Alignment of raw reads in Avadis NGS

© Strand Life SciencesStrictly Confidential

PioneeringScientific Intelligence

DNA/Small RNA Alignment in Avadis NGS 1.3

© Strand

Questions we will seek to answer in this presentation

What is an Alignment algorithm?

What issues must an Alignment algorithm consider?

How do Alignment algorithms work?

How does CoBWeb work?

How does CoBWeb compare with other algorithms?

How is CoBWeb exposed in Avadis NGS?

What is the future evolution of CoBWeb?

© Strand

What is an Alignment algorithm?

© Strand

AGGCTACGCATTTCCCATAAAGACCCACGCTTAAGTTC

Subject’s Genome

AGGCTACGCATGTCCCATAATGACCCACACTTAAGTTCReference Genome,

close but not quite the

same as the Subject’s Genome

© Strand

What issues must an Alignment algorithm consider?

© Strand

Reads

Reference Genome

SNP

Deletion

Mismatches and Gaps

© Strand

Subject’s Genome

Reference Genome

×

Handling paired reads

Repeat Region

Repeat Region

© Strand

A variety of Read Lengths

Short reads ~50, few

mismatches and gaps

Long reads, few

hundreds to thousands, many more mismatches

and gaps

© Strand

Speed and Memory

Run in 4GB RAM Allow use of

multiple cores/proces

sors

Scale speed with more memory

Billions of reads.

© Strand

How do Alignment algorithms work?

© Strand

Indexing the Genome to find Seed Matches

Scanning the Reference for each

Read takes too long

The Index very quickly yields

locations in the Reference where some part (seed)

of the Read matches.

The Reference Index

This Seed occurs at Reference

locations x1, x2…

This Seed occurs at Reference

locations x3, x4…

© Strand

Detailed Alignment at Seed Match Locations

Reference

Read

Seed Match

How many Mismatches and

Gaps are needed for the Read to match around the Seed?

Smith-Waterman or Dynamic

Programming

© Strand

C G A C $

A C $ C GC G A C $C $ C G AG A C $ C$ C G A C

The original

Reference

This column is the BWT

20314

All its circular shifts, sorted

lexicographically

Circular Shift Indices

The Index comprises these along with some

housekeeping data structures

The Burrows-Wheeler

based Index

These can be sampled to fit into reduced memory at

the expense of speed without

sacrificing correctness

© Strand

The Burrows-Wheeler

based Index

All Exact Matches of a Read (NO Mismatches or Gaps) in the Reference can be found in time proportional to the

length of the Read and largely independent of the

size of the Reference.

Reference

Read

EXACT Match

© Strand

How does CoBWeb work?

© Strand

Seeding Strategy

Use the BW based index, augmented

with additional data structures

for speed, to find one or more Long Seed Matches in the Reference

This 15-mer occurs at

locations x1, x2…

This 15-mer occurs at

locations x3, x4… This whole 30-

mer occurs at location x5

Justification: Most long Reads do not have

Mismatches and Gaps strewn across their length; there are

usually long stretches that match exactly.

And Long Seeds will have few

matching locations.

© Strand

Advantages

Seed length is not specified in advance,

so Long and Short reads can be handled

seamlessly.

Separating the Smith-Waterman phase

from the BW Index search allows an

unlimited number of gaps and

mismatches.

© Strand

Comparison with BWA

Read Length 50

Read Length

150

A little faster than BWA with

comparable results

CoBWeb: 94%

Alignment Score with

up to 2 Gaps

BWA: 4% error + 1

gap of possibly multiple length

© Strand

Alignment Parameters

Specify number of Mismatches and

Gaps, and handling of Multiple Matching.

Specify Adaptor Trimming (only for

Small RNA) and 3’,5’ trimming based on

quality

Screen against Contaminant Databases.

Alignment of raw reads in Avadis NGS

Technology

Transcript of Alignment of raw reads in Avadis NGS