Altered Endosome Biogenesis in Prostate Cancer has Biomarker … · and 2 mM L-glutamine (Sigma...

1

Altered Endosome Biogenesis in Prostate Cancer has Biomarker

Potential

Ian R D Johnson1, Emma J Parkinson-Lawrence1, Tetyana Shandala1, Roberto Weigert2,

Lisa M Butler3, Doug A Brooks1

1Mechanisms in Cell Biology and Disease Research Group, School of Pharmacy and

Medical Sciences, Sansom Institute for Health Research, University of South Australia,

Adelaide, SA, Australia

2NIDCR, National Institutes of Health, Bethesda, MD, USA.

3Dame Roma Mitchell Cancer Research Laboratories and Adelaide Prostate Cancer

Research Centre, School of Medicine, University of Adelaide, Adelaide, SA, Australia

Address for correspondence:

Professor Doug A. Brooks,

Mechanisms in Cell Biology and Disease Research Group Leader,

School of Pharmacy and Medical Sciences,

Sansom Institute for Health Research,

University of South Australia,

GPO Box 2471, Adelaide SA, AUSTRALIA 5001

Phone: +61 8 83021229

Email: [email protected]

Keywords:

Prostate cancer, endosomes, biomarkers, diagnosis, prognosis

Running title:

Altered endosome biogenesis in prostate cancer

Disclosure statement:

The authors declare that they have no relevant financial interests.

Word count: 6167

Total figures: 7

on April 9, 2020. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 30, 2014; DOI: 10.1158/1541-7786.MCR-14-0074

http://mcr.aacrjournals.org/

2

Abstract

Prostate cancer is the second most common form of cancer in males, affecting one in

eight men by the time they reach the age of 70. Current diagnostic tests for prostate

cancer have significant problems with both false negatives and false positives,

necessitating the search for new molecular markers. A recent investigation of endosomal

and lysosomal proteins revealed that the critical process of endosomal biogenesis might

be altered in prostate cancer. Here, a panel of endosomal markers was evaluated in

prostate cancer and non-malignant cells and a significant increase in gene and protein

expression was found for early, but not late endosomal proteins. There was also a

differential distribution of early endosomes, and altered endosomal traffic and signalling of

the transferrin receptors (TFRC and TFR2) in prostate cancer cells. These findings support

the concept that endosome biogenesis and function is altered in prostate cancer.

Microarray analysis of a clinical cohort confirmed the altered endosomal gene expression

observed in cultured prostate cancer cells. Furthermore, in prostate cancer patient tissue

specimens, the early endosomal marker and adaptor protein APPL1 showed consistently

altered basement membrane histology in the vicinity of tumours and concentrated staining

within tumour masses. These novel observations on altered early endosome biogenesis

provide a new avenue for prostate cancer biomarker investigation and suggest new

methods for the early diagnosis and accurate prognosis of prostate cancer.

Implications

This discovery of altered endosome biogenesis in prostate cancer may lead to novel

biomarkers for more precise cancer detection and patient prognosis.




3

Introduction

Prostate cancer is the most common form of cancer in males from developed countries,

and the incidence of this disease is predicted to double globally by 2030 (WCRF prostate

cancer statistics; http://globocan.iarc.fr). Prostate cancer affects approximately one in eight

men globally by the time they reach the age of 70 (1). The prostate-specific antigen test is

currently used for prostate cancer screening, however, this assay suffers from a high

percentage of false-positive results (see for example: 2) and recently there have been

recommendations to abandon this procedure, particularly in older men (3). In addition, the

digital rectal examination, which manually checks the prostate for abnormalities, is limited

by the inability to assess the entire gland and to some degree the size of the tumour.

Understanding the cell biology of prostate cancer is important in order to develop new

biomarkers for the early diagnosis and accurate prognosis of prostate cancer.

There is mounting evidence for a central role of endosome-lysosome compartments in

cancer cell biology (see: 4-6). Endosomes and lysosomes are directly involved in the

critical processes of energy metabolism (7), cell division (8) and intracellular signalling

(see for example: 9) and would therefore have a direct role in cancer pathogenesis. The

endosome-lysosome system has a specific capacity to respond to environmental change,

acting as an indicator of cellular function and will consequently be altered in cancer (10).

Moreover, the endosome-lysosome system has a critical role in controlling the secretion of

proteins into extracellular fluids (see for example: 11), making it an ideal system to identify

new biomarkers that are released from cancer cells. Cumulative evidence from patient

data and cell lines suggested that the process of lysosomal biogenesis might be altered in

prostate cancer (see for example: 12, 13). However, we recently demonstrated that a

panel of lysosomal proteins were unable to effectively discriminate between a set of non-

malignant and prostate cancer cells (14). In contrast, the endosomal related proteins

cathepsin B and acid ceramidase displayed increased gene and protein expression in




4

prostate cancer cells and demonstrated some discriminatory capacity when compared to

non-malignant cells. Acid ceramidase was previously shown to be upregulated in prostate

cancer tissues and the over-expression of this enzyme has been implicated in advanced

and chemo-resistant prostate cancer (15). Importantly, we also showed that LIMP-2, a

critical regulator of endosome biogenesis (16), had increased gene and protein expression

in prostate cancer cells (14), leading us to postulate that endosome biogenesis is altered

in prostate cancer.

Endosome biogenesis involves the synthesis and organisation of structural elements of the

endosome system to form an integrated set of functional organelles that eventually interact

with lysosomes (see for example: 17). There are two main endosomal pathways: first, from

the biosynthetic compartments (endoplasmic reticulum and Golgi apparatus) via specific

vesicular traffic towards distal elements of the endosomal network, including early

endosomes, late endosomes and multivesicular bodies; and from the cell surface through

early endosomes to either recycling endosomes or towards late endosomes. In each case,

the formation and movement of these dynamic vesicular compartments is controlled by

specific targeting signals and trafficking machinery (see for example: 17, 18). This

vesicular machinery can be used to define individual compartments; including for example,

the small GTPase Rab5 on early endosomes and the small GTPase Rab7 on late

endosomes (18, 19). Here we have investigated the gene expression, amount of protein

and intracellular distribution of a panel of endosomal proteins in prostate cancer and non-

malignant cell lines, to determine if endosome biogenesis is altered in prostate cancer

cells and to identify potential new biomarkers.




5

Materials and Methods

Antibody reagents

A LIMP-2 sheep polyclonal antibody was generated against the peptide sequence

CKKLDDFVETGDIRTMVFP (Mimotopes Pty. Ltd., VIC, Australia). Rabbit polyclonal

antibodies (Abcam PLC, Cambridge United Kingdom) were against Appl1 (0.4 µg/mL),

Appl2 (0.4 µg/mL), Rab4 (1 µg/mL), TGN46 (10 µg/mL), TfR1 (1 µg/mL), TfR2 (1 µg/mL).

Akt (1/1000) and phospho-Akt (Thr308 1/1000) from Cell Signalling Technology Inc., MA,

USA, and HRP-conjugated anti-GAPDH (1/20000 Sigma Aldrich Pty. Ltd., NSW, Australia).

Goat polyclonal antibodies (Santa Cruz Biotechnology, CA, USA) were against Rab5

(1 µg/mL), Rab7 (1 µg/mL) and EEA1 (1 µg/mL). A LAMP-1 (1 µg/mL) mouse monoclonal

BB6 was provided by Professor Sven Carlsson (Umea University, Sweden). HRP-

conjugated secondary antibodies for Western blot analysis included anti-goat/sheep

(1/2000, Merck Millipore Pty. Ltd., VIC, Australia), anti-rabbit (1/2000) and anti-mouse

(1/2000) (Sigma Aldrich). The secondary and other antibody conjugated fluorophores that

were used included Alexa Fluor® 488 (1/250), Alexa Fluor® 633 (1/250), Transferrin-633

(1/1000), Phalloidin-488 (1/100), and LysoTracker® (5 µM); all from Life Technologies Pty.

Ltd., VIC, Australia.

Cell lines and culture conditions

The non-malignant cell lines PNT1a and PNT2 and prostate cancer cell lines 22RV1 and

LNCaP (clone FCG) were obtained from the European Collection of Cell Cultures via

CellBank Australia (Children’s Medical Research Institute, NSW, Australia). These cell

lines were absent from the list of cross-contaminated or misidentified cell lines, version 6.8

(9th March 2012) (20).

Cell lines were cultured in 75 cm2 tissue culture flasks and maintained in Roswell Park

Memorial Institute (RPMI) 1640 culture medium (Gibco®, Life Technologies),




6

supplemented with 10% foetal calf serum (In Vitro Technologies Pty. Ltd., VIC, Australia)

and 2 mM L-glutamine (Sigma Aldrich Pty. Ltd., NSW, Australia). Cells were incubated at

37oC with 5% CO2 in a Sanyo MCO-17AI humidified incubator (Sanyo Electric Biomedical

Co., Ltd., Osaka, Japan). Cells were cultured to approximately 90% confluence before

passage, by washing with sterile PBS (Sigma Aldrich), trypsin treatment (Trypsin-EDTA

solution containing 0.12% trypsin, 0.02% EDTA; SAFC®, Sigma Aldrich) to dissociate the

cells from the culture surface and then resuspension in supplemented culture medium.

Preparation of cell extracts and conditioned culture media for protein detection

The culture medium was aspirated from cultures at 80-90% confluence, the cells washed

once with PBS and then incubated with 800 µL of a 20 mM Tris (pH 7.0) containing

500 mM sodium chloride and 2% (w/v) SDS. Cells were harvested and an extract prepared

by heating to 95 oC and sonication for one minute. The lysate was then passaged six times

through a 25-guage needle. Total protein in the cell extracts was quantified using a

bicinchoninic acid assay according to the manufacturer’s instructions (Micro BCA kit,

Pierce, Rockford, IL, USA). Samples were quantified using a Wallac Victor™ optical plate-

reader and Workout software v2.0 (Perkin-Elmer Pty, Ltd., VIC, Australia), using a 5-point

parameter standard curve. Cell extracts were stored at -20oC.

Protein was recovered from conditioned culture media, collected at the time of cell

harvesting, using trichloroacetic acid precipitation. Briefly, cell debris was removed from

the culture media by centrifugation (1000 g for 10 minutes), sodium deoxycholate (Sigma

Aldrich) added to a final concentration of 0.02 % (v/v) and incubated on ice for 30 minutes.

Trichloroacetic acid (Sigma Aldrich) was then added to a final concentration of 15 % (v/v)

and incubated on ice for two hours. Protein was collected by centrifugation at 4 oC

(5,500 g for 30 minutes), washed twice with ice-cold acetone and resuspended in SDS-

sample buffer/PBS solution, and stored at -20 oC.




7

Gene expression

Relative amounts of mRNA from non-malignant and prostate cancer cell lines were defined

by quantitative PCR (qPCR). Briefly, cells were lysed with TRI reagent® (Applied

Biosystems®, Life Technologies) and RNA extraction performed using RNeasy® (Qiagen

Pty. Ltd., VIC, Australia) according to the manufacturer’s instructions. Two micrograms of

total RNA was reverse-transcribed using a High Capacity RNA-to-cDNA Kit (Life

Technologies) following the manufacturer’s instructions. qPCR was performed with 2 µL of

a 1:25 dilution of cDNA in 10 µL of reaction mixture; containing 5 µL Power SYBR® Green

PCR Master Mix (Life Technologies) and 0.5 µL of both 10 nM forward and reverse primer.

qPCR was performed using a 7500 Fast Real-Time PCR System (Life Technologies). Each

target was assessed in triplicate on a single plate and quantified relative to GAPDH

endogenous control for each plate, with triplicate biological replicates run independently.

Oligonucleotides (GeneWorks Pty. Ltd., Adelaide, SA, Australia) were as follows:

GAPDH TGCACCACCAACTGCTTAGC (Fwd) GGCATGGACTGTGGTCATGAG (Rev)

(21);

LAMP1 ACGTTACAGCGTCCAGCTCAT (Fwd) TCTTTGGAGCTCGCATTGG (Rev) (21);

LIMP2 AAAGCAGCCAAGAGGTTCC (Fwd) GTCTCCCGTTTCAACAAAGTC (Rev);

APPL1 ACTTGGGTACATGCAAGCTCA (Fwd) TCCCTGCGAACATTCTGAACG (Rev);

APPL2 AGC TGATCGCGCCTGGAACG (Fwd) GGGTTGGTACGCCTGCTCCCT (Rev);

EEA1 CCCAACTTGCTACTGAAATTGC (Fwd) TGTCAGACGTGTCACTTTTTGT (Rev);

RAB5 AGACCCAACGGGCCAAATAC (Fwd) GCCCCAATGGTACTCTCTTGAA (Rev);

RAB4 GGGGCTCTCCTCGTCTATGAT (Fwd) AGCGCATTGTAGGTTTCTCGG (Rev);

RAB7 GTGTTGCTGAAGGTTATCATCCT (Fwd) GCTCCTATTGTGGCTTTGTACTG (Rev).

Western blotting

Ten micrograms of total protein for whole cell lysates or the secreted protein from

approximately 3×106 cells, was heat-denatured (5 minutes at 100 oC in NuPAGE® LDS




8

Sample Buffer and reducing agent), then electrophoresed at 120 V for 1.5 hours using pre-

cast gels in an XCell SureLock Mini-Cell system (Life Technologies). The protein was then

transferred to polyvinylidene difluoride membranes (Polyscreen®, PerkinElmer, VIC,

Australia). The transfer membranes were blocked for 1 hour at room temperature using a

5% (w/v) skim milk solution in 0.1% (v/v) TBS-tween (blocking solution) and incubated with

primary antibody overnight at 4 oC. The membranes were washed in 0.1% (v/v) TBS-tween

and then incubated with the appropriate HRP-conjugated secondary antibody diluted

1/2000 in blocking solution. The membranes were developed using a Novex® ECL

chemiluminescent substrate reagent kit (Life Technologies), and proteins visualised using

an ImageQuant™ LAS 4000 imager, software version 1.2.0.101 (GE Healthcare Pty. Ltd.,

NSW, Australia). Triplicate samples were analysed and images quantified relative to a

reference GAPDH loading control using AlphaViewSA™ software v3.0 (ProteinSimple Pty.

Ltd., Santa Clara, CA, USA).

Immune fluorescence

Cells were cultured on 22 mm glass coverslips, fixed with 4% (v/v) formaldehyde in PBS

for 20 minutes at room temperature, then permeabilised with 0.1% Triton-X (v/v) in PBS for

10 minutes. Non-specific antibody reactivity was blocked by incubation with 5% (w/v)

bovine serum albumin in PBS for two hours at room temperature. Cells were incubated

with primary antibody in 5% BSA for two hours at room temperature, followed by

fluorophore-conjugated secondary antibody in the dark for one hour at room temperature.

Unbound antibody was removed by three PBS washes and coverslips mounted with

ProLong® Gold Antifade Reagent containing DAPI nuclear stain (Life Technologies).

Confocal microscopy was performed using a Zeiss LSM 710 META NLO laser scanning

microscope and associated Carl Zeiss Zen 2009 software. Laser lines of 370, 488, 543

and 633 nm were utilised for DAPI, Alexa Fluor® 488, Cy3 and Alexa Fluor® 633




9

fluorescence, respectively. Images were exported as greyscale 16-bit TIFF files and

processed using Adobe® Photoshop® CS5 (Adobe Systems Inc., San Jose, CA, USA).

Immunohistochemistry

Matched human non-malignant and tumour prostate tissue sections (3 µm) were mounted

on Superfrost Ultra Plus® slides (Menzel-Gläser GmbH, Braunschweig, Germany) and

heated overnight at 50 oC. Sections were then dewaxed in xylene, rehydrated in ethanol

and incubated in 0.3% H2O2 in PBS for 15 min at room temperature. HIER was carried out

using 10 mM citrate buffer (pH 6.5) in a Decloaking Chamber (Biocare Medical LLC,

Concord, CA, USA) for 5 min at 125 oC. Slides were blocked first using an Invitrogen

Avidin/Biotin Kit (as per manufacturer’s instructions) and then in 5% blocking serum

(Sigma Aldrich) for 30 min at room temperature in a humid chamber. Sections were then

incubated with primary antibody overnight at 4 oC in a humid chamber, followed by

incubation with the appropriate biotinylated secondary antibody (1/400; Dako Australia Pty.

Ltd., NSW, Australia) for one hour at room temperature in a humid chamber, then

streptavidin-horseradish peroxidise (1/500; Dako Australia Pty. Ltd.) for one hour at room

temperature in a humid chamber and finally with DAB/H2O2. The tissue sections were then

counterstained with Lillie-Mayer’s haemotoxylin, rinsed in water, rehydrated and mounted

on slides with DPX mounting media (Merck Millipore Pty. Ltd., VIC, Australia). Images

were obtained by scanning slides using a NanoZoomer (Hamamatsu Photonics K.K.,

Hamamatsu City, Shizuoka Pref., Japan).

Data analysis

Quantities of target-gene and endogenous-control (GAPDH) were calculated from a

standard curve from serial dilutions of control material (LNCaP cDNA). Kruskal-Wallis non-

parametric analysis of variance statistical analyses were performed using Stata/SE v11.2

(StataCorp LP, Texas, USA) to determine the significance between non-malignant control




10

(PNT1a and PNT2) and prostate cancer (22RV1 and LNCaP) cell lines (95% confidence

limit; P ≤ 0.05) for intracellular or secreted protein amount, and gene expression. The

Taylor microarray cohort (GSE21034) consisted of patients treated by radical

prostatectomy at the Memorial Sloan-Kettering Cancer Center (MSKCC) (22), profiling 150

prostate cancer and 29 non-malignant tissue samples which was performed using

Affymetrix Human Exon 1.0 ST arrays. Statistical analysis of microarray gene expression

was performed using a two-tailed unpaired t-test with Welch’s correction using GraphPad

Prism 5.03 (GraphPad Software Inc., CA, USA).




11

Results

Increased endosome related gene and protein expression in prostate cancer cells.

The expression of endosome and lysosome related genes was quantified by qPCR in

control and prostate cancer cells and normalised to the expression of GAPDH mRNA. The

amounts of LIMP2, APPL1, APPL2, RAB5A, EEA1 and RAB4 mRNA were significantly

increased in prostate cancer when compared to non-malignant control cell lines (P ≤ 0.05;

Figure 1). In each case there was an approximately 2-3 fold increase in mRNA expression.

There was no significant difference in the amount of either RAB7 or LAMP1 mRNA

detected in prostate cancer cells compared to non-malignant controls. Western analysis

(Figure 2A) demonstrated significant increases in the amount of LIMP-2, Appl1, Appl2,

EEA1, and Rab4 protein in extracts from prostate cancer cells when compared to non-

malignant control cells (P ≤ 0.05; Figure 2B). Moreover, for both LIMP-2 and Rab4 the

increase was approximately 2-4 fold for prostate cancer when compared to non-malignant

cells (Figure 2B). There was no significant difference in the amount of Rab5, Rab7 and

LAMP-1 protein detected in non-malignant compared to prostate cancer cells (Figure 2B).

Altered distribution of endosomes and lysosomes in prostate cancer cells.

Representative confocal images for the distribution of endosomes and lysosome proteins

(Figure 3), show evidence of increased staining and altered distribution in prostate cancer

compared to the non-malignant controls. In non-malignant control cells LIMP-2 was

concentrated in the perinuclear region, with some punctuate vesicular staining in the

remainder of the cytoplasm. In contrast, prostate cancer cells displayed relatively smaller

LIMP-2 compartments, which had an even distribution throughout the cytoplasm. Appl1

positive endosomes were detected throughout the cell cytoplasm of non-malignant control

cells, whereas in prostate cancer cells these compartments were more concentrated at the

cell periphery, particularly near the plasma membrane in cellular extensions/pseudopodia.

In non-malignant control cells both Rab5 and its effector EEA1 were concentrated in the




12

perinuclear region, while in prostate cancer cells these endosomal compartments were

found throughout the cytoplasm, with some compartments located towards the cell

periphery in cellular extensions. Rab7 positive endosomes were located mainly in the

perinuclear region of both non-malignant control and prostate cancer cells. In non-

malignant control cells, LAMP-1 compartments were concentrated in the perinuclear

region, whereas in prostate cancer cells the LAMP-1 compartments were distributed away

from the perinuclear region and concentrated in cellular extensions. Consistent with the

LAMP-1 staining, LysoTracker™ positive acidic compartments were concentrated mainly

in the perinuclear region of non-malignant control cells, whereas in prostate cancer cells

these compartments were detected in both the perinuclear region and in cytoplasmic

extensions (Figure 3).

Altered distribution of endocytosed transferrin in prostate cancer cells.

Previous studies have reported increased uptake of transferrin in prostate cancer cells,

prompting the investigation of receptor expression and transferrin endocytosis in relation to

the observed increase in endosome protein expression and altered endosome distribution.

In non-malignant control cells, endocytosed transferrin was observed in punctate

intracellular structures after five minutes and in the perinuclear region at 15 and 30

minutes (Figure 4). The prostate cancer cells endocytosed relatively more transferrin than

the non-malignant control cell lines within the first five minutes of incubation and at the

thirty minute incubation point. In non-malignant cells at 30 minutes (Figure 4) and 20

minutes (Figure 5) this transferrin was tightly concentrated in close proximity to the

nucleus. After 15 minutes of incubation, the internalised transferrin was not as

concentrated in the perinuclear region of prostate cancer cells, with more transferrin-

labelled compartments in the cell periphery and distributed throughout the cytoplasm when

compared to the non-malignant cells (Figure 4). There was also a marked reduction in

actin staining for the prostate cancer compared to the non-malignant control cell lines




13

(Figure 4). In the non-malignant control cells, transferrin was clustered mainly in LIMP-2

and Rab7-positive endosomes localised in the perinuclear region (Figure 5). While the

prostate cancer cells had some LIMP-2 and transferrin positive staining in the perinuclear

region and some co-localisation of transferrin with the Golgi marker TGN46 (yellow

colocalisation), the majority of transferrin was localised in different endosomal

compartments (i.e. Appl1, Rab5, EEA1) distributed throughout the cytoplasm and in

cellular extensions (Figure 5). The Rab4 recycling endosomes and LAMP-1 positive

lysosomes had similar patterns of transferrin staining for the prostate cancer and non-

malignant control cell lines (Figure 5). Further analysis of the transferrin receptors revealed

variable gene and protein expression for TfR1 (TFRC) and TfR2 (TFR2) (Figure 6A & B).

There was a significant increase in TFRC gene expression (P ≤ 0.05) in prostate cancer

cells when compared to non-malignant controls (Figure 6A), but only a qualitative increase

in TfR1 protein in the prostate cancer cell line 22RV1 and not for LNCaP (Figure 6B).

While there was significantly more TfR2 protein detected in prostate cancer cells when

compared to the non-malignant cells (P ≤ 0.05), there was only an increase in TFR2 gene

expression in the LNCaP cancer cell line (Figure 6A). Co-localisation of TfR1 and

transferrin was observed in all cell lines, and was in a perinuclear location in non-

malignant cell lines PNT1a and PNT2 compared to a broader cytoplasmic distribution in

the cancer cell lines 22RV1 and LNCaP. Conversely, there appeared to be no co-

localisation of transferrin with TfR2 in non-malignant cells and limited co-localisation of

transferrin with TfR2- compartments in the prostate cancer cells.

Altered Akt signalling in prostate cancer cells.

The total amount of Akt protein detected in non-malignant control cells was similar to that

detected in prostate cancer cells (Figure 6D & E). There were, however, differences in the

amount of phosphorylated Akt in the prostate cancer lines, with 22RV1 showing a marked

reduction in the amount of phosphorylated Akt whereas LNCaP had an increased amount




14

of phosphorylated Akt (Figure 6D), a phenomenon previously observed by Shukla et al.

and related to mutations of PTEN in LNCaP (23). More importantly, following the addition

of transferrin, there was a significant increase in the amount of phosphorylated Akt in the

non-malignant control cell lines, but no change in the amount of phosphorylated Akt in

either of the cancer cells (Figure 6E).

LAMP1and APPL1 mRNA expression in a prostate cancer microarray cohort and

distribution of LAMP-1 and Appl1 in prostate tissue

To support the hypothesis of altered endosome biogenesis in prostate cancer, the

percentage change of mRNA expression for LAMP1 and APPL1 was analysed from the

Taylor microarray cohort (Figure 7A). LAMP1 gene expression was significantly decreased

(P ≤ 0.01) in prostate cancer tissue compared with non-malignant prostate tissue. APPL1

gene expression was significantly increased (P ≤ 0.05) in prostate cancer tissue compared

to non-malignant tissue. Immunohistochemistry was used to investigate the distribution of

LAMP-1 and Appl1 in prostate cancer patient tissue samples (Figure 7B). The lysosomal

marker LAMP-1 showed tumour specific staining in some patient samples, but consistent

with previous studies there were variable results with some patient samples having little or

no LAMP-1 staining (data not shown for the latter). In non-malignant tissue Appl1 clearly

delineated basement membranes, whereas in the malignant tissue there was no evidence

of basement membrane staining (Figure 7B). In addition, Appl1 specifically delineated the

cancer margins and showed increased staining within the tumour mass (Figure 7B).




15

Discussion

Prostate cancer is one of the most frequently diagnosed cancers in men and a leading

cause of cancer related deaths world-wide, particularly in the United States and

Australasian populations (24, 25). The prostate specific antigen is still commonly used to

detect prostate cancer, but has significant problems in terms of miss-diagnosis and

prognostic prediction (see for example: 26). Some promising adjunct tests have recently

been developed including prostate cancer antigen 3 (PCA3) (27), the analysis of

cholesterol sulphate (28) and a novel sequence of the gene protein kinase C-zeta

(PRKCZ), which is translated to the protein PRKC-ζ-PrC (29). However, these biomarkers

do not provide early and accurate detection of prostate cancer, which is needed to enable

the selection of the most appropriate therapeutic intervention and to avoid potential

overtreatment (2). Based on our observations of altered LIMP-2 expression (14), we

investigated altered endosomal biogenesis in prostate cancer to help provide more

sensitive and specific markers for early detection and disease prediction.

There have been extensive protein and proteomic studies undertaken to identify potential

new prostate cancer biomarkers (see for example: 26), however, the ideal marker with

appropriate sensitivity and specificity is yet to be established. Interestingly, many of the

early biomarkers investigated, and some of the recent proteins identified in proteomic

studies, are either lysosomal hydrolases (e.g. lysosomal cathepsins, acid ceramidase and

acid phosphatase), lysosomal membrane proteins (e.g. LAMP 1-3 also called CD107a, b

and CD63) or proteins that are delivered from the cell surface into the endosome-

lysosome system (e.g. sialomucin/CD164, CD1, CD47, CD75). Additional evidence

supports the concept that endosomal-lysosomal biogenesis is altered in prostate cancer,

including the altered distribution of lysosomes that has been reported in prostate cancer

cells (30). Despite these indications on lysosomal biogenesis, a set of optimal prostate

cancer biomarkers have yet to be defined. In a recent study of endosome and lysosome




16

markers in prostate cancer cell lines we also found that lysosomal markers were unable to

discriminate prostate cancer from non-malignant cell lines, but there was evidence

suggesting that endosome biogenesis may be altered in prostate cancer cells (14).

Here we observed altered distribution of specific endosome subsets and lysosomes into

the cellular periphery of prostate cancer cells, which could have important implications for

cancer cell biomarker release and intracellular signalling. Acidic extracellular pH has been

shown to enhance organelle re-distribution, stimulating the traffic of endosome-lysosome

related organelles to the periphery of cancer cells (10, 31). This altered endosome-

lysosome traffic has been linked with the release of cathepsin B and tumour invasiveness

(32), presumably due to the hydrolysis of extracellular matrix after the exocytosis of this

enzyme (33). However, cathepsin B has been reported to be more enriched in endosomes

(34) rather than lysosomes, whereas the reverse is true for another proposed prostate

cancer biomarker cathepsin D (35). The movement of lysosomal related vesicles to the

periphery of prostate cancer cells has been shown to be dependent on GTPases (e.g.

RhoA), microtubules, the molecular motor protein KIF5b, and to involve PI3K, Akt/Erk1/2

phosphorylation and MAPK signalling (32). Moreover, a component of the MAPK signalling

pathway, the endosome-localised MAPK/Erk Kinase (MEK1) p14-MP1 scaffolding

complex, has been shown to specifically interact with and regulate the distribution of

endosomes via ERK signalling (36). Increases in Na+/H+ exchange activity (acidification),

RhoA GTPase activity and PI3K activation have been shown to result in exocytosis from

prostate cancer cells (31). The increased endosomal associated gene and protein

expression observed here, together with the previously observed cathepsin B release,

suggested that endosome related proteins may provide an important new focus for

prostate cancer disease biomarker studies.




17

Increased expression of the endosomal protein LIMP-2 has been shown in oral squamous

cell carcinoma and was associated with tumour metastasis (37). LIMP-2 has been

reported to have a role in endosome biogenesis and its overexpression evoked the

enlargement of both early and late endosomes (16). We observed increased gene and

protein expression of the endosomal protein LIMP-2 in prostate cancer cell lines (14),

prompting us to investigate other endosomal proteins in prostate cancer cells. The early

endosome associated proteins Appl1, Appl2, EEA1 and recycling endosome protein Rab4

were significantly upregulated (gene and protein) in prostate cancer cells, supporting the

hypothesis of altered endosome biogenesis in prostate cancer. APPL1 expression was

significantly increased in the Taylor prostate cancer tissue microarray, supporting the

expression profiles observed in cell lines. Furthermore, the EEA1 and Appl1 endosome

sub-populations each displayed altered intracellular distribution consistent with altered

endosome traffic and potentially function. Interestingly, whilst Rab7 expression was

unaltered, Rab7-positive compartments displayed differential distribution in prostate

cancer compared to non-malignant cells. Changes in subcellular localisation may affect

signalling in a similar manner to that which transpires through downregulated gene/protein

expression that affects prostate cancer progression through enhanced signalling (38).

Thus, the analysis of compartment distribution may distinguish cancer cell phenotypes

independently of altered gene and protein expression.

The significant changes that we observed in endosome associated gene and protein

expression, together with the altered distribution of endosome populations prompted us to

investigate transferrin receptor expression together with transferrin endocytosis, sorting

and Akt signalling as measures of endosome function. Significant increases in the amount

of transferrin receptor have previously been reported in prostate cancer cells (39), and this

has been linked to c-Myc activation, which alters proliferation and tumourigenesis (40). Akt

signalling is also essential for regulating cell growth and survival; and this controls the cell




18

surface expression of transferrin and growth factor receptors (41). The transferrin receptor

has previously been observed to co-localise with Rab5 and the motor protein myosin VI;

the latter of which is involved in retrograde transport to the plasma membrane (42). This

was consistent with our observations of endosome populations co-staining with labelled

transferrin in the cellular periphery of prostate cancer cells. There also appeared to be a

deregulation of Akt signalling in prostate cancer cells, with control cells being responsive to

transferrin endocytosis, but prostate cancer cells being unresponsive, despite having

variable high or low amounts of Phospho-Akt/Akt. This altered signalling may be related to

the intracellular location of the transferrin receptor that can be disturbed through changes

in localisation or depletion of PtdIns3P (43) or affected through variable internalisation

resulting from altered Appl1 or Rab5 expression (as is the case with epidermal growth

factor receptor (44)), affecting receptor trafficking and signal modulation.

Appl1 has been shown to be directly involved in insulin signalling and the translocation of

the glucose transporter GLUT-4, which is mediated by direct binding of Appl1 to PI3K and

Akt (45), inducing endosome re-localisation. In prostate cancer cells, Appl1 potentiated Akt

activity has also been shown to suppress androgen receptor transactivation (46). The

increased gene and protein expression of Appl1 that we observed in prostate cancer cells

might be expected to cause increased glucose uptake, due to its effect on GLUT-4 and this

could have implications for energy metabolism in these cancer cells. Indeed, Appl1 also

regulates other aspects of both lipid and glucose metabolism, activating AMP-activated

kinase, p38 MAP kinase (MAPK) and PPARα (see for example: 45). Appl2 has been

shown to function as a negative regulator of adiponectin signalling, by competitive binding

with Appl1 for interaction with the adiponectin receptor, again regulating energy

metabolism. The increased expression of both Appl1 and Appl2 could therefore impact

heavily on prostate cancer cell metabolism with direct significance for increased energy

utilisation and prostate cancer cell survival. The altered Appl1 expression and effect on Akt




19

signalling in prostate cancer cells would be expected to also have significant consequence

for other aspects of prostate cancer biology, due to the importance of the Appl1/PI3K/Akt

signalling pathway in leading cell adhesion and cell migration (47). Notably, Appl1 also

acts as a mediator of other signalling pathways, by interaction with the cytosolic face of

integral or membrane associated proteins either at the cell surface or in the endosome

pathway; where it is directly involved in endosome traffic.

Rab GTPases are integrally involved in the control of endosome traffic, cycling between

the cytoplasmic GDP bound state and the active membrane associated GTP bound state.

Rab5 and Rab7 respectively define early and late endosome compartments and during

endosome maturation Rab5 recruits the HOPS complex as a mechanism to activate and

be replaced by Rab7. While mVps39 is known to be a guanine nucleotide exchange factor

(GEF) that promotes the GTP bound state on endosomal Rabs, TBC-2/TBC1D2 is a Rab

GTPase activating protein (GAP) that promotes the GDP bound state; and in combination

is used to regulate the membrane localisation of Rab proteins. TBC-2/TBC1D2 is therefore

thought to act as a regulator of endosome to lysosome traffic and is required to maintain

the correct size and distribution of endosomes (48). The altered distribution of endosome

populations that we observed in prostate cancer cells suggests that TBC-2/TBC1D2 (GAP)

and or mVps39 (GEF) might be functionally impaired; particularly as the early endosomes

were routed mainly toward the cell periphery, whereas late endosomes remained in a

perinuclear location. Interestingly, microarray analysis has detected increased expression

of TBC-2/TBC1D2 and reduced Vps39 mRNA in relation to altered endosomal-lysosomal

traffic (49). This altered GEF and GAP function has been shown to be critical for

endosomal traffic of integrins and there have been direct links established between altered

Rab GTPase activity and cancer progression (50).




20

The expression of endosome markers has not previously been investigated thoroughly in

prostate cancer, although some lysosomal related cell surface CD (cell differentiation)

markers and LAMP-1/LAMP-2 have been utilised in tissue biopsy analysis. The Gleason

grading system is used to define histological differentiation in conjunction with marker

analysis to predict the course of disease in prostate cancer patients. The lysosomal

membrane proteins LAMP 1-3 and CD markers CD164, CD1, CD47 and CD75 are often

evident in primary and metastatic cancer biopsies (51), but their consistency and predictive

capacity for disease progression is limited. We observed increased amounts of Appl1

protein in malignant tissue from biopsies of prostate cancer patients, confirming the

increased gene and protein expression of Appl1 in prostate cancer cell lines. Appl1

appeared more concentrated in the basement membranes in non-malignant tissue,

whereas in the malignant tissue there was no basement membrane staining, indicating

diagnostic/prognostic potential for this biomarker. Further immunohistochemical and

patient tissue analysis of Appl1 and other endosomal proteins is required to establish the

validity and predictive value of these proteins as prognostic biomarkers in prostate cancer.

In summary, we have demonstrated increased expression of early endosome markers and

altered localisation of endosome and lysosome compartments in prostate cancer cells,

which was associated with altered endocytosis and recycling of the transferrin receptor

and aberrant Akt signalling. The alterations to the endocytic machinery that we have

observed here, may increase the amount of endocytosis in prostate cancer cells, which

could increase nutrient uptake/availability, provide additional membrane for cell division (9)

and alter intracellular signalling (10); which are all hallmarks of cancer cell biology. There

appeared to be a specific disconnect between the cellular location of early endosomes

(and lysosomes) in the cell periphery and late endosomes in the perinuclear region, which

could impact on degradative and signalling processes in prostate cancer cells. We

concluded that endosome biogenesis and function is altered in prostate cancer cells,




21

opening a potentially new avenue to investigate biomarkers that aid in the diagnosis and

prognosis of prostate cancer. Endosomes are directly involved in the processes of cellular

secretion and exosome release, making these newly identified endosomal proteins

potentially available for detection in patient samples, such as blood and urine.

Acknowledgements

This project was funded by a University of South Australia Presidents Scholarship and a

University of South Australia Postgraduate Award, together with additional support from

University of South Australia Research SA Seeding Funds. We thank Dr Shalini Jindal and

Ms Marie Pickering (Dame Roma Mitchell Cancer Research Laboratories, University of

Adelaide, South Australia) for expert assistance with the immunohistochemistry and

pathology of human prostate tissue samples.




22

References

1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA: a cancer journal for clinicians. 2013;63:11-30. 2. Schroder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, Nelen V, et al. Screening and prostate-cancer mortality in a randomized European study. The New England journal of medicine. 2009;360:1320-8. 3. Moyer VA. Screening for Prostate Cancer: U.S. Preventive Services Task Force Recommendation Statement. Ann Intern Med. 2012;157:120-34. 4. Parachoniak CA, Park M. Dynamics of receptor trafficking in tumorigenicity. Trends in cell biology. 2012;22:231-40. 5. Hurley JH, Odorizzi G. Get on the exosome bus with ALIX. Nature cell biology. 2012;14:654-5. 6. Hu CT, Wu JR, Wu WS. The role of endosomal signaling triggered by metastatic growth factors in tumor progression. Cellular signalling. 2013;25:1539-45. 7. Settembre C, Fraldi A, Medina DL, Ballabio A. Signals from the lysosome: a control centre for cellular clearance and energy metabolism. Nature reviews Molecular cell biology. 2013;14:283-96. 8. Boucrot E, Kirchhausen T. Endosomal recycling controls plasma membrane area during mitosis. Proceedings of the National Academy of Sciences of the United States of America. 2007;104:7939-44. 9. Palfy M, Remenyi A, Korcsmaros T. Endosomal crosstalk: meeting points for signaling pathways. Trends in cell biology. 2012;22:447-56. 10. Glunde K, Guggino SE, Solaiyappan M, Pathak AP, Ichikawa Y, Bhujwalla ZM. Extracellular acidification alters lysosomal trafficking in human breast cancer cells. Neoplasia. 2003;5:533-45. 11. Stow JL, Murray RZ. Intracellular trafficking and secretion of inflammatory cytokines. Cytokine & growth factor reviews. 2013;24:227-39. 12. Henneberry MO, Engel G, Grayhack JT. Acid phosphatase. Urol Clin North Am. 1979;6:629-41. 13. Quintero IB, Araujo CL, Pulkka AE, Wirkkala RS, Herrala AM, Eskelinen EL, et al. Prostatic acid phosphatase is not a prostate specific target. Cancer Res. 2007;67:6549-54. 14. Johnson IR, Parkinson-Lawrence EJ, Butler LM, Brooks DA. Prostate cell lines as models for biomarker discovery: Performance of current markers and the search for new biomarkers. The Prostate. 2014;74:547-60. 15. Camacho L, Meca-Cortes O, Abad JL, Garcia S, Rubio N, Diaz A, et al. Acid ceramidase as a therapeutic target in metastatic prostate cancer. Journal of lipid research. 2013;54:1207-20. 16. Kuronita T, Eskelinen EL, Fujita H, Saftig P, Himeno M, Tanaka Y. A role for the lysosomal membrane protein LGP85 in the biogenesis and maintenance of endosomal and lysosomal morphology. J Cell Sci. 2002;115:4117-31. 17. Huotari J, Helenius A. Endosome maturation. The EMBO journal. 2011;30:3481-500. 18. Zerial M, McBride H. Rab proteins as membrane organizers. Nature reviews Molecular cell biology. 2001;2:107-17. 19. Jordens I, Marsman M, Kuijl C, Neefjes J. Rab proteins, connecting transport and vesicle fusion. Traffic. 2005;6:1070-7. 20. Capes-Davis A, Theodosopoulos G, Atkin I, Drexler HG, Kohara A, MacLeod RA, et al. Check your cultures! A list of cross-contaminated or misidentified cell lines. International journal of cancer Journal international du cancer. 2010;127:1-8. 21. Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino VA, et al. A gene network regulating lysosomal biogenesis and function. Science. 2009;325:473-7. 22. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010;18:11-22. 23. Shukla S, Maclennan GT, Hartman DJ, Fu P, Resnick MI, Gupta S. Activation of PI3K-Akt signaling pathway promotes prostate cancer cell invasion. International journal of cancer Journal international du cancer. 2007;121:1424-32. 24. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin. 2005;55:74-108. 25. AIHW. AIHW (Australian Institute of Health and Welfare) 2010. Cancer in Australia 2010: an overview. Cancer series no. 60. Cat. no. CAN 56. Canberra: AIHW.2010.




23

26. Roobol MJ, Haese A, Bjartell A. Tumour markers in prostate cancer III: biomarkers in urine. Acta Oncol. 2011;50 Suppl 1:85-9. 27. Ploussard G, de la Taille A. Urine biomarkers in prostate cancer. Nat Rev Urol. 2010;7:101-9. 28. Eberlin LS, Dill AL, Costa AB, Ifa DR, Cheng L, Masterson T, et al. Cholesterol sulfate imaging in human prostate cancer tissue by desorption electrospray ionization mass spectrometry. Analytical chemistry. 2010;82:3430-4. 29. Yao S, Ireland SJ, Bee A, Beesley C, Forootan SS, Dodson A, et al. Splice variant PRKC-zeta(-PrC) is a novel biomarker of human prostate cancer. British journal of cancer. 2012;107:388-99. 30. Sloane BF, Moin K, Sameni M, Tait LR, Rozhin J, Ziegler G. Membrane association of cathepsin B can be induced by transfection of human breast epithelial cells with c-Ha-ras oncogene. J Cell Sci. 1994;107:373-84. 31. Steffan JJ, Snider JL, Skalli O, Welbourne T, Cardelli JA. Na+/H+ Exchangers and RhoA Regulate Acidic Extracellular pH-Induced Lysosome Trafficking in Prostate Cancer Cells. Traffic. 2009;10:737-53. 32. Steffan JJ, Cardelli JA. Thiazolidinediones induce Rab7-RILP-MAPK-dependent juxtanuclear lysosome aggregation and reduce tumor cell invasion. Traffic. 2010;11:274-86. 33. Roshy S, Sloane BF, Moin K. Pericellular cathepsin B and malignant progression. Cancer and Metastasis Reviews. 2003;22:271-86. 34. Authier F, Kouach M, Briand G. Endosomal proteolysis of insulin-like growth factor-I at its C-terminal D-domain by cathepsin B. FEBS letters. 2005;579:4309-16. 35. Zaidi N, Maurer A, Nieke S, Kalbacher H. Cathepsin D: A cellular roadmap. Biochemical and Biophysical Research Communications. 2008;376:5-9. 36. Deacon SW, Nascimento A, Serpinskaya AS, Gelfand VI. Regulation of bidirectional melanosome transport by organelle bound MAP kinase. Current biology : CB. 2005;15:459-63. 37. Pasini FS, Maistro S, Snitcovsky I, Barbeta LP, Rotea Mangone FR, Lehn CN, et al. Four-gene expression model predictive of lymph node metastases in oral squamous cell carcinoma. Acta Oncol. 2012;51:77-85. 38. Steffan JJ, Dykes SS, Coleman DT, Adams LK, Rogers D, Carroll JL, et al. Supporting a role for the GTPase Rab7 in prostate cancer progression. PloS one. 2014;9:e87882. 39. Keer HN, Kozlowski JM, Tsai YC, Lee C, McEwan RN, Grayhack JT. Elevated transferrin receptor content in human prostate cancer cell lines assessed in vitro and in vivo. The Journal of Urology. 1990;143:381-5. 40. O'Donnell KA, Yu D, Zeller KI, Kim JW, Racke F, Thomas-Tikhonenko A, et al. Activation of transferrin receptor 1 by c-Myc enhances cellular proliferation and tumorigenesis. Mol Cell Biol. 2006;26:2373-86. 41. Edinger AL, Thompson CB. Akt maintains cell size and survival by increasing mTOR-dependent nutrient uptake. Molecular biology of the cell. 2002;13:2276-88. 42. Puri C, Chibalina MV, Arden SD, Kruppa AJ, Kendrick-Jones J, Buss F. Overexpression of myosin VI in prostate cancer cells enhances PSA and VEGF secretion, but has no effect on endocytosis. Oncogene. 2010;29:188-200. 43. Fili N, Calleja V, Woscholski R, Parker PJ, Larijani B. Compartmental signal modulation: Endosomal phosphatidylinositol 3-phosphate controls endosome morphology and selective cargo sorting. Proceedings of the National Academy of Sciences of the United States of America. 2006;103:15473-8. 44. Lee JR, Hahn HS, Kim YH, Nguyen HH, Yang JM, Kang JS, et al. Adaptor protein containing PH domain, PTB domain and leucine zipper (APPL1) regulates the protein level of EGFR by modulating its trafficking. Biochemical and biophysical research communications. 2011;415:206-11. 45. Wang C, Xin X, Xiang R, Ramos FJ, Liu M, Lee HJ, et al. Yin-Yang regulation of adiponectin signaling by APPL isoforms in muscle cells. The Journal of biological chemistry. 2009;284:31608-15. 46. Yang L, Lin HK, Altuwaijri S, Xie S, Wang L, Chang C. APPL suppresses androgen receptor transactivation via potentiating Akt activity. The Journal of biological chemistry. 2003;278:16820-7. 47. Broussard JA, Lin WH, Majumdar D, Anderson B, Eason B, Brown CM, et al. The endosomal adaptor protein APPL1 impairs the turnover of leading edge adhesions to regulate cell migration. Molecular biology of the cell. 2012;23:1486-99.




24

48. Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. TBC-2 regulates RAB-5/RAB-7-mediated endosomal trafficking in Caenorhabditis elegans. Molecular biology of the cell. 2010;21:2285-96. 49. Peralta ER, Martin BC, Edinger AL. Differential effects of TBC1D15 and mammalian Vps39 on Rab7 activation state, lysosomal morphology, and growth factor dependence. The Journal of biological chemistry. 2010;285:16814-21. 50. Subramani D, Alahari SK. Integrin-mediated function of Rab GTPases in cancer progression. Mol Cancer. 2010;9:312. 51. Liu AY, Roudier MP, True LD. Heterogeneity in primary and metastatic prostate cancer as defined by cell surface CD profile. The American journal of pathology. 2004;165:1543-56.

Figure Legends

Figure 1. Quantification of endosomal and lysosomal gene expression in control

and prostate cancer cell lines.

Levels of mRNA transcripts in non-malignant control cell lines (white bars) and prostate

cancer cell lines (black bars) were evaluated by qPCR in triplicate experiments. Data was

expressed relative to GAPDH endogenous control and analysed by Kruskal-Wallis rank

sum method. Statistical significance (P ≤ 0.05) is represented by an asterisk.

Figure 2. Detection and quantification of intracellular lysosomal proteins in non-

malignant control and prostate cancer cell lines.

(A) Representative images from western blot analysis of 10 µg whole cell lysate from non-

malignant control cell lines PNT1a and PNT2, and cancer cell lines 22RV1 and LNCaP,

examined in triplicate. (B) Protein amount was quantified by densitometry relative to a

GAPDH endogenous control. Data was analysed by Kruskal-Wallis rank sum method with

statistical significance (P ≤ 0.05) represented by an asterisk.

Figure 3. Confocal micrographs of endosomal markers in prostate cancer cell lines

compared to non-malignant control cell lines.

Fixed cells were probed for endosome markers (green) and counterstained with DAPI

nuclear stain (blue) and visualised by laser-scanning confocal microscopy. Cell outlines

were visualised by transmitted light illumination and cell periphery depicted by white dotted

line. Antibody labelling was performed in triplicate experiments and a minimum of five




25

cells were visualised in each cell line for each assay. Similar fluorescence staining was

observed in all cells for each cell line/antibody label. An additional confocal micrograph

from an independent labelling assay is presented in Supplementary Figure 1.

Figure 4. Time-course of transferrin uptake in prostate cell lines.

Representative confocal micrographs from triplicate staining experiments showing

increased uptake and altered distribution of transferrin in prostate cancer cell lines

compared to non-malignant control cell lines. Cell cultures were incubated with transferrin

Alexa Fluor® 633 conjugate (red) for a period of 5, 15 and 30 minutes prior to cell fixation

and F-actin labelled with phalloidin Alexa Fluor® 488 (green). Arrows in the control cells

depict transferrin that was concentrated in close proximity to the nucleus at 30 minutes.

Additional confocal micrographs of transferrin uptake are presented in Supplementary

Figure 2.

Figure 5. Transferrin and endosome/lysosome marker co-fluorescence.

Confocal micrographs and enlargements showing transferrin (red; endocytosed for 20

minutes) and endosome/lysosome marker (green) in non-malignant control cell lines

PNT1a and PNT2, and prostate cancer cell lines 22RV1 and LNCaP. Co-localisation of

markers is depicted by yellow fluorescence.

Figure 6. Analysis of transferrin receptor expression and localisation with

transferrin.

(A) Quantification of transferrin receptor 1 (TFRC) and transferrin receptor 2 (TFR2) gene

expression in non-malignant and prostate cancer cell lines. (B) Western blot analysis and

protein quantification of transferrin receptor 1 (TfR1) and transferrin receptor 2 (TfR2).

Quantification of gene and protein expression was relative to GAPDH gene and protein,

respectively. (C) Confocal micrographs and enlargements showing transferrin (red) and

transferrin receptor (green) in non-malignant cell lines PNT1a and PNT2, and prostate

cancer cell lines 22RV1 and LNCaP. Colocalisation of transferrin receptor and transferrin is




26

represented by yellow fluorescence. (D) Western blot analysis and quantification (E) of

AKT phosphorylation relative to total AKT, prior and subsequent to treatment of non-

malignant (PNT1a and PNT2) and prostate cancer cells (22RV1 and LNCaP) with

transferrin for 20 minutes. Asterisk represents (P ≤ 0.05).

Figure 7. Analysis of gene expression and protein distribution in prostate cancer

compared to non-malignant tissue.

(A) Box-and-whisker graphs showing percentage change of LAMP1 and APPL1 mRNA

expression in normal (n = 29) and prostate cancer tissue (n = 150) from metanalysis of the

cohort by Taylor et al. (22). Box-and-whisker graphs were plotted with Tukey outliers (black

points). Statistical significance is represented by an asterisk (P ≤ 0.05).

(B) LAMP-1 (a, b) and Appl1 (d, e) expression in matched human normal (a, d) and

malignant (b; Gleason grade 3+3, e; Gleason grade 3+4) prostate tissue. Both normal and

malignant mixed-tissue is stained for LAMP-1 (c; Gleason grade 3+3) and Appl1 (f;

Gleason grade 3+4). The arrows in d & f show Appl1 staining the basement membrane in

non-malignant prostate tissue. Scale bar represents 100 µM in a, b & d and 200 µM in c, e

& f.




Published OnlineFirst July 30, 2014.Mol Cancer Res Ian R D Johnson, Emma J Parkinson-Lawrence, Tetyana Shandala, et al. Biomarker PotentialAltered Endosome Biogenesis in Prostate Cancer has

Updated version

10.1158/1541-7786.MCR-14-0074doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2014/07/31/1541-7786.MCR-14-0074.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2014/07/30/1541-7786.MCR-14-0074To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0074

http://mcr.aacrjournals.org/content/suppl/2014/07/31/1541-7786.MCR-14-0074.DC1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2014/07/30/1541-7786.MCR-14-0074


Altered Endosome Biogenesis in Prostate Cancer has Biomarker … · and 2 mM L-glutamine (Sigma...

Documents

Transcript of Altered Endosome Biogenesis in Prostate Cancer has Biomarker … · and 2 mM L-glutamine (Sigma...