s002990000304

GENETIC TRANSFORMATION AND HYBRIDIZATION

X.D. Ye · X.L. Wu · H. Zhao · M. FrehnerJ. Nösberger · I. Potrykus · G. Spangenberg

Altered fructan accumulation in transgenic Lolium multiflorumplants expressing a Bacillus subtilis sacB gene

Received: 8 May 2000 / Revision received: 26 October 2000 / Accepted: 8 November 2000 / Published online: 3 February 2001© Springer-Verlag 2001

molecular-weight (HMW) fructan is β-(2,6); this kind offructan is often referred to as levan by analogy with bac-terial fructan (Pollock and Cairns 1991). Fructan may account for more than 30% of the dry weight of grassleaves, stems, and ears depending on their state of de-velopment and on environmental conditions such as light intensity, water supply, temperature, and nutrition (Pollock and Jones 1979; Labhart et al. 1983).

Fructan reserves mainly accumulate in the stems ofpasture grasses growing in the annual pasture (Griffith1992), or they are stored in the leaf sheaths of perennialgrasses to support the early stages of regrowth after defoliation or overwintering (Smith 1967; Pollock andJones 1979; Yamamoto and Mino 1982).

In addition to the role of fructan in assimilate parti-tioning (Pollock and Cairns 1991; Schnyder 1993), fruc-tan has also been implicated in osmoregulation (Pontis1989; Spollen and Nelson 1994) and is considered to beimportant in the response to environmental stresses suchas drought and cold (Pontis 1989; Chatterton et al. 1991;Pollock and Cairns 1991; Hendry 1993; Pilon-Smits etal. 1995a).

Fructan accumulation has been introduced into non-fructan-accumulating plants by transgenically expressingfructan synthesis genes. Increased tolerance to simulateddrought stress in levan-accumulating transgenic tobaccowas reported (Ebskamp et al. 1994; Pilon-Smits et al.1995a); however, no effects on the growth of organs andalteration in dry weight and carbohydrate partitioningwere described in tobacco and potato where bacterial le-vansucrase genes were transgenically expressed in dif-ferent cell compartments and organs (Pilon-Smits et al.1995a; Caimi et al. 1996, 1997; Röber et al. 1996; Turket al. 1997).

Plant fructan metabolism-related genes were not avail-able until recent years when the gene encoding sucrosefructan 6-fructosyltransferase from barley was firstcloned (Sprenger et al. 1995). This 6-SFT gene was in-strumental in the isolation of fructan fructan 6-glucosefructosyltransferase cDNA from onion (Vijn et al. 1997)and a sucrose-sucrose 1-fructosyltransferase cDNA fromartichoke (Hellwege et al. 1997). Functional expressionof the barley 6-SFT and the onion 6G-FFT genes in trans-genic tobacco, a naturally fructan-deficient plant, leads tooligofructan accumulation, whereas the expression of ei-ther of both genes in transgenic chicory, a plant naturallyproducing only unbranched fructan of the inulin type (β-2,1 linkages), leads to the synthesis of novel fructan(Sprenger et al. 1997; Vijn et al. 1997). Transgenic potatotubers expressing the artichoke 1-SST gene accumulatehigh levels of 1-kestose along with nystose (Hellwege etal. 1997), which provides the first evidence for 1-SST be-ing the entry point of plant fructan biosynthesis.

The purpose of the study reported here was to estab-lish the methodological basis required to exploit the po-tential of transgenic grasses in order to study the regula-tion and role of fructan metabolism, and the physiologicalconsequences of its manipulation, in native fructan-accu-mulating temperate grasses, the ryegrasses (Lolium spp.).

Materials and methods

Initiation and maintenance of suspension cultures

Seeds from Italian ryegrass (Lolium multiflorum Lam. ssp. wester-woldicum cv. Andy), provided by B. Boller, FAL-Zürich-Recken-holz, Switzerland, were used for the initiation of embryogeniccalli and cell suspension cultures as previously described (Wang etal. 1993).

Construction of sacB expression vectors

Plasmid pKK3 bearing the sacB coding sequence for the Bacillussubtilis levansucrase (EC 2.4.1.10) (Steinmetz et al. 1985) fused tothe yeast carboxypeptidase Y (cpy) vacuolar targeting signal se-quence (Valls et al. 1987) and plasmid pSTU337 containing thesacB coding sequence fused to the sweet potato preprosporaminvacuolar targeting signal sequence (spor) (Hattori et al. 1985)were kindly provided by Ad de Laat, Van der Have, The Nether-lands and Stefan Turk, Department of Molecular Cell Biology,University of Utrecht, The Netherlands, respectively.

Plasmids pKK3 and pSTU337 were double-digested with AccIand PstI, and with SphI and BamHI, respectively. The completesacB coding sequence with the vacuolar targeting signal sequenc-es, i.e., cpy-sacB and spor-sacB fragments, were isolated andblunt-ended with T4 DNA polymerase following standard proce-dures (Sambrook et al. 1989).

The maize ubiquitin promoter including intron I from pUBcIwas HindIII–BamHI-digested and ligated into HindIII–BamHI-digested pRT104 (Töpfer et al. 1987) to create the vectorpUbi35S. Plasmids pUBCsacB and pUBSsacB were constructedby the insertion of the blunt-ended cpy-sacB and spor-sacB frag-ments into the BamHI site of pUbi35S after blunt-ending with T4DNA polymerase. The plasmid pKM containing the CaMV 35Spromoter-driven chimeric cpy-sacB for constitutive transgene ex-pression was made available by Ad de Laat, Van der Have, TheNetherlands.

Transformation of L. multiflorum and molecular analysis of sacB-transgenic plants

Plasmids containing the chimeric sacB genes and pAcH1 bearinga chimeric truncated hygromycin phosphotransferase (hph) gene(Bilang et al. 1991) as selectable marker were co-transformed intoembryogenic suspension cells of L. multiflorum by microprojectilebombardment (Spangenberg et al. 1995; Spangenberg and Wang1998). Transgenic Italian ryegrass plants were recovered andgrown to maturity under greenhouse conditions [16 h (light)/8 h(dark) photoperiod; 23°C/18°C; fluorescent light 145 µmol m–2 s–1]as previously reported (Ye et al. 1997; Spangenberg et al. 1998,1999).

DNA and RNA isolation, gel electrophoresis and hybridizationexperiments were carried out as described previously (Ye et al.1997). For RT-PCR detection of sacB gene expression in the trans-genic plants, total cellular RNA was treated with 20 U/ l RNase-free DNaseI at 37°C for 30 min. The sacB 5′ primer (5′ GA-CGGCACTGTCGCAAACTATCACG 3′) and sacB 3′ primer (5′TCTACGTAGTGAGGATCTCTCAGCG 3′) were used to amplifyan internal 477-bp sacB coding sequence (Steinmetz et al. 1985).The reverse transcription reaction was carried out using Super-ScriptII RTase according to the manufacturer’s instructions (GIBCO-BRL, Life Technologies).

Carbohydrate analysis

Samples from fully expanded leaves from greenhouse-grown rye-grass plants were harvested at the end of the photoperiod and im-mediately immersed in liquid nitrogen. For each plant 500-mgsamples of leaf material were ground in liquid nitrogen with a

206

mortar and pestle and the powder extracted with 2 ml of 80% boil-ing ethanol for 15 min. After centrifugation at 10,000 g for10 min, the pellet was re-extracted three times with 1 ml water at80°C for 15 min each time. The extracts were pooled and concen-trated to 500 µl in a Savant Speed-Vac concentrator (Savant In-strumental, Farmingdale, N.Y.).

HMW transgenic fructan was separated from total WSC ex-tracts by size exclusion chromatography on Sepharose CL-4B asfollows: Sepharose CL-4B was washed three times with distilledwater and resuspended in water. A 1-ml syringe barrel wasplugged with glass-wool, filled with the Sepharose CL-4B suspen-sion, and subjected to centrifugation in a 12-ml centrifuge tube at1,000 g for 5 min. This column was topped with the SepharoseCL-4B suspension and centrifuged; this procedure was repeateduntil a 1-ml column volume was obtained. The column waswashed by the addition of 100 µl distilled water and centrifugationat 1,000 g for 5 min. A 100-µl aliquot of the WSC extract wasloaded on the column, and the eluate was collected in a de-capped1.5-ml Eppendorf tube held in a 12-ml centrifuge tube by centrifu-gation at 1,000 g for 5 min. The eluate was used either directly orafter concentration in a Savant Speed-Vac for the analysis ofHMW fructans.

Sugars and fructans were separated by TLC (TLC-Ready-Plates G 1500, Schleicher & Schuell, Feldbach, Switzerland). Hy-drolysis of fructans was performed as described by Ebskamp et al.(1994). The plates were developed twice in a solvent mixture ofbutanol:propanol:water (3:12:4, v/v/v). Sugars were detected bythe urea-phosphoric acid spray (Wise et al. 1955). Purified fructanfrom Helianthus tuberosus (provided by S. Marx), levan fromErwinia herbicola (Sigma L-8647), and fructose and sucrose wereused as standards.

Fructose equivalents content in the total WSC and HMW fruc-tans were quantified spectrophotometrically by the cysteine-carb-azole method (Nakamara 1968). Dilutions from a 1 mM fructosesolution were used to generate a calibration curve.

Total WSC extracts were separated by HPAEC-PAD (Rocklinand Pohl 1983) using a Dionex-CarboPac PA-100 column fittedwith a CarboPac Guard PA-100 set (Dionex, Henry Sarasin, Basel,Switzerland). The detector (ESA Coulochem II Model 5040; ESA,Bedford, USA) was set as described by Lüscher et al. (1993). Thesodium acetate gradient in 100 mM NaOH used to separate carbo-hydrates was as follows: 0–5 min, 50 mM; 5–50 min, increasinglinearly to 500 mM; 50–55 min, decreasing linearly to 50 mM;with an equilibration for an additional 50 min. Similarly, fructose,glucose, and sucrose were determined using an isocratic system at150 mM NaOH instead of the gradient as eluant.

Results

Construction of sacB expression vectors

The expression constructs bearing the Bacillus subtilissacB gene driven by the maize ubiquitin I promoter, in-cluding its own intron and double CaMV 35S promoter,are depicted in Fig. 1. The complete bacterial sacB cod-ing sequence was fused to the vacuolar targeting signalsequence from the cpy or spor genes to direct the ex-pressed levansucrase to the vacuole (Ebskamp et al.1994; Turk et al. 1997).

Recovery of sacB-transgenic Lolium multiflorum plants

In order to generate sacB-expressing transgenic ryegrassplants with manipulated fructan metabolism, we subject-ed embryogenic suspension cells of L. multiflorum to mi-

croprojectile bombardment with particles coated withdifferent chimeric sacB gene-bearing vectors (Fig. 1) andthe plasmid pAcH1-bearing a chimeric Act-hph gene asselectable marker. In total, 648 dishes (each containing200–300 mg FW) of L. multiflorum suspension cellswere used for co-transformation with each of the threechimeric sacB constructs combined with the hph select-able marker gene (Ye et al. 1997). After selection withhygromycin, 99 hph- and 64 sacB-Southern hybridiza-tion-positive transgenic plants were obtained, represent-ing an average co-transformation frequency of 65%. Theresults are summarized in Table 1.

The transgenic nature of the recovered L. multiflorumplants was confirmed by Southern hybridization withhph and sacB probes separately, using undigested and di-gested total cellular DNA samples. Most lines containedtwo to five hph- and sacB-hybridizing bands, indicatingthe integration of multiple and rearranged hph and sacBtransgene copies. Different hybridization patterns, in-cluding additional hph- and sacB-hybridizing bands,were observed, indicating that the corresponding plantswere derived from independent transformation events(data not shown).

To analyze the expression of the transferred chimericsacB genes, we prepared total RNA from leaf tissue sam-

207

Fig. 1 The chimeric levansucrase sacB genes used for ryegrasstransformation. B BamHI, E EcoRI, H HindIII, N NcoI, S SalI, XXbaI

Table 1 Transformation of Lolium multiflorum with chimericsacB genes

Plasmid Bombarded hph transgenic sacB transgenic dishesa plantsb plantsb

pKM 373 35 14pUBCsacB 132 29 24pUBSsacB 143 35 26

Total 648 99 64

a Each bombarded dish contained 200–300 mg (FW) of suspensioncellsb Hph- and sacB-transgenic plants refer to the number of plants re-generated from independent hygromycin-resistant calli whichwere positive when subjected to Southern hybridization analysisusing hph and sacB hybridization probes, respectively

pled from Southern hybridization-positive transgenicryegrass plants and subjected it to Northern hybridiza-tion analysis. This analysis failed to reveal detectablelevels of sacB transcripts (data not shown). Therefore,the more sensitive reverse RT-PCR method was used forthis purpose. The expected amplification product corre-sponding to a 477-bp internal sacB gene fragment wasreproducibly detected in 16 out of the 42 sacB-transgenicL. multiflorum plants analyzed. Representative resultsfrom this RT-PCR analysis of the transgenic ryegrassplants are shown in Fig. 2.

Analysis by TLC of fructan from sacB-transgenicL. multiflorum leaves

RT-PCR-positive sacB-transgenic ryegrass plants wereanalyzed for the accumulation of HMW fructan usingTLC, since the HMW fructan of the levan type is the ex-pected product from the functional expression of thesacB transgene. Indeed, out of 16 sacB-RT-PCR-positivetransgenic L. multiflorum plants three were confirmed toaccumulate HMW levan, which was detectable in shootextracts after size exclusion (Fig. 3, lanes b). Similar sig-nals at the TLC application points were observed forsamples from a sacB-transgenic tobacco plant used aspositive control, since tobacco does not accumulate na-tive fructan. The polyfructose nature of the HMW fruc-tan from the transgenic plants (Fig. 3, lanes b) was con-firmed by TLC analysis after acid hydrolysis, which re-leased free fructose (Fig. 3, lanes c). In extracts from thepKM-transformed Italian ryegrass plant, fructans withDP between about 10 and 15 were apparent (Fig. 3, A,lane a). Similar patterns, however, with reduced relativefructose content, as reflected by the reduced signal inten-sities, were observed for extracts from the control rye-grass plants included in the analysis (Fig. 3, N1 and N2).In contrast, no such distinct spots close to the TLC appli-cation points were resolved for the pUBCsacB- andpUBSsacB-transformed L. multiflorum plants (Fig. 3, B,lane a; C, lane a). Furthermore, diffuse spots betweenDP 2 and 10 were observed in samples from the pKM-transformed plant, but these were virtually absent in theother transformed and untransformed Italian ryegrasssamples (Fig. 3, lanes a).

Quantitative analysis of total fructose content

The content of total fructose equivalents in WSC extractsfrom leaves of the sacB-transgenic L. multiflorum plantswas significantly lower than for the pAcH1-transformedand non-transformed isogenic control plants (Fig. 4, leftpanel). The sacB-transgenic Italian ryegrass plants con-tained HMW fructan well above the background levelsdetected in the corresponding samples from controlplants (Fig. 4, right panel).

Analysis of WSC extracts by HPAEC-PAD

Total WSC extracts from leaf material of the sacB-trans-genic L. multiflorum plants accumulating HMW fructanwere subjected to HPAEC-PAD (Fig. 5). Sucrose, fruc-tose, and glucose represented a large proportion of sug-ars in all extracts and appeared as a large merged peak at around 5 min in the HPAEC-PAD chromatograms. Irregular peaks of oligosaccharides between DP 5 and 35were observed in WSC extracts from the sacB-transgenic

208

Fig. 2 RT-PCR analysis of sacB-transgenic Lolium multiflorum.Independent sacB-transgenic L. multiflorum plants were trans-formed with pKM (lane 1), pUBCsacB (lanes 2–10), pUBSsacB(lanes 11–16); lane 17 a non-transformed control L. multiflorumplant. Lane C Negative control with no template, lane P pKM-positive control. Reactions using sacB primers were carried outwith reverse transcriptase (a) and without reverse transcriptase (b)

Fig. 3 Analysis by TLC of HMW fructan accumulation in sacB-transgenic L. multiflorum plants. P HMW fructan from pKM-transformed tobacco as positive control, A pKM-transformed Ital-ian ryegrass plant, B pUBCsacB-transformed Italian ryegrassplant, C pUBSsacB-transformed Italian ryegrass plant; pAcH1-transformed (N1) and non-transformed (N2) Italian ryegrass plantsas negative controls. Lanes: a Extracts from leaves containing100 µg of total fructose equivalents for L. multiflorum and 10 µgof total fructose in ethanol precipitated HMW levan for tobacco,b samples after Sepharose CL-4B column size exclusion from ex-tracts corresponding to 300 µg total fructose for L. multiflorumand 10 µg for tobacco, c corresponding acid-hydrolyzed samplesas b, F fructose, S sucrose, Ht fructan from Helianthus tuberosus,DP degree of polymerization. The signal from bacterial levan-typeHMW fructan is expected at the application site on the TLC plate

Italian ryegrass plants (Fig. 5, panels A–C). The pKM-transformed Italian ryegrass plant showed higher con-tents of oligosaccharides around DP 10 (Fig. 5, panel A)than those observed in control plants (Fig. 5, panels N1and N2). In contrast, extracts from the pUBCsacB- andpUBSsacB-transformed Italian ryegrass plants showedonly trace amounts of oligosaccharides in that range(Fig. 5, panels B and C). These results are in accordancewith the TLC analyses, where no clear signals could beresolved close to the application points in the WSC ex-tracts from leaf material derived from the pUBCsacB-and pUBSsacB-transformed Italian ryegrass plants(Fig. 3, B and C). The most significant change in theWSC profiles revealed by the HPAEC-PAD analysis ofextracts from the sacB-transgenic Italian ryegrass plantsis an important depletion of high DP (>30) oligosaccha-rides, which may correspond to the native HMW fruc-tans, when compared to the corresponding profile ob-served for the otherwise isogenic control plants (Fig. 5).Bacterial HMW levan cannot be detected or resolvedwith this system, as determined using commercialErwinia levan (data not shown).

To quantify the fructose, glucose, and sucrose con-tent, we separated WSC samples by isocratic HPAEC-PAD after a 100-fold dilution. No significant differencein total sucrose content between sacB-transgenic andcontrol plants (16–19 µmol/g FW) was observed, andthere was only a slight decrease in both fructose and glu-cose content in the sacB-transgenic plants (1–1.5 µmol/gFW) compared with control plants (2–2.5 µmol/g FW).

Phenotype of sacB-transgenic L. multiflorum plants

The phenotype of the sacB-transgenic L. multiflorumplants accumulating HMW fructan differed from that ofthe corresponding otherwise isogenic control plants(Fig. 6). During the early vegetative growth phase aftertransfer of the sacB-transgenic L. multiflorum plants tosoil, no differences were observed when compared to thephenotype of the control plants. However, after 2 monthsof growth under greenhouse conditions, when the plantsentered the transition to the reproductive phase, pro-nounced phenotypic differences between the sacB-trans-genic and the control plants were observed: leaf bladesof the vegetative tillers of the sacB-transgenic plantswere narrower and shorter than those of the controlplants, and sacB-transgenic plants were stunted and ap-proximately two-thirds the size of the otherwise isogeniccontrol plants.

Discussion

We have been able to demonstrate that fructan corre-sponding to HMW bacterial levan can be produced in anatively fructan-accumulating species, Lolium multiflo-rum, which expresses chimeric bacterial levansucrasesacB genes. Bacterial levansucrase genes have previous-ly been introduced into several non-fructan-accumulat-ing plants, namely tobacco, Arabidopsis, potato, andmaize (Ebskamp et al. 1994; Van der Meer et al. 1994;Caimi et al. 1996, 1997; Röber et al. 1996).

Expression of the transferred chimeric sacB geneswas demonstrated by RT-PCR at the mRNA level for 16out of 42 sacB-transgenic L. multiflorum plants. The lowlevels of steady-state sacB transcripts in the transgenicryegrass plants could not be detected by Northern hy-bridization analysis. Similarly, no sacB transcripts weredetected by Northern hybridization analysis of sacB-transgenic tobacco plants generated with analogous chi-meric genes (Ebskamp et al. 1994). Furthermore, the ac-cumulation levels of levansucrase in sacB-transgenic to-bacco and maize plants have been reported to be belowthe limit of immunodetection (Ebskamp et al. 1994;

209

Fig. 4 Content of total fructose equivalents in WSC extracts fromleaf material of sacB-transgenic L. multiflorum plants prior to sizeexclusion (left) and after size exclusion (right). Italian ryegrassplants were transformed with: A pKM, B pUBCsacB, C pUBS-sacB. pAcH1-transformed (N1) and non-transformed Italian rye-grass plants (N2), obtained from the same single genotype-derivedembryogenic cell suspension, are negative controls. Mean valuesand standard deviations of the content of total fructose equivalents[in µmol/g FW leaves (left) and in nmol/g FW leaves (right)] fromfour independent experiments are shown

Caimi et al. 1996). The localized regions of AT richnessresembling plant introns, the presence of mRNA-destabi-lizing ATTTA sequences, and the rare codon usage foundin the Bacillus subtilis sacB coding sequence (Steinmetzet al. 1985) may contribute to the quick turnover of thecorresponding mRNA (Murray et al. 1991) and explainthe difficulties in detecting sacB transcripts by Northernhybridization analysis in the sacB-transgenic plants.However, RT-PCR enabled us to reproducibly detect andidentify the sacB-expressing transgenic ryegrass plants.

Three out of 16 RT-PCR-sacB-positive transgenic L.multiflorum plants containing the chimeric sacB genesunder the control of either a double CaMV 35S or amaize Ubi promoter (with different vacuolar targetingsignals in pKM, pUBCsacB, and pUBSsacB) were foundto accumulate low levels of HMW fructan similar to bac-terial levan (<0.01% FW). These low levels of HMWbacterial levan accumulation in the transgenic Italianryegrass plants can be explained by the low levels ofsacB expression. Ryegrass plants can naturally synthe-size HMW fructan of DP>150 (Suzuki 1989). Tobaccoand potato, species that do not accumulate native fruc-tan, have been shown to accumulate levan-type fructanconsisting of over 10,000 fructose units when trans-formed with chimeric sacB genes (Ebskamp et al. 1994;Röber et al. 1996). Furthermore, levan produced trans-genically in ryegrass plants may be degraded in part bythe native ryegrass FEH. Purified FEH from oat has beenshown to hydrolyze bacterial levan at 8.5% of the rate of its best substrate, 6G,6-kestotetraose (Henson andLivingston 1996). Partially purified FEH from barleyand Lolium rigidum showed weak hydrolytic activitieson bacterial levan (Simpson and Bonnett 1993). In con-trast, significantly higher levan accumulation levels, upto 30% of the dry weight depending on the plant speciesand organ tested, were observed in natively non-fructan-accumulating sacB-transgenic plants that lack endogenicfructan hydrolytic activities (Ebskamp et al. 1994; Vander Meer et al. 1994; Pilon-Smits et al. 1995b; Caimi etal. 1996, 1997; Röber et al. 1996).

The expression of chimeric sacB genes in transgenicryegrass plants and the concomitant accumulation of lowlevels of bacterial levan-type fructan were found to sub-stantially distort the native pattern of fructan synthesis.HMW native fructans were depleted in the sacB-trans-genic ryegrass plants. Patterns of oligosaccharides in the5- to 35-DP range were also altered in the transgenicryegrass. Native ryegrass fructans may be used by the

210

Fig. 5 Total WSC profiles of sacB-transgenic Italian ryegrassplants analyzed by HPAEC-PAD. Leaf extracts corresponding to 15 µg total fructose equivalents were separated by HPAEC.A pKM-transformed Italian ryegrass plant, B pUBCsacB-trans-formed Italian ryegrass plant, C pUBSsacB-transformed Italianryegrass plant; pAcH1-transformed (N1) and non-transformed(N2) Italian ryegrass plants obtained from the same single geno-type-derived embryogenic cell suspension as controls. The DP ofthe fructans, based on a separation of fructan from Helianthus tu-berosus, is indicated at the top. The shape of the sodium acetategradient used to elute the fructans is indicated in each panel

transgenic sacB-encoded levansucrase as acceptors ordonors for fructosyl units and, thus, converted intoHMW bacterial-type levan. The sacB-transgenic rye-grass plants contained unchanged sucrose and slightlydecreased monosaccharide levels. Decreased levels ofmonosaccharides and sucrose were reported in leavesfrom cpy-sacB transgenic tobacco plants (Ebskamp et al.1994), while cpy-sacB expression in potato leaves led toincreased monosaccharide and sucrose levels (Van derMeer et al. 1994; Pilon-Smits et al. 1995b). Increasedmonosaccharide and sucrose concentrations were alsofound in tobacco plants constitutively expressing a chi-meric spor-sacB gene (Turk et al. 1997).

Growth of the HMW fructan-accumulating transgenicryegrass plants slowed down with the onset of the repro-ductive phase. The flowering plants were stunted, withnarrower leaves and a poorly developed root system. Asimilar observation has been reported in transgenic pota-to and tobacco plants constitutively expressing chimericsacB genes (Van der Meer et al. 1994; Pilon-Smits et al.1995b; Turk et al. 1997).

Transgenic ryegrass plants with manipulated fructanmetabolism through the transgenic expression of a bacte-rial levansucrase gene were generated. The isolation ofryegrass 1-SST, 1-FFT, and 6-SFT will enable the molec-ular genetic dissection of fructan biosynthesis in grassesto study the regulation and role of fructan metabolismand the physiological consequences of its manipulation.

Acknowledgements Thanks are due to H. Isopp for assistance inthe HPLC analysis. S. Klarer and K. Konja are gratefully ac-knowledged for carefully growing plants in the greenhouse. Thiswork was funded by a Swiss Federal Institute of Technology com-petitive grant (ETH grant 41-2703.5).

References

Bilang R, Iida S, Peterhans A, Potrykus I, Paszkowski J (1991)The 3′-terminal region of the hygromycin-B-resistance gene isimportant for its activity in Escherichia coli and Nicotiana ta-bacum. Gene 100:247–250

Caimi PG, McCole LM, Klein TM, Kerr PS (1996) Fructan accu-mulation and sucrose metabolism in transgenic maize endo-sperm expressing a Bacillus amyloliquefaciens sacB gene.Plant Physiol 110:355–363

Caimi PG, McCole LM, Klein TM, Hershey HP (1997) Cytosolicexpression of the Bacillus amyloliquefaciens sacB protein in-hibits tissue development in transgenic tobacco and potato.New Phytol 136:19–28

Chatterton NJ, Harrison PA, Bennett JH, Asay KH (1989)Carbohydrate partitioning in 185 accessions of Gramineaeunder warm and cool temperatures. J Plant Physiol 134:169–179

Chatterton NJ, Thornley WR, Harrison PA, Bennett JH (1991)DP-3 and DP-4 oligosaccharides in temperate and tropicalgrass foliage grown under cool temperatures. Plant PhysiolBiochem 29:367–372

Ebskamp MJ, van der Meer IM, Spronk BA, Weisbeek PJ, Smeekens SCM (1994) Accumulation of fructose polymers intransgenic tobacco. Biotechnology 12:272–275

Edelman J, Jefford TG (1968) The mechanism of fructosan metab-olism in higher plants as exemplified in Helianthus tuberosus.New Phytol 67:517–531

Griffith SM (1992) Changes in post-anthesis assimilates in stemand spike components of Italian ryegrass (Lolium multiflo-rum Lam.). I. Water soluble carbohydrates. Ann Bot 69:243–248

Hattori T, Nakagava T, Maeshma M, Nakamura K, Asahi T (1985)Molecular cloning and nucleotide sequence of the cDNA forsporamin, the major soulable protein of sweet potato tuberousroots. Plant Mol Biol 5:315–320

Hellwege EM, Gritscher D, Willmitzer L, Heyer AG (1997)Transgenic potato tubers accumulate high levels of 1-kestoseand nystose: functional identification of a sucrose sucrose 1-fructosyltransferase of artichoke (Cynara scolymus) blossomdiscs. Plant J 12:1057–1065

Hendry GAF (1993) Evolutionary origins and natural functions offructans – a climatological, biogeographic and mechanistic ap-praisal. New Phytol 123:3–14

Henson CA, Livingston III DP (1996) Purification and character-ization of an oat fructan exohydrolase that preferentially hy-drolyzes β-2,6-fructans. Plant Physiol 110:639–644

211

Fig. 6 Phenotype of sacB-transgenic L. multiflorum plants. Leftpanel: A pKM-transformed Italian ryegrass plant, B pUBCsacB-transformed Italian ryegrass plant, C pUBSsacB-transformed Italianryegrass plant; pAcH1-transformed (N1) and non-transformed (N2)Italian ryegrass plants as controls. Right panel: Mature leaf bladesfrom vegetative tillers of the corresponding plants of the left panel

Labhart CH, Nösberger J, Nelson C (1983) Photosynthesis and de-gree of polymerization of fructan during reproductive growthof meadow fescue at two temperatures and two photon fluxdensities. J Exp Bot 34:1037–1046

Lüscher M, Frehner M, Nösberger J (1993) Purification and char-acterization of fructan:fructan fructosyltransferase from Jeru-salem artichoke (Helianthus tuberosus L.). New Phytol 123:717–724

Murray EE, Rocheleau T, Eberle M, Stock C, Sekar V, Adang M(1991) Analysis of unstable RNA transcripts of insecticidalcrystal protein genes of Bacillus thuringiensis in transgenicplants and electroporated protoplasts. Plant Mol Biol 16:1035–1050

Nakamura M (1968) Determination of fructose in the presence oflarge excess of glucose, part V. A modified cysteine-carbazolereaction. Agric Biol Chem 32:701–706

Pilon-Smits EAH, Ebskamp MJM, Paul MJ, Jeuken MJW,Weisbeek PJ, Smeekens SCM (1995a) Improved performanceof transgenic fructan-accumulating tobacco under droughtstress. Plant Physiol 107:125–130

Pilon-Smits EAH, Ebskamp MJM, Weisbeek PJ, Smeekens SCM(1995b) Fructan accumulation in transgenic plants: effects ongrowth, carbohydrate partitioning and stress resistance. In:Pontis HG, Salerno GL, Echeverria EJ (eds) Int Symp SucroseMetabol. American Society of Plant Physiologists, Rockville,Md., pp 88–99

Pollock CJ, Cairns AJ (1991) Fructan metabolism in grasses andcereals. Annu Rev Plant Physiol Plant Mol Biol 42:77–101

Pollock CJ, Jones T (1979) Seasonal patterns of fructan metabo-lism in forage grasses. New Phytol 83:9–15

Pontis HG (1989) Fructan and cold stress. J Plant Physiol 134:148–150

Röber M, Geider K, Müller-Röber B, Willmitzer L (1996) Synthe-sis of fructans in tubers of transgenic starch-deficient potatoplant does not result in an increased allocation of carbohy-drates. Planta 199:528–536

Rocklin RD, Pohl CA (1983) Determination of carbohydrates byanion exchange chromatography with pulsed amperometricdetection. J Liquid Chromatogr 6:1577–1590

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning – alaboratory manual. Cold Spring Harbor Laboratory Press, NewYork

Schnyder H (1993) The role of carbohydrate storage and redistri-bution in the source-sink relations of wheat and barley duringgrain filling – a review. New Phytol 123:233–245

Simpson RJ, Bonnett GD (1993) Fructan exhydrolase from grass-es. New Phytol 123:453–469

Smith D (1967) Carbohydrate in grasses. II. Sugars and fructosancomposition of the stem bases of bromegrass and timothy atseveral growth stages and in different plant parts at anthesis.Crop Sci 7:62–67

Spangenberg, Wang ZY (1998) Biolistic transformation of embry-ogenic cell suspensions. In: Celis E (ed) Cell biology: a labo-ratory handbook, 2nd edn, vol 4. Academic Press, New York,pp 162–168

Spangenberg G, Wang ZY, Wu XL, Nagel J, Potrykus I (1995)Transgenic perennial ryegrass plants (Lolium perenne) plantsfrom microprojectile bombardment of embryogenic suspen-sion cells. Plant Sci 108:209–217

Spangenberg G, Wang ZY, Potrykus I (1998) Biotechnology inforage and turf grass improvement. In: Frankel R, GrossmanM, Linskens HF, Maliga P, Riley R (eds) Monographs on theo-retical and applied genetics, vol 23. Springer, Berlin Heidel-berg New York, pp 127–146

Spangenberg G, Wang ZY, Ye XD, Wu XL, Potrykus I (1999)Transgenic ryegrasses (Lolium spp.). In: Bajaj YPS (ed) Bio-technology in agriculture and forestry, vol 46. Transgeniccrops I. Springer, Berlin Heidelberg New York, pp 172–187

Spollen WG, Nelson CJ (1994) Response of fructan to water defi-cit in growing leaves of tall fescue. Plant Physiol 106:329–334

Sprenger N, Bortlik K, Brandt A, Boller T, Wiemken A (1995) Pu-rification, cloning, and functional expression of sucrose: fruc-tan 6-fructosyltransferase, a key enzyme of fructan synthesisin barley. Proc Natl Acad Sci USA 92:11652–11656

Sprenger N, Schellenbaum L, van Dun K, Boller T, Wiemken A(1997) Fructan synthesis in transgenic tobacco and chicoryplants expressing barley surose: fructan 6-fructosyltransferase.FEBS Lett 400:355–358

Steinmetz M, Le Coq D, Aymerich S. Gonzy-Treboul G, Gay P(1985) The DNA sequence of the gene for the secreted Bacil-lus subtilis enzyme levansucrase and its genetic control sites.Mol Gen Genet 200:220–228

Suzuki M (1989) Fructans in forage grasses with varying degreesof cold hardiness. J Plant Physiol 134:224–231

Töpfer R, Matzeit V, Gronenborn B, Schell J, Steinbiss HH (1987)A set of plant expression vectors for transcriptional and trans-lational fusions. Nucleic Acids Res 15:5890

Turk SCHJ, De Roos K, Scotti PA, Van Dun K, Weisbeek P,Smeekens SCM (1997) The vacuolar sorting domain of spora-min transports GUS, but not levansucrase, to the plant vacu-ole. New Phytol 136:29–38

Valls LA, Hunter CP, Rothman JH, Stevens TH (1987) Proteinsorting in yeast: the localization determinant of yeast vacuolarcarboxypeptidase Y resides in the propeptide. Cell 48:887–897

Van der Meer IM, Ebskamp MJM, Visser RGF, Weisbeek PJ,Smeekens SCM (1994) Fructan as a new carbohydrate sink intransgenic potato plants. Plant Cell 6:561–570

Vijn I, van Dijken A, Sprenger N, van Dun K. Weisbeek P, Wiemken A, Smeekens SCM (1997) Fructan of the inulin neo-series is synthesized in transgenic chicory plants (Cichoriumintybus L.) harbouring onion (Allium cepa L.) fructan: fructan6G-fructosyltransferase. Plant J 11:387–398

Wang ZY, Nagel J, Potrykus I, Spangenberg G (1993) Plant fromcell suspension-derived protoplasts in Lolium species. PlantSci 94:179–193

Wise CS, Dimler RJ, Davis HA, Rist CE (1955) Determination ofeasily hydrolyzable fructose units in dextran preparations. AnnBiochem 27:33–36

Yamamoto S, Mino Y (1982) Carbohydrate metabolism in thestem base of orchardgrass (Dactylis glomerata L.) after cut-ting. J Jpn Soc Grassl Sci 28:8–13

Ye X, Wang ZY, Wu X, Potrykus I, Spangenberg G (1997) Trans-genic Italian ryegrass (Lolium multiflorum) plants from micro-projectile bombardment of embryogenic suspension cells.Plant Cell Rep 16:379–384

212