بسم الله الرحمن الرحیم

Al-neelain University

Faculty of Graduate studies

Molecular Characterization of Carbapenemase-Producing KlebsiellaNDMblaandVIMbla,KPCbla,48-OXAblaDominance ofpneumoniae

producers in Khartoum, Sudan

A dissertation submitted in fulfilment of the requirement of the degree of

PhD in Microbiology

By:

Abdelhakam Hassan Ibrahim Ali

B.Sc , Medical Laboratory Sciences, 2009

Omdurman Islamic University

M.Sc, Medical Microbiology, 2012

Sudan University of Science and Technology

Supervisor

Professor

Alfadhil Al Obeid Omer

MD, FRC Path, MRCP

FICTM, FIBMS, AM.Bd

2018

I

ا علمت رشدا (( ))قال لھ موسى ھل أتبعك على أن تعلمني مم

)66(الكھفسورة

صدق الله العظیم

II

Dedication

To:

My mother

My father

Brothers and sisters

Friends and teachers

III

Acknowledgment

First of all my thanks and eulogize were due to ALMIGHTY ALLAH, the beneficent

and merciful, for giving me health and strength to accomplish this work.

Firstly, I would like to express my sincere gratitude to my supervisor Prof. AlfadhilAl Obeid Omer for the continuous support of my PhD study and related research, for

his patience, motivation, and immense knowledge. His guidance helped me in all the

time.

I would like to express my deepest gratitude to my teachers Prof. Wafa Elhag, Dr.

Hosham Nouraldaiem for their guidance, insight, encouragement and valuable

supervision throughout this study.

I must acknowledge as well the many friends, colleagues, students, teachers,

archivists, and other librarians who assisted, advised, and supported my research and

writing efforts over the years. Especially, I need to express my gratitude and deep

appreciation to Mr. Mohammad Aljak, Mr. Altelib, Mr. Altayeb Mahmood,

Mr.Marwa Mamoon and Mr. Mustafa Alheber because of their friendship, hospitality,

knowledge, and wisdom have supported, enlightened, and entertained me over the

many years of our working. They have consistently helped me keep perspective on

what is important in life and shown me how to deal with reality.

My thanks and gratitude also was offered to Miss.Hadeah, Mr. Ammar., Miss. Ala

Alnaeam , Miss. Najat, Miss. Nafessa, Mr. Mohammad Ibrahim , Miss. Wafa

Mohammad, Miss. Tagwa Ali, Miss. Maha Baballah, Miss.Salma Alnour, All the

Molecular research lab staff at Al-Neleen University (Mr. Gosse, Miss. Anan, Miss.

Soha, Miss. Shereen and Miss. Sara). Lab assistants at Ribat National University (Mr.

Gaboosh, Mr. Mohammad Babiker and Mr. Alamin Azrag) for their help and

unlimited support.

Last but not least my thanks and appreciation to anyone who helped me directly or

indirectly in the preparation and revision of this study during the research work, my

best regards to all without any exception.

IV

Abstract

Background and objectives: Antibiotic non susceptible Bacteria have been increased

and disseminated all over the world. So this resistant strain with treatment difficulty

may threat the Patients lives. However the last line of treatment for such infection is

antibiotic from Carbapenem family. One of the most virulence bacteria with pandrug

resistant is Klebsiella pneumoniae which associated with high morbidity and

mortality. In this study, the phenotypic and genotypic features of carbapenem-

resistant K. pneumoniae strains isolated in some Sudanese hospitals were studded.

Methodology: A total of 315 K.pneumoniae isolates were collected between May

2015 to January 2017, from Microbiology laboratories of different Hospitals in

Khartoum, Sudan. Beside one strain of K. pneumoniae (ATCC 700603) was used as

quality controls.

Phenotypic detection had been done by modified Hodge test (MHT) and Carba NP

direct test while genotypic detection was done by Real time PCR.

Results: Out of these 315 isolates 96 (30%) isolates of Klebsiella pneumoniae were

show resistant to carbapenem by Disc diffusion test were included in this study.

Our results revealed that 63 (65.6%) isolates were carbapenemase producers by

phenotypic tests. Seventy-two percent (70/96) isolates were showed presence of used

carbapenemase genes; 59.4% (57/96) were positive for blaKPC genes, 57.3% (55/96)

were positive for blaNDM genes, 37.5% (36/96) were positive for blaVIM genes and

35.4% (34/96) were positive for blaOXA-48 genes.

In this study we found that nineteen isolates possessed four genes, fourteen isolates

possessed three genes, 27 isolates possessed two genes, 10 isolates possessed only

one gene and the remaining 26 isolates were free from these four genes.

Conclusion: this study showed that the most common type of carbapenemase gene

detected in these clinical isolates is blaKPC. Co-production of KPC, VIM, NDM and

OXA-48 genes are found too.

V

المستخلص

ده لحیاة اعداد البكتریا المقاومھ للمضادات الحیویھ في ازدیاد في جمیع انحاء العالم وھي مھد:والاھداف مقدمھال

كاربابینیم ومع الم لاستخدام مضادات حیویھ بدیلھ وكان اخره تلك التي تتبع الي عائلة الالمرضي , لذلك اتجھ الع

متلك مقاومھ ذلك لوحظ في السنوات الاخیرة ادي الاستعمال غیر الجید والرشید الي ظھور بعض انواع البكتریا ت

لھذا المضاد الحیوي.

یات.المسوؤلھ عن نسبھ عالیھ جدا من الامراض والوفبسیلة الرئویھ ھذه البكتریا المقاومھ ھي الكلواحدة من

عض مستشفیات لذلك كانت ھذه الدراسھ والتي تعني بدراسھ المظاھر الشكلیھ والجینیھ لھذه البكتریا المقاومھ في ب

الخرطوم بالسودان.

2015لفتره من مایو من العینات الكلینیكیھ المختلفھ من بكتریا الكلبسیلھ الرئویھ في ا315تم جمع المنھجیھ :

, اضافھ الي ذلك تم استخدام الكلبسیلھ المستشفیات بولایة الخرطوم بالسودانمن مختلف2017الي ینایر

) كبكتریا معیاریھ.700603أ تي سي سي الرئویھ ذات الرقم (

ساسیھ طریق اختبار الح) بكتریا كانت مقاومھ لعائل الكاربابینیم عن%30(96من جملة ھذه البكتریا المعزولھ

ھودج ا اختبار الھمللمقاومھ بواسطھ اختبارین دراسھ الظاھره الشكلیھالطبقي . لھذه المعزولات تم اجراء

تفاعل اختبارةبینما تمت دراسة الظاھرة الجینیھ بواسطاختبار نوردمان وبوریل للكاربابینیم المباشروالمعدل

ي.البولیمیراز المتسلسل اللحظ

) من البكتریا المقاومھ للكاربابینیم منتجھ لانزیم الكاربابینیمیز %65.6(63اشارت ھذه الدراسھ الي ان النتائج:

بواسطھ الاختبارات الشكلیھ اما الاختبار علي المستوي الجیني فقد اوضح ان مانسبتھ اثنین وسبعین بالمائھ

الكلبسیلھ الرئویة عائلة موضوع الدراسھ, حیث ان الجین ) من البكتریا تحت الدراسھ حاملھ للجینات 96\70(

فیرونا ), الجین96\55(%57.3یمثل نیودلھي فلزیة البیتالاكتامیز), الجین 96\57(%59.4یمثل الكاربابینیم

).96\34(%35.4یمثل 48-اوكساسلین ) والجین 96\36(%37.5یمثل انتجرون فلزیة البیتالاكتامیز

بكتریا تحمل 27, جینات بكتریا تحمل ثلاثھ14بكتریا تحمل اربعة جینات , 19لك وجد ان ھناك اضافھ الي ذ

بكتریا كانت 26وبقیة البكتریا المقاومھ للكاربابینیم وعددھا جین واحد فقط یوجد بھابكتریات 10وجینین فقط

لاتحمل اي من الجینات المستخدمھ في ھذه الدراسھ .

الكلبسیلھ الجین ت ھذه الدراسھ ان اكثر جین موجود في ھذه البكتریا المقاومة للكاربابینیم ھو اظھرالخلاصة:

. ایضا وجدت ان ھنالك بعض البكتریا المعزولة تحتوي علي ھذه الاربعة جینات الرئویة عائلة الكاربابینیم

موضع الدراسھ.

VI

TABLE OF CONTENTS

TITLE Page No.

الآیة I

Dedication II

Acknowledgement III

Abstract IV

المستخلص V

Table of contents VI

List of tables X

List of figures XI

List of abbreviations XI

CHAPTER ONE: INTRODUCTION &LITERATURE REVIEW

1.1. Introduction 1

1.2. Literature Review 2

1.2.1. Klebsiella pneumoniae 2

1.2.1.1. Pathogenicity of K.pneumoniae 3

1.2.1.2. Properties Relevant to Pathogenicity for Humans 4

1.2.1.2.1. Adhesions 4

1.2.1.2.2. Capsular Polysaccharides 4

1.2.1.2.3. Lipopolysaccharide 4

1.2.1.2.4. Siderophores 5

1.2.1.3. Identification of Klebsiella pneumoniae 5

1.2.1.3.1. Phenotypic detection 5

1.2.1.3.2. Identification based on molecular methods. 5

1.2.2. Carbapenem antibiotic 5

1.2.2.1. Mechanism of action. 7

1.2.2.2. Mechanisms of resistance against Carbapenems 8

VII

TITLE Page No.

1.2.3. Carbapenemase 8

1.2.3.1. Classification of Carbapenemase 9

1.2.3.1.1. Molecular Class A Carbapenemases 10

1.2.3.1.1. 1. Chromosomally Encoded Enzymes: SME, NMC, and IMI 10

1.2.3.1.1. 2. Plasmid-Encoded Enzymes: KPC and GES 10

1.2.3.1.2. Class B Metallo- β-Lactamases 12

1.2.3.1.3. Class C (functional group 1e) 13

1.2.3.1.4. Class D Serine-Carbapenemases: The Oxa Β-Lactamases(Functional Group 2df):

14

1.3. Rationale 19

1.4. Objectives 21

1.4.1. General Objective 21

1.4.2. Specific Objectives 21

CHAPTER TWO: MATERIALS AND METHODS

2. Materials And Methods 22

2.1. Study design 22

2.2. Study area 22

2.3. Sample size and sampling technique: 22

2.4. Inclusion criteria 22

2.5. Exclusion criteria 22

2.6. Ethical consideration 22

2.7. Data collection and analysis 22

2.8. Study protocols 23

2.8.1. Bacterial isolates 23

2.8.2. Identification of isolated Bacteria 23

VIII

TITLE Page No.

2.8.2.1. Colonial morphology 23

2.8.2.2. Gram stain 23

2.8.2.3. Biochemical identification 23

2.8.2.4. Chromogenic agar media 23

2.8.3. Antimicrobial Susceptibility Testing 24

2.8.3.1. Method of sensitivity test 24

2.8.4. Preservation of isolates 24

2.9. Phenotypic Detection of Carbapenemase 25

2.9.1. Modified Hodge Test (MHT) 25

2.9.1.1. Procedure of Modified Hodge test 25

2.9.1.2. Reading and interpretation of results 25

2.9.2.Carba Nordmann Poirel Test Direct (CNPt-direct) 25

2.9.2.1. Procedure of Nordmann Poirel Test Direct 26

2.9.2.2. Reading and interpretation of CNPt-direct results: 26

2.10. Molecular detection of carbapenemase genes: 26

2.10.1. DNA Extraction 26

2.10.2. Polymerase chain reaction (PCR) 26

2.10.2.1. Primers (Macrogen, Seoul, Korea) 26

2.10.2.2. Preparation of primers 27

2.10.2.3. Preparation of agarose gel 27

2.10.2.4. Preparation of reaction mixture 27

2.10.2.1. Real-Time PCR (Sacace Biotechnologie, Italy) 28

2.10.2.2. Interpretation of results 28

2.10.3. DNA Sequencing: 28

2.11. Bioinformatics analysis 28

IX

TITLE Page No.

2.11.1. Sequences (similarity and alignment) 28

2.11.2. Phylogenetic tree of NDM, VIM and OXA-48 carbapenemase

genes

29

2.12. Nucleotide sequence accession numbers: 29

CHAPTER THREE: RESULTS

3. Results 30

3.1. Patients and isolates characteristics 30

3.2. Antimicrobial Susceptibility Testing 30

3.3. Prevalence of carbapenemase activity based on phenotypic tests 30

3.3.1. Result of Modified Hodge Test (MHT) 30

3.3.2. Result of Carba Nordmann Poirel Test-Direct 31

3.4. Genotypic detection of Crbapenemase genes using PCR 31

3.5. Frequency and distribution of genes among isolated organisms 31

3.6. Correlation between phenotypic and genotypic results of

carbapenemase production

32

3.7. DNA Sequencing 33

3.7.1. KPC genes 33

3.7.2. NDM genes 33

3.7.3. VIM genes 34

3.7.4. OXA-48 genes 34

3.8. Novel genes detected 34

CHAPTER FOUR: DISCUSSION

4.Discussion 35

CHAPTER FIVE: CONCLUSION & RECOMMENDATIONS

5.1. Conclusion 41

5.2. Recommendations 42

X

TITLE Page No.

References 43

Appendices 57

LIST OF TABLES

TITLE P.No

Table (2:1): Primer sets for amplification of carbapenem resistancedetermine genes.

27

Table (3:1): Distribution of enrolled patients according to age groups 30

Table (3:2): Frequencies of Genes (blaKPC, blaNDM, blaVIM and blaOXA-

48 )

31

Table (3:3): Frequency and distributed of Genes out of Isolated K.pneumoniae

32

Table (3:4): Genotypic detection crosstab phenotypic detection (MHT&C-NP)

33

XI

LIST OF FIGURES

TITLE P.No

Figure (3:1) :Phylogenetic tree of NDM, VIM and OXA-48 carbapenemasegenes

34

LIST OF ABBREVIATIONS

ABBREVIATION MEANINGCA Community-Acquired

CLSI Clinical Laboratory Standards Institute

CNP T Direct Carba Nordman Poreil Test Direct

CR-GNB Carbapenem Resistant Gram-Negative Bacilli

GES Guiana Extended Spectrum

GIM German Imipenemase

IBC Integron-Borne Cephalosporinase

ICAAC Inter Science Conference on Antimicrobial Agents and

Chemotherapy

IMI Imipenem-Hydrolyzing Β-Lactamase

KPC Klebsiella Pneumoniae Carbapenemase

MHT Modified Hodge Test

NDM New Delhi Metallo Β-Lactamase

NMC Not Metalloenzyme Carbapenemase

OXA-48 Oxacillinases

SIM Seoul Imipenemase

SME Serratia Marcescens Enzyme

SPM Sao Paulo Metallo- Β-Lactamase

VIM Verona Integron-encoded Metallo-Β-Lactamase

XII

1

CHAPTER ONE

INTRODUCTION & LITERATURE REVIEW

1.1. Introduction

Antibiotics are chemotherapeutic agents that have been change the treatment of

infectious disease – turning dangerous diseases into more controllable and easy to

cure conditions. Moreover to healing the community-acquired diseases, antibiotics

have facilitated and increased the safety and postoperative of surgery and organs

transplantation in hospitals and other medical sectors (1).

As matter of fact Resistance became a major problem to the drugs used for curing of

infectious diseases soon after the introduction of antibiotics. These were originate of

natural origin, such as bacteria or fungi (2). In 1928, the German scientist Alexander

Fleming first discovered that the penicillium nonatum one of the kindom of

mycology has the ability to produce antibacterial substance (3). At the beginning of

1940, this product was called penicillin and used as the first antibiotic on the medical

field and claimed grew as antibiotics were look like miracle treatment for a rapid

cure of infection. But , for not more than three years the report of penicillin-resistant

Staphylococcus aureus infections were existed and more than 60% of hospital S.

aureus infections were resistant by the end of the first decade of global use of this

new drug (4).

Antibiotic resistant has a lrge challenge to local, national and global public health.

Resistant bacteria minimize the probability for good treatment of infectious diseases

and infections. Moreover , Antibiotic resistant increases possibility of complications,

morbidity and mortality toward patients (5).

This challenges is further increase the rate resistance to all kinds of antibiotic

(e.g. beta-lactams, quinolones, tetracyclines, glycopeptides and macrolides) . In spite

of the levels of resistance are high tell now in developed countries, they are most

warning in developing counties (6). The history of Antibiotic resistant In developed

countries without a prescription from doctors you cannot take antibiotic from

pharmacy ; while in developing countries antibiotics are often available everywhere

even over-the-counter, which lead to self-medication and use of antibiotic by wrong

ways (7).

2

There are many factors that related with the elevated risk of morbidity, mortality and

duration of hospital stay for patients with resistant infections. Cosgrove and Carmeli

(2003) recommended that antibiotic-resistant microorganisms may altered the patient

healing from the infection in three different ways. Firstly , resistant genes may

change the virulence of pathogenic bacteria, making the bacteria more or less

virulent. Secondly, the presence of resistance in a pathogenic bacteria may lead to a

delay in the using of suitable antibiotic therapy. The third factor, majority of

antibiotic that used for eradicating resistant pathogens are toxic or unsuitable for

used (8). Add to that, resistance in developing countries often associate with high

mortality because of a lack of access to more affordable and effective antibiotics (9).

1.2. Literature Review

1.2.1. Klebsiella pneumoniae

Klebsiella pneumoniae was isolated for the first time in 1882 by Friedlander from the

lungs of patients who died suffering from pneumonia. This encapsulated bacterium,

initially named Friedlander’s bacillus, and then renamed Klebsiella in 1886. Later, it

was described as a saprophyte microorganism, not only colonizing the human

gastrointestinal tract, skin and nasopharynx, but also able to cause urinary and biliary

tract infections, osteomyelitis and bacteremia (10). Klebsiella is a genus of non-motile,

oxidase-negative, rod-shaped, Gram-negative bacteria with a prominent capsular

polysaccharide (11) It is named after the Edwin Klebs a German microbiologist (1834–

1913). Klebsiella species are found everywhere in nature. This is thought to be due to

developing specific adaptations, with associated biochemical adaptations which make

them better suited to a different environment. They can be found in water, soil,

plants, insects, animals and humans (12). Klebsiella bacteria tend to be rounder and

thicker than other family members of the Enterobacteriaceae . They occur as straight

rods with typically rounded or slightly pointed ends. They can be found singly, in

pairs or in short chains. Diplobacillary forms are predominantly found in vivo (13).

Klebsiella species are mostly found in the human as normal flora in nose, mouth, and

gastrointestinal tract; where, they can also behave as opportunistic human pathogens(13). Members of the genus produce a prominent capsule, or slime layer, which can be

used for serologic identification, but molecular serotyping may replace this method(12). They need no specific growth requirements and grow well on standard laboratory

3

media, but grow best between 35 and 37 °C and at pH 7.2. The species are facultative

anaerobes, and most strains can survive with citrate and glucose as their sole carbon

sources and ammonia as their sole nitrogen source (13).

Klebsiella pneumoniae can lead to a wide range of diseases , particularly pneumonia,

urinary tract infections, septicemia, meningitis, diarrhea and soft tissue infections (14).

The majority of human Klebsiella infections are caused by K. pneumoniae, followed

by K. oxytoca. Infections are more common in the very young, very old, and those

with other underlying diseases, such as cancer (12). And most infections due to

contamination of an invasive medical devices (13).

1.2.1.1. Pathogenicity of K. pneumoniae

Due to its high pathogenicity, in the pre-antibiotic era, it was considered as an

important causative agent of community-acquired (CA) infections, including a severe

form of pneumonia, especially in alcoholics and in week immunity individual such

as diabetic patients. In recent years, while CA pneumonia due to this pathogen has

become rare, novel manifestations of K. pneumoniae CA infections, including liver

abscess complicated by endophthalmitis, different metastatic (15) often caused by

highly virulent strains of specifically serotypes, such as K1 (16) as well as urinary tract

infections have been described (17). K. pneumoniae is second only to Escherichia coli

in nosocomial infections caused by Gram-negative bacteremia (18) as well as in urinary

tract infections (UTIs), affecting catheterized patients (16% and 70%, respectively)(19).

In general, a cohort study proved that the majority of infections associated with

different medical devices, including both urinary and intravascular catheters, was

caused by K. pneumoniae followed by staphylococcal biofilms, and a high percentage

(about 90%) of biofilm-producing bacterial isolates causing infection were multidrug

resistant (20). In 2013, the incidence of K. pneumoniae clinical infections was

estimated in the United States to be higher in long-term acute care hospitals,

compared to short-stay hospital intensive care units (21). In a prospective study on

hospital-acquired infections carried out in Rome in the period January, 2002–

December, 2004, K. pneumoniae was reported as the second most frequent Gram-

negative species (11%) after Pseudomonas (25%) (22).

4

1.2.1.2. Properties Relevant to Pathogenicity for Humans

The pathogenicity of Klebsiella pneumoniae depend on Four components which

have long been implicated in pathogenesis: adhesins, capsular polysaccharides,

lipopolysaccharide (LPS), and iron-scavenging systems (siderophores) (14).

1.2.1.2.1. Adhesions

Adhesion to mucosal and epithelial cell surfaces is often the first step in the

development of colonization and infection. Adhesins are often also hemagglutinins

and may be located on fimbriae that protude on the surface of the bacterial cells.

Klebsiella fimbriae were studied by Duguid (1959), who demonstrated their

association with different hemagglutination (HA) behaviors.

1.2.1.2.2. Capsular Polysaccharides

Klebsiella strains are surrounded by a generally thick hydrophilic polysaccharide

capsule responsible for the glistening, mucoid aspect of colonies on agar plates. A

total of 77 antigenically distinct exopolysaccharides have been recognized so far and

are included in the international K-serotyping scheme (23). The chemical structure of

most K-antigen types has been analyzed (24). Capsular polysaccharides are acidic and

composed of repeats of basic units of four to six sugars. It has been shown that non

carbohydrate groups are also present on some capsular types, but very little is known

about the immunochemical specificity of Klebsiella capsular polysaccharides.

1.2.1.2.3. Lipopolysaccharide

The lipopolysaccharide (LPS) molecule is composed of lipid A, a core polysaccharide

and a side chain called the “O-antigen.” Nine types of O-antigen are distinguished in

this organism , O1 being the most predominant (25). Protection of K.pneumoniae from

complement mediated killing is the most important role of O-antigen. Non-capsulated

strains lacking the O1 antigen are very sensitive to the bactericidal action of both the

alternative and classical complement pathways (26). The O1 lipopolysaccharide has

been linked with the extensive tissue necrosis that complicates Klebsiella infections(27).

5

1.2.1.2.4. Siderophores

Iron is essential for bacterial growth. Brewer et al. (1982) observed that virulence was

enhanced by hyperferremia, suggesting that iron scavenging may also be a virulence

factor. In the human body, iron is complexed to carrier molecules such as transferrin

(in the serum) or lactoferrin (in milk and other secretions), or sequestered within cells

(in heme proteins). Under conditions of iron limitation, potentially pathogenic

Enterobacteriaceae produce high-affinity systems (siderophores) to solubilize and

import the required iron. The iron-chelating compounds produced are mostly of two

sorts, phenolates (e.g., enterochelin) and hydroxamates (aerobactin) (28,29).

1.2.1.3. Identification of Klebsiella pneumoniae

1.2.1.3.1. Phenotypic detection

Klebsiella are straight Gram-negative rods, 0.3–1 μm in diameter and 0.6–6 μm in

length, often surrounded with a capsule (30). The large mucoid colonies often contain

cells with large capsules and those of K. pneumoniae subsp. ozaenae and K.

pneumoniae subsp. Rhinoscleromatis are often present . Usually the methyl red test is

negative and the Voges- Proskauer (VP) test is positive, meaning that acetoin and 2,3-

butanediol are produced from glucose fermentation and that neutral end products

predominate over the acidic end products. Some strains of K. rhinoscleromatis do not

form acetoin and 2,3-butanediol, other strains produce acetoin and 2,3-butanediol in

such small amounts that the methyl red reaction remains positive, and in other strains,

the acetoin disappears before the VP reaction is tested, so both tests may be positive

or both tests negative (30).

1.2.1.3.2. Identification based on molecular methods.

Identification of Klebsiella species and phylogenetic groups within K. pneumonia and

K. oxytoca can now be reliably achieved based on the sequencing of housekeeping

genes such as gyrA and parC (31) or rpoB (32).A simplified method based on gyrA PCR-

RFLP was recently developed for species identification (33). Species can be identified

by 16S rRNA gene sequencing, but because of limited nucleotide variation, 16S

rRNA sequences cannot be reliably used to distinguish the phylogenetic groups (31).

1.2.2. Carbapenem antibiotic

In the late 1960s, as bacterial β-lactamases emerged and threatened the use of

penicillin, the search for β-lactamase inhibitors began seriously (34). By 1976, the first

6

β-lactamases inhibitors were discovered; these olivanic acids were natural products

produced by the Gram-positive bacterium Streptomyces clavuligerus. Olivanic acids

possess a “carbapenem backbone” (a carbon at the 1 position, substituents at C-2, a C-

6 ethoxy, and sp2-hybridized C-3) and act as broad-spectrum β-lactams (34). Due to

chemical instability and poor penetration into the bacterial cell, the olivanic acids

were not further used (35).

Shortly after that, two superior β-lactamase inhibitors were discovered: (i) clavulanic

acid from S. clavuligerus, the first clinically available β-lactamase inhibitor (36), and

(ii) thienamycin from Streptomyces cattleya (37). Thienamycin was the first

“carbapenem” and would eventually serve as the parent or model compound for all

carbapenems. A groups of other carbapenems were also identified (38) however, the

discovery of thienamycin was paramount. The term “carbapenem” is defined as the

4:5 fused ring lactam of penicillins with a double bond between C-2 and C-3 but with

the substitution of carbon for sulfur at C-1. The hydroxyethyl side chain of

thienamycin is a radical departure from the structure of conventional penicillins and

cephalosporins, all of which have an acylamino substituent on the β-lactam ring; the

stereochemistry of this hydroxylethyl side chain is a key attribute of carbapenems and

is important for activity (39). Remarkably, thienamycin demonstrated potent broad-

spectrum antibacterial and β-lactamases inhibitory activity (40). This notable discovery

was first reported at the 16th Inter science Conference on Antimicrobial Agents and

Chemotherapy (ICAAC) meeting in 1976 (37). Although thienamycin is a “natural

product” and the biosynthetic pathway was determined (41), yields from the

purification process were low. With time, the synthetic preparation of thienamycin

assumed greater importance; especial compound grew rapidly, since thienamycin

displayed inhibitory microbiological activity against Gram-negative bacteria,

including isolates of Pseudomonas aeruginosa, as well as anaerobes, like Bacteroides

fragilis, and Gram-positive bacteria, such as methicillin or oxacillin-susceptible

Staphylococcus aureus and streptococci (42).

Unfortunately, thienamycin was found to be unstable in aqueous solution, sensitive to

mild base hydrolysis (above pH 8.0), and highly reactive to nucleophiles, such as

hydroxylamine, cysteine, and even thienamycin’s own primary amine (39). The

chemical instability of thienamycin stimulated the search for analogous derivatives

with increased stability. Due to the continued evolution of cephalosporin-resistant

7

Gram negative and Gram-positive pathogens, compounds derived from thienamycin

were anticipated to have even greater value with time (43).

The first developed was the N-formimidoyl derivative, imipenem (44). Imipenem and a

closely related carbapenem, panipenem, identified later, were more-stable derivatives

of thienamycin and less sensitive to base hydrolysis in solution. In 1985, imipenem

(originally called MK0787) became the first carbapenem available for the treatment

of complex microbial infections. Imipenem, like its parent, thienamycin,

demonstrated high affinity for PBPs and stability against β-lactamase (45). However,

both imipenem and panipenem were susceptible to deactivation by dehydropeptidase-

I (DHP-I), found in the human renal brush border (46). Therefore, coadministration

with an inhibitor, cilastatin or betamipron was necessary (47).

Along the way to the discovery of more-stable carbapenems with a broader spectrum,

the other currently available compounds, meropenem, biapenem, ertapenem, and

doripenem, were developed, and several novel carbapenems were also identified (48).

A major advance in this “synthetic journey” was the addition of a methyl group to the

1-β- position. This modification was found to be protective against DHP-I hydrolysis(49).

1.2.2.1. Mechanism of action

As a class of β-lactams, carbapenems are not easily diffusible through the bacterial

cell wall (45).As general , carbapenems enter Gram-negative bacteria through outer

membrane proteins (OMPs), also known as porins. After crossing the periplasmic

space, carbapenems “permanently” acylate the PBPs (45). PBPs are enzymes (i.e.,

transglycolases, transpeptidases, and carboxypeptidases) that catalyze the formation

of peptidoglycan in the cell wall of bacteria. Current insights into this process suggest

that the glycan backbone forms a right-handed helix with a periodicity of three per

turn of the helix (50). Carbapenems act as mechanism-based inhibitors of the peptidase

domain of PBPs and can inhibit peptide cross linking as well as other peptidase

reactions. A key factor of the efficacy of carbapenems is their ability to bind to

multiple different PBPs (45). Since cell wall formation is a dynamic “three-dimensional

process” with formation and autolysis occurring at the same time, when PBPs are

inhibited, autolysis continues (51). Eventually the peptidoglycan weakens, and the cell

bursts due to osmotic pressure.

8

1.2.2.2. Mechanisms of resistance against Carbapenems

Many nonfermenting Gram-negative bacteria (e.g., Pseudomonas spp., Acinetobacter

spp., and Stenotrophomonas spp.), as well as the Enterobacteriaceae (e.g., Klebsiella

spp., Escherichia coli, and Enterobacter spp.) and Gram-positive bacteria (e.g.,

Staphylococcus spp., Streptococcus spp., Enterococcus spp., and Nocardia spp.), are

or are becoming resistant to most clinically available carbapenems. This distressing

pattern poses a major public health threat. mechanisms of resistance to carbapenems

include production of β-lactamases, efflux pumps, and mutations that alter the

expression and/or function of porins and PBPs . Of these mechanisms can cause high

levels of resistance to carbapenems in certain bacterial species, such as Klebsiella

pneumoniae, P. aeruginosa, and A. baumannii (52).

A different exists between resistance to carbapenems in Gram-positive cocci and

Gram-negative rods. In Gram-positive cocci, carbapenem resistance is typically the

result of substitutions in amino acid sequences of PBPs or production of a new

carbapenem-resistant PBP (53). Expression of β-lactamases and efflux pumps, as well

as porin loss and alterations in PBP, are all belong to carbapenem resistance in Gram-

negative bacilli (54).

1.2.3. Carbapenemase

Carbapenemases represent the most universal family of β-lactamases, with a

expansion of spectrum incomparable by other β-lactamases hydrolyzing enzymes.

Although known as “carbapenemases,” many of these enzymes recognize almost all

hydrolysable β-lactamases, and most are elastic against inhibition by all

commercially viable β-lactamases inhibitors (55).

Some scientists have preferred the nomenclature “carbapenem- hydrolyzing enzymes”

to the term “carbapenemases,” suggesting that carbapenems are but one segment of

their substrate spectrum (56). However, the term carbapenemase has become fixed in

the β-lactamases literature and is used throughout this review.

Carbapenemases belong to two major molecular families, distinguished by the

hydrolytic mechanism at the active site. The first carbapenemases described were

from gram-positive rods. Unlike other β-lactamases known at that time, these

enzymes were inhibited by EDTA, therefore establishing them as metallo enzymes.

Later work has shown that all metallo carbapenemases contain at least one zinc atom

9

at the active site that acts to facilitate hydrolysis of a bicyclic β-lactamases ring (57).

In the mid to late 1980s, another group of carbapenem- hydrolyzing enzymes

appeared among the Enterobacteriaceae (58), but EDTA did not inhibit their activity(59). Later studies showed that these enzymes utilized serine at their active sites and

were inactivated by the β-lactamases inhibitors clavulanic acid and tazobactam (59).

Until the early 1990s, all carbapenemases were showed as species-specific,

chromosomally encoded β-lactamases, each with a remarkable set of characteristics.

However, the identification of plasmid-encoded IMP-1, a metallo- β-lactamases in

Pseudomonas aeruginosa (60), ARI-1 (OXA-23), a class D carbapenemase in

Acinetobacter baumannii (61), and KPC-1, a class A carbapenemase in Klebsiella

pneumoniae (62), has changed the patterns of carbapenemase dissemination.

1.2.3.1. Classification of Carbapenemase

Classification of β-lactamases can be achieved according to two charactristics,

functional and molecular. In the early work with β-lactamases, before genes were

routinely cloned and sequenced, a new β-lactamases was analyzed biochemically by

isolating the protein and determining its isoelectric point, followed by enzymatic

studies to determine substrate hydrolysis and inhibition properties (63). The relative

rates of hydrolysis for a broad spectrum of β-lactam substrates, and inhibitor profiles,

allowed for the classification of the new β-lactamases. This functional classification

process evolved over many years into a widely accepted scheme currently dividing

the known β-lactamases into four major functional groups (groups 1 to 4), with

multiple subgroups under group 2 that are differentiated according to group-specific

substrate or inhibitor profiles (64). In this functional classification scheme,

carbapenemases are found primarily in groups 2f and 3.

Classification based on amino acid homology has resulted in four major classes (65),

which matched well with the functional scheme but lack the detail involving the

enzymatic activity of the enzyme. Molecular classes A, C, and D include the β-

lactamases with serine at their active site, whereas molecular class B β-lactamases are

all metalloenzymes with an active-site zinc. Carbapenemases, β-lactamases with

catalytic efficiencies for carbapenem hydrolysis, resulting in elevated carbapenem

MICs, include enzymes from classes A, B, and D.

10

1.2.3.1.1. Molecular Class A Carbapenemases

Class A serine carbapenemases of functional group 2f have found sporadically in

clinical isolates since their first appeared over 20 years ago (58). These β-lactamases

have been detected in Enterobacter cloacae, Serratia marcescens, and Klebsiella spp.

as single isolates or in small outbreaks (58). Bacteria expressing these enzymes are

characterized by reduced susceptibility to imipenem, but MICs can range from mildly

elevated to fully resistant. These β-lactamases, therefore, may go unrecognized

following routine susceptibility testing. Three major families of class A serine

carbapenemases include the NMC/IMI, SME, and KPC enzymes. Their hydrolytic

mechanism requires an active-site serine at position 70 in the Ambler numbering

system for class A β-lactamases (66).

All have the ability to hydrolyze a wide range of β-lactamases, consisting of

carbapenems, cephalosporins, penicillins, and aztreonam, and all are inhibited by

clavulanate and tazobactam, putting them in the group 2f functional subgroup of β-

lactamases. A fourth member of this class, the GES β-lactamases, was firstly

recognized as an ESBL family, but over time variants were discovered that had low,

but remarkable, imipenem hydrolysis. This subgroup of GES enzymes is also

classified as functional group 2f carbapenemases (66).

1.2.3.1.1. 1. Chromosomally Encoded Enzymes: SME, NMC, and IMI

The antibiotic resistance profile of strains expressing the chromosomal group 2f β-

lactamases is distinctive: carbapenem resistance joined with susceptibility to

extended spectrum cephalosporins. SME-1 (for “Serratia marcescens enzyme”) was

first investigated in England from two S.marcescens isolates that were collected in

1982 (67). The IMI (for “imipenem-hydrolyzing β-lactamase”) and NMC-A (for “not

metalloenzyme carbapenemase”) enzymes have been detected in a few clinical

isolates of E. cloacae in the United States, France, and Argentina. NMC-A and IMI-1

have 97% amino acid identity and are related to SME-1, with approximately 70%

amino acid identity (56).

1.2.3.1.1. 2. Plasmid-Encoded Enzymes: KPC and GES

Two properties separate the KPC (for “Klebsiella pneumonia carbapenemase”)

carbapenemases from the other functional group 2f enzymes. First, the KPC enzymes

are existed on transferable plasmids; second, their substrate hydrolysis spectrum

contain the aminothiazoleoxime cephalosporins, such as cefotaxime. Although the

11

KPC β-lactamases are mostly found in K. pneumoniae, there have been reports of

these enzymes in Enterobacter species and in Salmonella species (68). The first

member of the KPC family was discovered through the ICARE surveillance project in

a K. pneumoniae clinical isolate from North Carolina in 1996 (62). This isolate was

unsusceptible to all β-lactams tested, but carbapenem MICs decreased in combination

with clavulanic acid. Carbapenemase activity, first detected with a bioassay, was

associated with a large plasmid that encoded the KPC-1β-lactamases. The appeared

of KPC-1 was quickly followed by several reports of a single-amino-acid variant,

KPC-2, along the east coast of the United States (69,70) KPC-2 firstly recognized in

2003 as the result of a point mutation in KPC-1 and appeared in four isolates with

imipenem MICs of 2 to 8 µg/ml from Baltimore, MD, from 1998 to 1999. The KPC-

2- producing gene found on a transferable plasmid, and it was noted that while all

isolates showed reduced susceptibility to imipenem, none were technically resistant

according to approved CLSI (formerly NCCLS) breakpoints (70). KPC-2 was then

described in another Maryland site on a plasmid in Salmonella enterica (69).

KPC carbapenemases hydrolyze β-lactamas of all classes, with the most efficient

hydrolysis observed for nitrocefin, cephalothin, cephaloridine, benzylpenicillin,

ampicillin, and piperacillin. Imipenem and meropenem, as well as cefotaxime and

aztreonam, were hydrolyzed 10-fold-less efficiently than the penicillins and early

cephalosporins. Weak but measurable hydrolysis was seen for cefoxitin and

ceftazidime, giving the KPC family a broad hydrolysis spectrum that includes most β-

lactam antibiotics (71). Of the functional group 2f carbapenemases, the KPC family

has the greatest potential for spread because of location on plasmids, especially since

it is most frequently appeared in K.pneumoniae, an organism known for its ability to

accumulate and transfer resistance determinants. Add to that, the clonal spread seen in

several epidemics points to difficulties with infection control for this organism . Most

worrisome, treatment of infections caused by these organisms is extremely difficult

because of their multidrug resistance, which results in high mortality rates (68).

The GES/IBC family of β-lactamases is an infrequently encountered family that was

first described in 2000 with reports of IBC-1 (for “integron-borne cephalosporinase”)

from an E.cloacae isolate in Greece (72) and GES-1 (for “Guiana extended spectrum”)

in a K. pneumoniae isolate from French Guiana (73). These enzymes differ by only two

amino acid substitutions and possess the class A active site-motifs with the cysteine

residues at Ambler positions 69 and 238 that have been found in the KPC, SME, and

12

NMC/IMI families. Their amino acid sequences show them to be distantly related to

these carbapenemases, with identities of 36% to KPC-2, 35% to SME-1, and 31% to

NMC-A (74).

1.2.3.1.2. Class B Metallo- β-Lactamases

This class of β-lactamases is characterized by the ability to breakdown carbapenems

and by its unsusceptible to the commercially available β-lactamase inhibitors but

susceptibility to inhibition by metal ion chelators. The substrate spectrum is quite

broad; beside the carbapenems, majority of these enzymes breakdown cephalosporins

and penicillins but missing the ability to hydrolyze aztreonam. The mechanism of

action is dependent on interaction of the β-lactamas with zinc ions in the active site

of the enzyme, resulting in the distinctive trait of their inhibition by EDTA, a chelator

of Zn2+ and other divalent cations (75).

The first metallo- β-lactamases discovered and studied were chromosomal enzymes

exist in environmental and opportunistic pathogenic bacteria such as Bacillus cereus(76), Aeromonas species (77), and Stenotrophomonas maltophilia (78). The most

common metallo- β-lactamase families include the VIM, IMP, GIM, and SIM

enzymes, which are placed within a variety of integron structures, where they have

been incorporated as gene cassettes. When these integrons become associated with

plasmids or transposons, transfer between bacteria is readily become easily (71).

This enzyme hydrolyzed imipenem, penicillins, and extended-spectrum

cephalosporins but not aztreonam. The hydrolytic activity was inhibited by EDTA and

restored by the addition of Zn2+. The first member of the IMP family found in Europe

was in an A. baumannii isolate from Italy, which produced a related enzyme, IMP-2,

as the first cassette on a class 1 integron (79).

NDMs have been recently described as MBLs with high spreading tendencies and

have been the most popular enzymes within this family (80). Regardless the fact that

the NDM were first identified in India in 2008, today they appear in a widespread

pattern in a myriad of countries worldwide, primarily India, Pakistan, the USA, and

the Balkan states. In Turkey, different centres have reported NDM-producing

K.pneumoniae strains (81). NDM-1 has been investigated in Enterobacteriaceae, and

Gram negative non-fermenters (82,83). Some variants, such as NDM-4, -5 and -7, show

higher efficiencies of carbapenem breakdown (84). The systematical association of

13

NMDs with other resistance determinants and spread rapidity to other bacterial strains

poses a serious challenge to hygienic systems worldwide.

Another member family of integron-associated metallo-β-lactamases is composed of

the VIM enzymes. VIM-1 (for “Verona integron-encoded metallo-β-lactamase”) was

first identified in Verona, Italy, in 1997 (85), with the isolation of VIM-2 in France in

1996 subsequently reported (73). Both of these enzymes were firstly found in

P.aeruginosa clinical isolates and existed in class 1 integrons. The VIM family

currently consists of 14 members with occurrences mostly in P.aeruginosa within

multiple-integron cassette structures. VIM-2 has the doutable distinction of being the

most-reported metallo- β-lactamases worldwide (75).

SPM-1 (for “Sao Paulo metallo- β-lactamase”) was first isolated in a P. aeruginosa

strain in Sao Paolo, Brazil. From the first report, single clones of SPM-1-containing

P.aeruginosa have caused multiple hospital outbreaks with increasing mortality in

Brazil. Genetic analysis of regions around the SPM-1 gene approved that it was not

part of an integron but instead was associated with common regions that contain a

new type of transposable structure with potential recombine and promoter sequences(86).

GIM-1 (for “German imipenemase”) was isolated in Germany in 2002. GIM had

almost 30% homology to VIM, 43% homology to IMPs, and 29% homology to

SPM.GIM-1 has proprieties same as those of the other acquired metallo β-

lactamases in that it was found in five clonal P.aeruginosa isolates within a class 1

integron on a plasmid. Nowadays, it has not been noted elsewhere in the world (87).

The latest member family of acquired metallo-β-lactamases to be mentioned comes

from Korea. The enzyme SIM-1 (for “Seoul imipenemase”) has the closest amino

acid similarity to the IMP family (64 to 69%) (48). from their initial appeared , SPM,

GIM, and SIM metallo- β-lactamases have not spread their countries of origin.

However, VIM and IMP continue to be detected worldwide, with an overall trend of

these two metallo- β-lactamases moving beyond P.aeruginosa and into the

Enterobacteriaceae (71).

1.2.3.1.3. Class C Carbapenemase (functional group 1e):

AmpC (CMY) gene, is the unique carbapenem-hydrolyzing enzyme within class C β-

lactamases. This enzyme is an extended-spectrum cephalosporinase, reflecting a

three-amino-acid deletion in the R2-loop, and has been identified in Enterobacter

14

cloacae in South Korea (88). Class C β-lactamases are not carbapenemases. They

contain however a less potential of carbapenem hydrolysis and their overproduction

combined with efflux systems over-expression and/or diminished outer membrane

permeability has been proven to lead to carbapenem resistance (89).

1.2.3.1.4. Class D Serine-Carbapenemases: The Oxa Β-Lactamases

(Functional Group 2df): Class D β-lactamases, also defined as oxacillinases

(OXAs) due to their capability to breakdown oxacillin, are classified according to

their hydrolysis spectrum. Broad-spectrum OXA enzymes hydrolyze carbapenems

and represent a heterogeneous group including over 100 genetically different

enzymes subdivided into 9 clusters based on amino acid sequence (71). Carbapenems

are weakly hydrolyzed through OXA carbapenemases, rendering high minimum

inhibitory concentrations (MICs) below the resistance cut-off value. Moreover, OXA-

producing bacteria are typically unsusceptible to carbapenems, reflecting concurrent

resistance mechanisms, such as permeability alteration or the production of other β-

lactamases (90,81).

OXA carbapenemases are variably inhibited by clavulanic acid, sulbactam and

tazobactam. The vast majority of OXA carbapenemases, except the OXA-48 cluster,

have been detected in Acinetobacter spp. isolates, primarily A. baumannii, presenting

high resistance to carbapenems (91,92).Add to that , the OXA-48 cluster is the most

popular among class D carbapenemases. The activity of these enzymes is 10-fold

higher than that of other OXA enzymes, and the OXA-48 cluster has been identified

in K. pneumoniae, from which it has spread to other Enterobacteriaceae (93).

OXA enzymes hydrolyze penicillins and first generation cephalosporins, but have a

weak activity on oxyimino-cephalosporins. OXA-163, an OXA-48- like enzyme with

a single amino acid substitution and a four-amino-acid deletion, showed lower affinity

for carbapenems, but is active on extended-spectrum cephalosporins and partially

inhibited by clavulanic acid, mimicking an ESBL phenotypic profile (94, 95).

In a study in turkey, Karaaslan et al., 2015 they were studied 762 hospitalized

children. Of these, 176 (23 %) were colonized with carbapenem resistant gram-

negative bacilli (CR-GNB). NDM (31%) was the second most frequent

carbapenemase that was identified in Acinetobacter baumannii isolates. All of the 17

patients colonized with NDM-producing A. baumannii were newborns in the neonatal

intensive care unit. Independent risk factors for CR-GNB colonization were: age <1

15

year, nasogastric tube placement, presence of underlying chronic diseases, ampicillin

or carbapenem usage, surgical intervention (96).

In another study in turkey, Sahin et al., 2015, they were examined 43 carbapenem-

resistant strains isolated from different body sample among hospitalized patient and

detected OXA-48 gene in seven isolates and NDM-1 gene in one isolate . they

determen that of 43 strains, 35 (85 %) were carbapenemase-positive. Seven of the

isolates (16.3 %) were positive for the OXA-48 gene, as determined by multiplex

PCR. The NDM-1 gene was detected only in one strain (2.3 %). VIM and KPC

resistance genes were not detected in any isolates (97).

Another study in turkey by Oguz Karabay et al., 2016. During the December 2014 to

March 2015 period, NDM-1 positive K. pneumoniae strains were detected in eight

patients at intensive care unit .Six sample collected from blood followed with wound

and central catheter All of these strains were found to produce NDM-1, while two of

them also revealed the presence of OXA-48. All of the patients with NDM-1-

producing isolates in the blood culture ended up dying, except one patient in which

NDM-1 (+) K.pneumoniae was isolated from his wound sample and who was

discharged with a full recovery (98).

Study by Sonnevend et al., 2015, in the Arabian Peninsula, 145 independent

K.pneumoniae isolates collected in 16 hospitals of Saudi Arabia, Kuwait, Oman and

the United Arab Emirates were studied. All strains were multidrug resistant. The

frequency of various carbapenemases varied according to the participating countries,

but in the collection, as a whole, blaNDM-1 was the most frequently encountered

carbapenemase gene (53.8%) followed by blaOXA-48-like gene (29.7%). A

comparatively high rate (4.1%) of multi-clonal strains carrying both blaNDM and

blaOXA-48-like genes in the United Arab Emirates, representing the most resistant

subgroup, was encountered. No KPC-expressing isolates were detected. These results

call for improved surveillance of carbapenem resistant Enterobacteriaceae in the

countries of the Arabian Peninsula (99).

Wang et al., at 2012 in China they were collect 53 clinical isolate from multiple

infection sites like blood, wound, sputum, catheter, urine and pleural effusion from

Beijing Tongren Hospital. Meropenem resistant were 22 isolates , out of these

resistant strains only 20 isolate were positive for KPC gene by using real time-PCR at

the same time these 20 strains were also carbapenemase producers phenotypically by

Modified Hodge Test (MHT) (100).

16

Study done by Martha et al., 2014, A total of 68 MDR- K. pneumoniae isolates were

isolated from blood (23), urine (24), pus swab (28) and one aspirate, from tertiary

hospital in Mwanza, Tanzania. These isolates analyzed for carbapenem resistance

genes. For each isolate, five different PCR assays were performed, allowing for the

detection of the major carbapenemase genes, including those encoding the VIM and

NDM-type metallo-beta-lactamases, the class A KPC-type carbapenemases, and the

class D OXA-48 enzyme. Of 68 isolates, 20 (29%) were positive for one or more

carbapenemase gene. VIM-types were the most predominant gene followed by OXA-

48, KPC and NDM in 11 (16%), 4 (5%) , 3 (4%) and 2 (3%) isolates, respectively(101).

In the study in Turkey by Koksal et al., 2016. Between January 2012 and October

2015, a total of 100 CPK isolates were isolated from blood culture samples of

hospitalized patients with bacteremia in intensive care units. The detection of

carbapenemase genes was performed by real-time PCR using (Sacace Biotechnologie,

Italie). All isolates were phenotypically positive for carbapenemase activity. The

carbapenemase gene blaOXA-48 was detected in 43% of isolates and blaVIM in 5%.

One isolate harbored a combination of blaOXA-48 and blaVIM. None of the isolates

harbored blaNDM or blaKPC (102).

Study done by Atef Shibl et al., in 2013, was carried out in Riyadh, Saudi Arabia, A

total of 60 K.pneumoniae isolates were identifie and studied. The majority of these

were from patients in the intensive care unit (ICU; n = 45), while others were from

patients on the surgical and medical wards. Specimen sources were blood (n = 9),

rectal swabs (n = 16), sputum (n = 13), urine (n = 11), wound (n = 9), and suction

swab (n = 2). All isolates were confirmed to be carbapenemase producers by modified

Hodge test. The carbapenemase gene blaOXA-48 was detected in 47 (78%) isolates,

blaNDM-1 in 12 (20%), and blaVIM in one (1.6%). No isolate harbored a

combination of blaNDM-1 and blaOXA-48. None of the isolates harbored or blaKPC(103).

At 2013 a study by Rojas et al., they isolated the first Klebsiella pneumonia

coharboring KPC and VIM genes in Colombia from a 74 -year-old woman presented

to the emergency department after acute onset of an ischemic stroke. The isolate non

susceptible to ciprofloxacin, amikacin, β-lactams/β-lactamase inhibitors, expanded-

spectrum cephalosporins, imipenem, and ertapenem but susceptible to meropenem,

tigecycline, and polymyxin B. the woman died after 76 days of hospitalization (104).

17

At 2017 in Italy, Giancarlo et al., they were collected 22 strains of Klebsiella

pneumoniae Isolated from Intensive Care Unit Patients with Respiratory Tract

Infections, among the isolates 73% (n=16) were classified as intermediate for

imipenem, and 18% (n=4) classified as resistant to imipenem, while the majority

(n=20, 91%) of isolates resulted sensitive to meropenem, and only the 9% (n=2) was

classified as resistant. The carbapenemases genes were detected by PCR. The

blaVIM gene encoding class B carbapenemase was detected in 90.9% of isolates. The

blaVIM gene was detected in all cultures except cultures two strains, which showed

an intermediate profile to imipenem, and were both sensitive to meropenem. In

addition to VIM, no isolate harbored the blaKPC, blaOXA-48 and blaNDM-1(105).

Sakarikou et al., 2017 at their study on 55 consecutive non-replicated clinical strains

of Klebsiella pneumoniae isolated from blood culture in two hospitals of Rome, Italy.

Only Of the 55 isolates investigated, 40 were found to be carbapenemase-producing

strains and 15 noncarbapenemase- producing strains. Carbapenemase genes expressed

as 31 (77%) isolates harbor KPC gene , 5 (12%) isolates contain both KPC and VIM

genes and 4 (10%) isolates contain OXA-48 gene. NDM gene were absent in all

isolates (106).

Research at 2017 by Dalia and Doaa , they were collected 42 K. pneumoniae

carbapenem resistant out of 125 K.pneumoniae isolated from intensive care units of

Mansoura University hospitals, Egypt from different clinical sample, respiratory

samples (62%) was the predominant source of CRKP, followed by urine (14%),

wound (9.5%), blood (9.5%), and catheter tip (5%) samples. The isolates were

nonsusceptible (intermediate and resistant) to ertapenem. 25.6% and 20% were

nonsusceptible to meropenem and imipenem respectively. Phenotypic tests For

Carbapenamase activity was detected in 26/42 (61.9%) by MHT method, Prevalence

and distribution of carbapenemase genes based on the PCR assays , 39/42 of the

CRKP isolates were positive, the most prevalent gene was blaKPC 47.8% (22/42)

followed by blaVIM-1 21.7% (10/42), blaIMP 15.2% (7/42), blaOXA-48-like 10.9%

(5/42) and blaNDM-1 4.3%(2/42) (107).

Mohammad et al., 2015. They were collected 79 strains of K.pneumoniae from

different wards in the Suez Canal University Hospitals, Egypt. The sources of the

isolates were: urine (35%), pus (29%), blood (20.5%), and sputa (15%). Carbapenem

resistance was detected in 35 strains (44.3%) by agar disk diffusion screening and

confirmed by Modified Hodge test (108).

18

Maryam et al., 2017. They were isolate 34 non-duplicated K.pneumoniae strains

from Urine sample of patients admitted to Prince Sultan Military Medical City in

Riyadh, KSA. Carbapenem resistance was detected in 23 strains (67%) by Modified

Hodge test. PCR results indicated that 25 (73.5%) out of 34 isolates were positive for

carbapenem resistance determine genes. OXA-48 gene was the most frequent where it

was detected in 22 (65%) isolates, followed by NDM in 2 (5%) isolates ,VIM was

detected only in one isolate of K. pneumoniae (2.9%). While KPC gene were not

detected in any of the tested isolates (109).

Anika et al., at 2016, their study started by collected 121 Strains of K. pneumoniae

isolated from different clinical samples of patients treated in 14 hospitals in Serbia,

phenotypically these strains resistant to at least one carbapenem (imipenem,

meropenem or ertapenem). Carbapenemase genes were detected in 45 (37%) isolates.

Gene blaNDM was found in 33 (27.3%) K. pneumoniae, blaOXA-48 in 10 (8.3%),

blaKPC in 1 (0.8%), and 7 (5.4%) strains harbored both blaOXA-48 and blaNDM(110).

Amin et al., 2017 in Jordan, 296 strains of K. pneumoniae were isolated from

clinical specimens (bloodculture, urine, Body fluids, wound, tissue and sputum) taken

from 296 patients attending Islamic Hospital in Amman. Seven of the 296 K.

pneumoniae (2.8%) were carbapenemase producers (CPK). PCR amplification of the

carbapenemase genes revealed that two of the seven CPK harbored a blaNDM gene

and five harbored a blaOXA-48-like gene . All isolates were negative for blaVIM,

and blaKPC. All seven isolates were susceptible to tigecycline and colistin (111).

In the 2012, Barguigua et al., they were reported the constitutes of first identification

of the coexistence of blaNDM-1, blaVIM-1 and blaOXA-48 genes in a K.

pneumoniae strain (Kpp474) in Morocco isolated from the urine sample recovered

from an elderly male (49 years) non-hospitalized patient in Taza (northern Morocco).

He had previously received broadspectrum cephalosporins and fluoroquinolones for

recurrent urinary tract infections; the treatment was changed to amikacin and the

patient recovered (112).

In the 2015, Abdullah and Mehmet were reported the First Klebsiella pneumoniae

Isolate Co-Producing OXA-48 and NDM-1 in Turkey which was obtained from a

patient who was transferred from Sanliurfa (on the border between Syria and Ankara)(113).

19

In the 2010, Meletis et al., reported A Klebsiella pneumoniae clinical isolate resistant

to imipenem was recovered from a wound sample. At Hippokratio General Hospital,

The ssaloniki, Greece. The patient, a 57-year-old man, underwent a surgical resection

of small bowel and sigmoid colon and was treated with multiple courses of

antimicrobials. PCR analysis revealed that the clinical isolate was carrying

simultaneously blaVIM-1, blaKPC-2, blaSHV and blaTEM genes. The concomitant

presence of these genes is alarming and poses therapeutic as well as infection control

problems (114).

In the 2013, Ben Nasr et al., isolated the first Klebsiella pneumoniae co harbor

NDM-1 in association with OXA-48 in from Tunisia , a country where OXA-48

producers are already endemic as in Turkey (115).

In the 2012, Christine et al., their study in the Asia-Pacific region, the SMART

(Study for Monitoring Antimicrobial Resistance Trends) global surveillance program

found that between 2008 and 2009, 42.7% of 110 CR-KP strains produced class A,

23.6% produced class B, and 11.8% produced class D carbapenemases (116).

1.2. Rationale :

Carbapenems recently represent the drugs of choice for treatment of serious

infections caused by multidrug-resistant (MDR) strains of Enterobacteriaceae

producing extended-spectrum b-lactamases (ESBLs). Currently, however, the

emergence of carbapenem resistance intermediated by the production of acquired

carbapenemases has been remarkably mentioned among Enterobacteriaceae and is a

case of major clinical concern (71). In spite of K. pneumoniae own only moderate

amounts of chromosomal penicillinases, it is a well-known “collector” of multidrug

resistance plasmids that commonly mediated resistance to aminoglycosides, until the

end of 1980s, while, later, encoding extended-spectrum β-lactamases (ESBLs), mostly

Temoniera (TEMs) and Sulfhydryl variable (SHVs) active against last generation

cephalosporins, as well as a variety of genes giving resistance to drugs other than β-

lactams (116). The possession of these plasmids and the occurrence of chromosomal

mutations that offer resistance to fluoroquinolones often make the treatment of K.

pneumoniae healthcare-associated infections possible only by using carbapenems as

“last-line of defense” antibiotics (117). Unfortunately, from the early 2000s, multidrug-

resistant (MDR) K.pneumoniae strains began to produce also “carbapenemases”

20

carried by transmissible plasmids and rapidly disseminated within both acute hospitals

and long-term care facilities. Later, other enterobacterial species, including E.coli,

came to have carbapenemase genes, thus suggesting that K.pneumoniae may have

acted as a pool of β-lactamases (118).

Among three different mechanisms of resistance the enzyme production is of special

importance. In this matter, only one small gene is enough to express carbapenem

resistance. The carbapenemase genes are often located in integrons, which carry

multiplicity of arrays of variants gene cassettes and just one transfer event is enough

to disseminate multidrug resistance. Moreover, carbapenemase genes are often

located within Mobile Genetic Elements. For these reasons carbapenemases are the

most epidemiologically importance. Early detection and identification of

carbapenemase producers among clinical isolates can help to avoid hospitals acquired

infections. Because of the proliferation of new members of established

carbapenemase families, it is even more important to try to understand the

characteristics of these enzymes, with all their strengths and limitations. Several

excellent carbapenemase researches have appeared recently, containing detailed

compilations of the kinetic properties of these enzymes (75). But in Sudan the

information is poor , therefore, this study focuses on updated information on the

epidemiological and biochemical characteristics of both metallo- and serine

carbapenemases. Add to that Monitoring this organism’s molecular antimicrobial

pattern will give an evidence to make the essential environmental and therapeutical

measures to make it safe for hospitalized patients not to contract nosocomial

infections. Actually, the most important determinant in the successful control of

infections in patients in the ICU is prompt institution of effective experimental

antimicrobial therapy; inappropriate empirical therapy affects both patient mortality

rates and patient time spent in the ICU. Optimizing empirical therapy requires

knowledge of likely antimicrobial resistance patterns (119).

21

1.4. Objectives:

1.4.1. General Objective:

To determine antimicrobial molecular patterns of carbapenemase producing

Klebsiella pneumoniae using of blaOXA-48, blaKPC, blaVIM and blaNDM genes

between May, 2015 and January, 2017 in Khartoum state, Sudan.

1.4.2. Specific Objectives:

To isolate Klebsiella pneumoniae from hospitalized patients that admitted to

the hospitals in Khartoum suffering from different type of diseases .

To determine of the antibiotic sensitivity Patterns of Klebsiella pneumoniae.

To identify if there any mutation by sequencing of few samples (PCR

products).

22

2. MATERIALS AND METHODS

2.1. Study design

This was a cross-sectional laboratory based study involving 96 clinical isolates of

K.pneumoniae carbapenem resistant collected between May, 2015 and January, 2017

from clinical specimens in different hospitals in Khartoum, Sudan.

2.2. Study area

This study was carried out in four Hospitals at Khartoum State (National Ribat

University Teaching Hospital, Royal Care International Hospital, Dar Alaelaj

Hospital and Alzytona Hospital) one at Omdurman city (Military hospital) and one at

Bahree city (Sharg alneal Hospital).

2.3. Sample size and sampling technique

Samples had been taken from admitted patients are collected depending on the site

and type of infection. The estimated number of sample size will be 100 K.

pneumoniae carbapenem resistant.

2.4. Inclusion criteria

All isolates from different types of samples that identified as K.pneumoniae by

conventional Biochemical methods and show resistance to Meropenem disc of

Carbapenem family , at the period of this study were included in this study.

2.5. Exclusion criteria

Isolates other than K.pneumoniae or K.pneumoniae that show susceptibility to

Meropenem disk from Carbapenem family were excluded from this study.

2.6. Ethical consideration

Ethical clearance for this study was obtained from microbiology section of above

mentioned Hospitals which allow using their isolates.

2.7. Data collection and analysis

A questionnaire (information about isolates includes type of sample and patient age )

was designed and used in the study (Appendix 1). Then data were recorded and

analyzed. The collected data was analyzed using statistical package for social science

(SPSS) version 24, Chi square test was used, a p-value of <0.05 was considered

significant.

23

2.8. Study protocols

2.8.1. Bacterial isolates

A total of 315 K.pneumoniae isolates were obtained from culturing of different

clinical samples (n =315; urine = 171, wound swab = 47, CSF = 5, Blood = 10,

sputum = 67, stool=4, vaginal swab= 7, Seminal fluid= 3 and peritoneal fluid =1). Out

of these 96 Klebsiella pneumoniae were show resistant to carbapenem, beside K.

pneumoniae (ATCC 700603) was used as quality controls.

2.8.2. Identification of isolated Bacteria

2.8.2.1. Colonial morphology

Bacterial colonies were examined for shape which appeared smooth shiny and

mucoid due to existent of capsule. The color of the colonies was also observed which

depend on the indicator contained in the media (appendix 2) (120).

2.8.2.2. Gram stain

A well prepared dried fixed smear was covered with crystal violet stain for 30-60

seconds. The stain was washed off rapidly with clean water. All the water was wipped

off and the smear was covered with lugol’s iodine for 30-60 seconds. The iodine was

washed off with clear tap water and decolorized rapidly (few seconds) with acetone

alcohol and washed immediately with clean water. Then smear was covered with

neutral red stain for 2 minutes and washed off with clean tap water. The dried smear

was examined microscopically, first with the ×40 objective to check the staining and

then with the oil immersion objective to report the bacteria (120).

2.8.2.3. Biochemical identification

Biochemical tests were carried out according to (120).which will show after incubation

24 hours aerobically negative indole test (yellow ring on the surface of broth

medium), positive urease test (pink color in medium) and positive citrate test (blue

color in medium) . And the tube of KIA medium will show yellow color on whole

medium (slope & Butt) result from lactose fermentation and cracking in medium due

to gas production.

2.8.2.4. Chromogenic agar media

Chromogenic agar media (Liofilchem Co. Italy) was used for isolation and

identification of bacterial isolates. Chromogenic agar medium was prepared

(Appendix3) and mixed well then dispensed aseptically in sterile Petri dishes, after

24

the surface of culture media have been dried, by using of sterilized wire loop a small

area (the well) of the plate have been inoculated, after that well streaked out three

times by a sterile wire loop, then the plates were incubated over night at 37° C. Then

the isolates were identified according to color produced on Chromogenic media,

which give Dark blue to purple colonies that indicated the isolated organism is

Klebsiella pneumoniae (Appendix4). Standard biochemical tests were used to confirm

isolates (121).

2.8.3. Antimicrobial Susceptibility Testing

All identified K. pneumoniae were tested for their antimicrobial susceptibilities by

disc diffusion technique according to the Clinical Laboratory Standards Institute

(CLSI) guidelines (122). The antibiotic discs were used: Meropenem (10μg)

(Bioanalysis Co. Italy).

2.8.3.1. Method of sensitivity test

Several colonies of tested organism were emulsified in small volume of sterile normal

saline to make a fine suspension. The turbidity of the suspension was matched against

0.5 McFarland standards (Appendix3). A sterile cotton swab was dipped into the

suspension and was rotated firmly several times against the upper side wall of the tube

to exclude the excess fluid. Then the entire agar surface of Mueller-Hinton agar

(Appendix III) plates were streaked three times, the plates were turn 60 degree

between streaking to obtain even inoculums. The lid of the plate was left away for 3-

5 min, to allow surface moisture to dry before applying the discs. By using sterile

forceps, under aseptic condition the antibiotic discs were applied into agar surface.

The discs were pressed down with a sterile needle or forceps to make contact with the

surface of media. The plates were incubated inverted in the incubator at 37°C for

overnight. The plates were examined for inhibition zones size. Escherchia coli strain

ATCC 25922 was used as control for evaluation the disk activity. All isolates for

which the zone diameter ≤ 18 mm for Meropenem disk were considered to have a

positive screening test for an carbapenem resistant (122).

2.8.4. Preservation of isolates

Several colonies from each isolates were emulsified in Eppendorff tubes contain in

brain heart infusion (BHI) broth with 20% glycerol and were frozen at -20°C at the

Microbiology Laboratory of National Ribat University.

25

2.9. Phenotypic Detection of Carbapenemase

2.9.1. Modified Hodge Test (MHT)

Carbapenem resistant strains were subjected to MHT for phenotypic detection of

Carbapenemase production. This test was performed as recommended by the Clinical

and Laboratory Standards Institute (CLSI) guidelines, 2012 (123). The suspension of

ATCC E. coli 25922 was prepared in comparison to 0.5 McFarland standard in 5mL

of sterile saline using the direct colony suspension.

2.9.1.1. Procedure of MHT

A 4.5mL of sterile saline was pipette out into a sterile tube. Then 0.5mL of the ATCC

E.coli 25922 suspension was added to make a 1:10 dilution. This was inoculated on a

Mueller Hinton agar plate, as for the routine disk diffusion testing. The plate was

dried for 5 minutes and a disk of Meropenem (10 g) was placed in the centre of the

agar plate. Using a swab; 3-5 colonies of the test organism were picked and were

inoculated in a straight line, from the edge of the disk, up to a distance of at least

20mm. The plates were incubated at 37° C overnight and they were examined next

day.

2.9.1.2. Reading and interpretation of MHT results

They were checked for an enhanced growth around the test organism streak at the

intersection of the streak and the zone of inhibition. The presence of an enhanced

growth of E. coli indicated Carbapenemase production by the tested organism that

inactivated Meropenem which was no longer sufficient to inhibit E.coli and an

indentation of the zone was noted and detected by the presence of a distorted or

cloverleaf shaped inhibition zone which was interpreted as positive for

carbapenemase producing isolates (123) (Appendix 5).

2.9.2. Carba Nordmann Poirel Test Direct (CNPt-direct)

Biochemical tests based on the detection of β-lactam ring hydrolysis have been

developed for the early identification of carbapenemases in Enterobacteriaceae and P.

aeruginosa. This biochemical test, applicable to isolated bacterial colonies, is based

on in vitro hydrolysis of the carbapenem. Hydrolysis acidifies the medium, changing

the color of the pH indicator (Bromothymol blue). The color change is visible to the

naked eye ; no reading device is required. No color change within 2 hours indicates

absence of carbapenemase-producing activity (54).

26

2.9.2.1. Procedure of Carba Nordmann Poirel Test Direct

A full 2-µl loop of a pure bacterial culture recovered from Mueller-Hinton agar was

directly suspended in ELISA micro titer plate 96 well, each well contain 200 µl of

Urea broth medium , supplemented with 6 mg/ml Meropenem (reaction tube) or

without antibiotic (control tube). Tubes were gentle mixed during 5 to 10 s. Finally,

regardless of the protocol used, the plate were incubated at 35°C and monitored

throughout 2 h.

2.9.2.2. Reading and interpretation of CNPt-direct results

indicator was added after the end of reaction a yellow color indicated acidic pH which

result from hydrolysis of substrate which means carbapenemase production (positive

test) , no change in color indicate a negative test (Appendix 6) .

2.10. Molecular detection of carbapenemase genes

Molecular techniques, primarily based on PCR, has been the reference standard for

the identification and differentiation of carbapenem resistance genes depended on the

excellent specificity, sensitivity, accuracy and rapidity of these methods. If

identification of a carbapenemase is required for epidemiological purposes, then the

PCR products are subjected to additional sequencing. These techniques generate

results within 4-6 h, or even less as for these study because we used real-time PCR

technique.

2.10.1. DNA Extraction

DNA was isolated from bacterial colonies using the boiling lysis method. Strains were

streaked onto Nutrient agar (Himedia, India) and grown overnight at 37°C. A loopful

of bacterial growth was suspended in 400 μl of sterile distilled water, incubated at

room temperature for 5min, and then boiled for 10 min. After centrifugation at 13200

rpm for 10 min, the pellet was discarded and the supernatant containing DNA was

checked by gel electrophoresis and then use for PCR or stored at -20°C (125).

2.10.2. Polymerase chain reaction (PCR)

2.10.2.1. Primers (Macrogen company, Seoul: Korea)

PCR amplification was performed using published primer pairs (101), which are as

shown, in (Table 2:1).

27

Table (2:1). Primer sets for amplification of carbapenem resistance determine

genes.

Gene name Primer sequence (5/→ 3/) TM(°C)* Amplicons

size (bp)

bla-VIM Forward: GATGGTGTTTGGTCGCATA

Reverse: CGAATGCGCAGCACCAG

54.5

57.6

390

bla-KPC Forward: CATTCAAGGGCTTTCTTGCTGC

Reverse: ACGACGGCATAGTCATTTGC

60.3

57.3

498

bla-NDM Forward: GGTTTGGCGATCTGGTTTTC

Reverse: CGGAATGGCTCATCACGATC

57.3

59.4

521

bla-OXA-48 Forward: GCTTGATCGCCCTCGATT

Reverse: GATTTGCTCCGTGGCCGAAA

56.0

59.4

238

*TM: melting temperature of the primer.

2.10.2.2. Preparation of primers

For 100 pmol/ml from each primer we dissolved them in DW as instructed by

manufacture, then for 10 pmol/ml we dissolved 10 μl of each primer in 90 μl DW.

2.10.2.3. Preparation of agarose gel

Amount of .5 mg of agarose powder were dissolved in 25 ml 1X TE buffer and heated

until became clear. Then the mixture was cooled to 55°C. 2.5 μl of (20mg/ml)

ethidium bromide were added, mixed well and poured in a casting tray, any bubbles

were removed and left to solidify at room temperature.

2.10.2.4. Preparation of reaction mixture

The following reagents were used for each gene in the following volumes (total

reaction volume was 20 μl) in 0.2 ml PCR tube;

5.5 μl deionized sterile water.

10 μl Master mix (iNtRON, Biotechnology, Korea) (Appendix IV)

1 μl forward primer (Macrogen Company ,Seoul, Korea).

1 μl reverse primer (Macrogen Company ,Seoul, Korea).

2.5 μl DNA (template DNA).

28

2.10.2.1. Real-Time PCR (Sacace Biotechnologie, Italy).

Investigations were performed using amplification mixture RealMODTM Green qRT-

PCR mix (iNtRON,Biotechnology). The best results of amplification were obtained

with: activation of thermostable hot-start DNA polymerase for 10 min at 94°C,

followed by 40 cycles comprising: denaturation (30 s at 94°C), primers annealing (45

s at 52°C) and strand elongation (50 s at 72°C). After the end of cycling, material was

cooled down to 40°C for 60 s. Fluorescence levels were measured at wavelengths:

530 nm (FAM dye) and 610 nm (LC-Red 610 dye).

2.10.2.2. Interpretation of results

A sample was considered positive by RT-PCR if it crossed the threshold before a

crossing point (Cp ) of 35 cycle and negative if the Cp was greater than 35. Positive

result at wavelength 530 nm (FAM dye) stated the presence of bla OXA-48 or bla

NDM, whereas positive result at wavelength 610 nm (LC-Red 610 dye) meant the

presence of bla VIM or bla KPC.

2.10.3. DNA Sequencing

DNA sequencing was performed for 8 PCR products two products for each gene (2 KPC, 2

VIM, 2NDM and 2 OXA-48). standard sequencing was performed for both strands of ESBLs

genes by Macrogen Company (Seoul, Korea).

2.11. Bioinformatics analysis

2.11.1. Sequences (Similarity and Alignment)

Actually before uploading the sequences to NCBI we were proof read the nucleotides

chromatogram to ensure that all ambiguous sites are correctly called and determined

the overall quality of it. Then nucleotides sequences of the Carbapenemase genes

achieved were searched for sequence similarity using nucleotide BLAST (126) (http:

//blast.ncbi.nlm.nih.gov/Blast.cgi). Highly similar sequences were retrieved from

NCBI and subjected to multiple sequence alignment using the BioEdit software (127).

In Gene MarkS version 4.25 (http://exon.gatech.edu/genemark/genemarks.cgi), the

gene sequences were translated into amino acid sequence (128). Sequences similarities

were searched with BLASTp (http://blast.ncbi.nlm.nih.gov/Blast.cgiCMD

=Web&PAGE_TYPEBlastDocs), highly similar sequences were achieved from NCBI

and subjected to multiple sequence alignment and evolutionary analysis using BioEdit

software.

29

2.11.2. Phylogenetic tree of NDM, VIM and OXA-48 carbapenemase

genes

Phylogenetic tree of Carbapenrmase genes and their evolutionary relationship with

those obtained from NCBI database was performed online by Clustal W2

http://www.ebi.ac.uk/Tools/msa/clustalw2/) (129).

2.12. Nucleotide sequence accession numbers

The nucleotide sequences of novel blaNDM reported in this study will appear under

GenBank nucleotide accession number MF197908. The nucleotide sequence of

blaVIM reported here will appear under GenBank nucleotide accession number

MF197911. The nucleotide sequence of blaOXA-48 reported here will appear under

GenBank nucleotide accession numbers MF197909 and MF197910.

30

3. Results

3.1. Patients and isolates characteristics

In the present study, 315 Klebsiella pneumoniae isolates were collected. The enrolled

organisms were isolated from different types of sample from both gender males 53%

(168/315) on the other side 46.5% (147/315) which were all females of different ages

(range from 9 years to 81) . The highest number of patients belonged to the age group

61-90 years old and the lowest number of patients belonged to the group of 0-20 years

old patients and this difference due to collection (table 3:1).

Table (3:1): Distribution of enrolled patients according to age groups

Age group/ years Male Female Total / %

0------20 20 10 30 (9.5%)

21----40 36 48 84 (26.6%)

41----60 44 40 84 (26.6%)

61----81 68 49 117 (37.3%)

Total 168 (53.5%) 147(46.5%) 315 (100%)

3.2. Antimicrobial Susceptibility Testing

315 clinical isolates were categorized according to the susceptibility of Meropenem.

96 (30.5%) isolates were resistant to Meropenem (zones of 21 mm or less) and 219

(69.5%) isolates were susceptible to carbapenems (zones of ≥22 mm ) (Appendix (7)

and (8)).

3.3. Prevalence of carbapenemase activity based on phenotypic tests

3.3.1. Result of Modified Hodge Test (MHT):

Of the total 96 carbapenem resistant isolates, MHT identified 63 (65.5%) isolates as

carbapenemase producers by developing cloverleaf shaped inhibition zone while 33

(34.4%) isolates were negative due to absent of cloverleaf shape.

31

3.3.2. Result of Carba Nordmann Poirel Test-Direct:

The same result obtain by MHT MHT identified 63 (65.5%) isolates as

carbapenemase producers by developing cloverleaf shaped inhibition zone while 33

(34.4%) isolates were negative test indicated by the color of indicator changes from

green to yellow indicating of acid production after destruction of substrate

(carbapenem) by the enzyme.

3.4. Genotypic detection of crbapenemase genes using polymerase

chain reaction (PCR):

Polymerase Chain Reaction (PCR) was performed for isolates that show resistant

against carbapenem antibiotic to detect crbapenemase genes (blaKPC, blaNDM,

blaVIM and blaOXA-48). Seventy two percent (70/96) were positive for carbapenemase

genes; (59.4% (57/96) were positive for KPC genes, 57.3% (55/96) were positive for

NDM genes, 37.5% (36/96) were positive for VIM genes and 35.4% (34/96) were

positive for OXA-48 genes) while the remnant 26 isolates were free from these used

genes table (3:2).

Table (3:2). Frequencies of Genes (blaKPC, blaNDM, blaVIM and blaOXA-48 )

GeneFrequency (%)

Total

Positive Negative

blaKPC 57 (59.4%) 39 (39.6%) 96 (100%)

blaNDM 55 (57.3%) 41 (42.7%) 96 (100%)

blaVIM 36 (37.5%) 60 (62.5%) 96 (100%)

blaOXA-48 34 (35.5%) 62 (64.5%) 96 (100%)

3.5. Frequency and distribution of genes among isolated organisms:

Seventy two percent (70/96) isolates were positive for carbapenemase genes; 59.4%

(57/96) were positive for blaKPC genes, 57.3% (55/96) were positive for blaNDM genes,

37.5% (36/96) were positive for blaVIM genes and 35.4% (34/96) were positive for

blaOXA-48 genes. Nineteen isolates possessed four genes (blaKPC, blaNDM, blaVIM and

32

blaOXA-48) , fourteen isolates possessed three genes{(blaNDM, blaVIM and blaOXA-48=6),

(blaKPC, blaNDM, and blaOXA-48=3), (blaKPC, blaNDM and blaVIM =3), (blaKPC, blaVIM and

blaOXA-48=2)}, twenty seven isolates possessed two genes{(blaKPC and blaNDM =21),

(blaKPC, blaOXA-48 =2), (blaNDM and blaVIM =3), (blaNDM and blaOXA-48 =1)}, ten

isolates possessed only one gene (blaKPC=8, blaOXA-48=1 and blaVIM =1) and the

remaining twenty six isolates free from these genes table(3:3).

Table (3:3): frequency and distributed of Genes out of Isolated K.pneumoniae

No of Genes

detected

Type of Genes No of isolated

organism

Percentage

%

4 Genes KPC+NDM+VIM+OXA-

48

19 19/96 (19.7%)

3Genes

NDM+VIM+OXA-48 6

14/96 (14.5%)KPC+NDM+OXA-48 3

KPC+NDM+VIM 3

KPC+VIM+OXA-48 2

2 Genes

KPC+NDM 21

27/96 (28.1%)

KPC+OXA-48 2

VIM+NDM 3

NDM+OXA-48 1

1 Genes

KPC 8

10/96 (10.4%)VIM 1

OXA-48 1

No Gene -------- 26 26/96 (27.3%)

3.6. Correlation between phenotypic and genotypic results of

carbapenemase production:

Out of 63 positive isolates by phenotypic methods (MHT&Carba NP tests) , only 37

isolates were positive for KPC gene, 36 isolates were positive for NDM gene, 26

33

isolates were positive for VIM gene and 25 isolates were positive for OXA-48 gene

by PCR table (3:4 ).

Table (3:4): Genotypic detection crosstab phenotypic detection (MHT&C-NP)

Genotypic detection KPC NDM VIM OXA-48

Crosstab positive negative Positive negative positive negative positive negative

Phenotypic

(MHT&C-

NP)

positive 37 26 36 27 26 37 25 38

negative 20 13 19 14 10 23 9 24

Total 57 39 55 41 36 60 34 62

P.Value 1.000 1.000 0.376 0.267

3.7. DNA Sequencing

DNA sequencing was performed for eight PCR products, 2 products to each gene (2

KPC genes, 2 NDM genes, 2 VIM genes and 2 OXA-48 genes) . The successful

sequences were submitted to NCBI database (http://www.ncbi.nlm.nih.gov/) and all

accession numbers are shown in Table (9). The Phylogenetic tree of isolates is shown

in (Figure 3:3).

3.7.1. KPC genes

DNA sequencing was performed for 2 PCR products which were positive for KPC

gene, the two sequences showed no significant alignment with BLAST.

3.7.2. NDM gene

DNA sequencing was performed for 2 PCR products which were positive for NDM

gene (550 bp); isolate with code number 308 showed no significant alignment with

BLAST. The other one isolate with code number 336 (MF197908) When aligned in

BLAST, 17 isolates produced a significant alignment (100%) to NDM carbapenemase

of K. pneumoniae gb|KX218441.1 and gb|KY446367.1 (Figure 3:3).

34

3.7.3. VIM gene

DNA sequencing was performed for 2 PCR products which were positive for VIM

genes (390 bp). Isolate with code number 332 sequences showed no significant

alignment with BLAST. Other one isolate with code number 301 (MF197911)

showed 100% identity with VIM (gb|NG050370.1) and VIM-1 (gb|KT124311.1)

(Figure 3:3).

3.7.4. OXA-48 gene

DNA sequencing was performed for 2 PCR products which were positive for OXA-

48 genes (238 bp). Two isolates showed 100% identity. These were isolate with code

number 361 with OXA-48 (gb|NG049762.1), and isolate with code number 344 with

OXA-48 (gb|KY094977.1) (Figure 3:1).

Figure (3:1): Phylogenetic tree of NDM, VIM and OXA-48 carbapenemase genes

and other carbapenemase genes that obtained from NCBI database.

3.8. Novel genes detected

A number of new variants of class B metallo-betalactamases (e.g., VIM and NDM

metallo-betalactamases), and class D carbapenemases (e.g., OXA-48) are emerging

over time scale. And then they got the following abbreviation after had been accessed

on National Center for Biotechnology Information (NCBI):

Klebsiella pneumoniae strain Hakam1 beta-lactamase NDM (blaNDM) gene,

Klebsiella pneumoniae strain Hakam2 metallo-beta-lactamase VIM (blaVIM) gene,

Klebsiella pneumoniae strain Hakam3 carbapenemase OXA-48 (blaOXA-48) gene

and Klebsiella pneumoniae strain Hakam4 carbapenemase OXA-48 (blaOXA-48)

gene.

35

4. DISCUSSION

Carbapenem antibiotics are the last line for treatment of dramatic, life-threatening

infections caused by gram negative enteric bacteria with pandrug resistance. Hence,

an identifying of carbapenem resistance is necessary. The increasing of resistant

strains, as well as those with the ability to become resistant, completely different

from place to another (130).

Antimicrobial sensitivity tests have become basic tools in the determination of

many hospital outbreaks due to their easy usage. Therefore, these tests are

standardized and can be applied to many other factors. Thus, as for other phenotypic

methods, Antimicrobial sensitivity profiles are not ideal because they can be affected

by type of growth medium, phase of reproduction and estimate continuous

mutations. Wherefore, molecular techniques are more recommended to use globally(130).

K. pneumoniae among the most Enterobacteriaceae members is important causative

agent of nosocomial and community-onset infections of human beings (131).

Carbapenemases production by these organism is combined with treatment failures,

spreading, and increased mortality and morbidity rates (54). For these reasons, accurate

detection methods with rapidity, high sensitivity and specificity is required (84). The

fact detection of carbapenem resistance bacteria helps physicians not only to give the

proper antibacterial treatment but also to cease their dissemination. The introductory

screening for carbapenemase producers in clinical specimens is depend first on

phenotypic tests, and so the confirmation tests are mainly depend on molecular tests.

But, traditional phenotypic tests have some disbenefits such as time consuming,

interpretation is so difficult in some cases and less sensitivity and specificity among

different species (132).

The present study revealed that 96 multidrug-resistant strains resistant to routinely

used carbapenems were collected in duration one year and half from perevious

mentioned hospitals in Khartoum. K. pneumoniae was isolated mostly from urine and

less frequently from blood, wound secretion or swab and lower respiratory tract

secretions. Of the 96 carbapenem resistant isolates tested in the current study, 63

(65.5%) were phenotypicaly positive by Modified Hodge (MHT) Test, which agreed

with the result obtain by Dalia & Doaa 2017 in Egypt (61.9%) which investigate 125

36

isolate and Maryam et al., 2017 in KSA (67%) from 34 isolates, while the higher

results obtained by Sahin et al., 2015 in Turkey, wang et al., 2012 in China, koksal et

al., in Turkey 2016 and Shible et al., 2013 in KSA (85%, 91%, 100%, 100%)

respectively and lower result obtained from Mohamed et al., 2015 from Egypt (35%)(97, 100, 102, 103, 107, 108, 109).

Our results showed that Modified Hodge Test failed to detect 20 isolates of K.

pneumoniae which was positive for KPC gene, 19 isolates positive for NDM gene, 10

isolates positive for VIM gene as well as 9 isolates positive for OXA-48 gene by RT-

PCR As well, but were negative for MHT. The overall sensitivity and specificity of

the MHT were not so high which agreement with Doyle et al., 2012 in Canada &

USA found that the sensitivity and specificity for MHT was 58% and 93%,

respectively (132). MHT is less reliable to detect NDMs, VIMs, and IMPs producing

bacteria; however, it may be useful for detecting KPC and OXA-48 producers (132). At

the same time RT-PCR fail to detect 26 isolates of K.pneumoniae which was positive

by MHT while negative with KPC gene, 27 isolates negative with NDM gene, 37

isolates negative with VIM gene and 38 isolates negative with OXA-48 gene. The

same observation happened with Anika et al., 2016 in Serbia (110) After performing

phenotypic testing 46 strains which was suspected for carbapenemase production and

actually only 41 carried tested carbapenemase genes (blaKPC, blaNDM, blaVIM,

blaIMP, blaOXA-48). Positive phenotypic test in 5 isolates that tested negative for

carbapenemase genes, their justification indicated the presence of metallo-beta

lactamase we add to that two possibilities exist that may explain these MHT-positive

while PCR-negative isolates. First, as reported by Schechner et al., 2013 in (133). PCR

could be falsely negative due to inhibitory substances in the reaction, secondly due to

technical inexperience of the laboratory workers . However, the most probable reason

could be the existence of other carbapenemases genes not used in this studies such as

the ESBL and the member of the Serratia marcescens (SME) family of carbapenem-

hydrolyzing beta-lactamases, SME-1, which can give a positive result for MHT but

negative for RT-PCR. However new CLSI recommendations lowered the breakpoints

of carbapenems and removed the requirement for testing for carbapenemase (e.g.

MHT) to determine susceptibility, performing MHT as an adjunct to PCR may

increase the likelihood of detecting other carbapenemases. Furthermore, the current

recommendations is to still to perform MHT for infection control and epidemiological

purposes.

37

In this study, we did a rapid, sensitive, and specific real-time-PCR assay for the

detection of four carbapenemase genes (blaKPC, blaNDM, blaVIM and blaOXA-48).This assay

can be performed in less than 4 hours, which will reduce the chance of spreading the

organism in the hospital. The RT-PCR assay specificity and sensitivity were 100 %

compared to phenotypic detection assessed by MHT and sequencing. We identified

these genes by melting curves analysis of the amplification product using SYBR

Green dye with many advantages like low-cost and easy to use. The Tm value of the

each gene was detected.

As matter of fact This study showed that The most prevalent gene among the 96

CRKP isolates genes was blaKPC at 59.4% which agreed with what was seen in a

previous study in Egypt by Dalia & Doaa, 2017 (47.8%), in Italy by Sakarikou et al.,

2017 (77%) and in study from china by Wang et al., 2012 (91%)(100, 106, 107) while

differ from previous study which revealed this gene as less detected as from Tanzania

by Martha et al., 2014 (4%) from Serbia by Anika et al., 2016 (.8%)(101, 110) or

completely absent as from Turkey four studies (Abdellah et al., 2015 ; Sahin et al.,

2015; Karaby et al., 2016; Koksal et al., 2016)(97, 98, 102, 113), KSA two researches

(Shible et al., 2013; Maryam et al., 2017)(103, 109), from Jordan ,Morocco, Arabian

peninsula, Tunisia, Grees and from Italy by Giancarlo (99, 105, 111, 112, 114, 115 ).

As for the second gene this study reported the bla NDM gene is the second more

predominant gene (57.3%) which agree with previous study from Jordan by Amin et

al., 2017 (1%) (111) and two studies from KSA by Shible et al., 2013, and Maryam et

al., 2017 with (20%) and (5%) respectively (103, 109).

However, another studies reported that the NDM gene is the most detected gene as

from Turkey by two studies in Turkey by Karaby et al., 2016 and Karaaslan et al.,

2015 in (100% : 10%) respectively , Arabian peninsula by Sonnevend et al., 2015.

(53,8%) and from Serbia by Anika et al., 2016 (27.3%) ( 96, 98, 99, 110) at the same time

other studies reported this gene as less revealed such as Dalia & Doaa, 2017 from

Egypt (4.3%), Sahin et al., 2015, from turkey (2%) and Martha et al., 2014 from

Tanzania (3%) ( 97, 101, 107) Or completely absent in studies from China (100) and two

researches from Italy (Giancarlo et al., 2017; Sakarikou et al., 2017) (105,106).

With regard to the VIM gene this study said it is the third most common gene by

existence of (37.5%) which agree with the two studies from KSA by Maryam et al.,

2017 and Shible et al., 2013 with percentage of (2.9% : 1.6%) respectively (103, 109).

However the studies by Sakarikou et al., 2017 from Italy, Dalia & Doaa, 2017 from

38

Egypt and Koksal et al, 2016 from Turkey found this gene as second existence gene

by ( 12% , 21.7% and 5%) respectively (102, 106, 107). At the same time our study

disagree with two studies which reported VIM gene as most common such as in

Tanzania by Martha et al., 2014 and Italy by Giancarlo et al., 2017 (16% and 91%)

respectively (101, 105) while the remaining studies which reviewed show absent of these

gene such as Sahin et al., 2015 in Turkey, Serbia, Jordan and Arabian peninsula (97, 99,

110, 111).

The class D carbapenemase gene OXA-48 was the less common detected one out of

genes used in this study (35.4%) and this result agreed with studies from Tanzania by

Martha et al., 2014, Italy by Sakarikou et al., 2017, Serbia by Anika et al., 2016 and

Egypt by Dalia & Doaa, 2017 (5%, 10% ,9% and 11%) respectively (101, 106, 107, 110)

while disagree with the other studies that consider OXA-48 gene as the most

dominant one like studies from Turkey by Sahin et al., 2015, another one from

Turkey by Koksal et al., 2016 another two studies from KSA by Shible et al., 2013

and Maryam et al., 2017, and Jordan by Amin et al., 2017 (16%, 43%, 78%, 65%

and 2%) respectively (97, 102, 103, 109, 111) While The studies from Turkey by Karaby et

al., 2016 (25%), Arabian peninsula by Sonnevend et al., 2015 (30%) and Serbia by

Anika et al., 2016 (8.3%) were reported this gene as second more common gene (98, 99,

110).

Dissemination of K. pneumoniae isolates harboring carbapenemase resistance genes

continues unrelieved. To our knowledge this is the first research in Sudan that

revealed Nineteen isolates (19.7%) possessed four genes (blaKPC, blaNDM, blaVIM and

blaOXA-48) and this is unique result out of all reviewed papers, fourteen isolates

possessed three genes (14.5%){(blaNDM, blaVIM and blaOXA-48=6), (blaKPC, blaNDM, and

blaOXA-48=3), (blaKPC, blaNDM and blaVIM =3), (blaKPC, blaVIM and blaOXA-48=2)} which

agree with one study from Morocco by Barguigua et al., 2013 (112) they reported the

first isolated carbapenemase producer K.pneumoniae from urine of elderly man that

coproducing three genes NDM-1, VIM-1 and OXA-48, twenty seven isolates

possessed two genes (28.1%){(blaKPC and blaNDM =21), (blaKPC and blaVIM =2),

(blaNDM and blaVIM =3), (blaNDM and blaOXA-48 =1)}these result agree with result from

Turkey by Koksal et al., 2016 (102) where they isolated on K.pneumoniae harbor

blaVIM and blaOXA-48, study from Colombia by Rojas et al, 2013 (104) their

K.pneumoniae carry blaKPC and blaVIM and the same result obtained by Sakarikou et

al., 2017 (106) in Italy their organism carry blaKPC and blaVIM too.

39

However, K. pneumoniae positive for both NDM and OXA-48 genes have been

reported in only four cases around the world. The first one K. pneumoniae that

coharbor NDM-1 and OXA-48 was isolated from an elderly male’s urine sample in

Morocco by Barguigua et al., 2013 (112). The second K.pneumoniae was detected in

Tunisia by Ben Nasr et al., 2013 (115), where studies showed that OXA-48 gene are

endemic same like Turkey. And the third K.pneumoniae identified in the screening

rectal swab of a patient converted from the intensive care unit of a hospital found in

Serbia to Bern University Hospital in Switzerland Anika et al., 2016 (110) The forth

one was reported in Arabian Peninsula which was obtained from a patient who was

transferred from Sanliurfa locality by Sonnevend et al., 2015 (on the border between

Syria and turkey) (99). However , in this study we were reported the fifth

K.pneumoniae isolate that coproduced the OXA-48 and NDM carbapenemases,

which was obtained from sputum sample of elderly male patient in Ribat Teaching

Hospital.

In the Asia-Pacific area, the Study for Monitoring Antimicrobial Resistance Trends

(SMART) global survey scheme by Christine et al., 2012 found that by phenotypic

study between 2008 and 2009, 42.7% of 110 CR-KP strains produced class A, 23.6%

produced class B, and 11.8% produced class D carbapenemases (116). The high

prevalence of Carbapenim resistant producing K.pneumoniae in the current study

could be due to the excessive use of carbapenems in our hospitals, and the improper

application of the infection control measures by the hospital quality control manegers

that simultaneously lead to multiple occurrence of horizontal spread of CR-KP

strains among patients. At the same time, the incidence of class B (MBL) was higher

(57% & 37.5%) than that of other classes; this can be justified by the theoretic

increase in the detection and disseminate of the mobilized families of metallo

enzyme which are located within a variety of integrons, increasing their mobilization

between different species and strains in the hospital (71). On the other hand, the

production of class A and class D enzymes in this study is reported with high rate

(59%, 35%). This can be justified by the situation of these enzymes where it exist on

plasmids in CR-KP strains.

By the way all the four genes used in this study were located on the plasmid.

In this study 26 isolate out of 96 isolates (27%) with resistant to Meropenem by

antimicrobial susceptibility testing exhibited no gene detection for all the four genes

(KPC, NDM, VIM and OXA-48) used in this research and this may be due to β-

40

lactamases enzymes that did not covered by this study or other mechanisms of

resistance such as efflux pumps or mutations that occure to PBPs or alter the

expression of porins on the cell wall. Of these mechanisms can cause high levels of

resistance to carbapenems in certain bacterial species, such as Klebsiella pneumoniae(52).

All isolates with carbapenemase genes were resistant to Meropenem, suggesting that

Meropenem susceptibility might be an indicator for carbapenemase production among

K. pneumoniae the same result obtained in Serbia by Anika et al., 2016 when they

were studied CRE especially K. pneumoniae and E. coli (110).

41

CONCLUSION & RECOMMENDATIONS

5.1. CONCLUSION

This study Demonstrate a high prevalence of carbapenem-resistance genes

among multidrug resistant K. pneumoniae, with KPC gene present as more

predominant one in Khartoum, Sudan.

Commonly described co-production of KPC, VIM, OXA-48 and NDM are

found in K. pneumoniae isolates. This situation can cause significant

morbidity and mortality due to increase resistant.

The real-time PCR assay described here provides a useful screening test to

detect Crbapenemase genes rapidly and accurately so this characteristics for

identification of this kind of resistance genes is the first step for rapid

treatment and facilitate control their spread.

Modified Hodge Test and Carba NP direct test are simple, costly cheep and

highly sensitive phenotypic techniques can be employed in any laboratory for

both screening and confirmation the presence carbapenemase enzymes.

Consequently ,this will further help in timely implementation of strict

infection control practices as well as clinical guidance regarding the potential

risks for therapeutic failure.

42

5.2. RECOMMENDATIONS

The research finding indicates the accumulations of carbapenemase genes in

K. pneumoniae isolated in Khartoum, for this alarming situation of the large

spread of Carbapenemase genes we suggest that future work to be performed

to determine the whole genome sequencing for these isolates to investigate is

there any mutation in this genes.

It is recommended that Dissemination of such organisms in community may

initiate future outbreak, which would be difficult to deal with the available set

of antibiotics. This requires healthcare facilities to be aware of the emergence

of these multidrug-resistant isolates.

The detection of carbapenemase using molecular technique while it is rapid

and sensitive but more expensive therefore it is of clinical importance that

laboratories prepare a simple and reliable phenotypic screening test to identify

promptly and accurately these organisms for both therapeutic considerations

and infection control purposes.

We recommend routine testing for carbapenem resistance among the MDR-

Klebsiella pneumoniae in our hospital and other health facilities in developing

countries. In addition, other antibiotics such as colistin and tigecycline should

be tested to provide alterative treatment to these isolates.

43

REFERENCES

1. Finch R. Innovation drugs and diagnostics. Journal of Antimicrobial

Chemotherapy.2007;60:79–82.

2. Demain A, and Sanchez S. Microbial drug discovery: 80 years of progress.

Journal of Antibiotics.2009; 62:5–16.

3. Deasy J. Antibiotic resistance: the ongoing challenge for effective drug

therapy. Journal of the American Academy of Physician Assistants.2009;

22:18–22.

4. Pray L. Antibiotic R&D: resolving the paradox between unmet medical need

and commercial incentive. Needham, MA, Cambridge Healthtech Institute

(Insight Pharma Reports) clinical Infectious Diseases. 2008; 55 (4):562–700.

5. ReAct – Action on Antibiotic Resistance (2007). Cure with care:

understanding antibiotic resistance. Uppsala, ReAct – Action on Antibiotic

Resistance, Uppsala University (http://

soapimg.icecube.snowfall.se/stopresistance/cure_with_care.pdf, accessed 26

April 2010).

6. European Parliament (2005). Antibiotic resistance. Brussels, European

Parliament, Policy Department, Economic and Scientific Policy. 31 October

2008).

7. Zaidi AK, Huskins WC, Thaver D, Bhutta ZA, Abbas Z, and Goldmann

DA. Hospital-acquired neonatal infections in developing countries.

Lancet.2005; 365:1175–1188.

8. Cosgrove S, and Carmeli S. The impact of antimicrobial resistance on

health and economic outcomes. Clinical Infectious Diseases. 2003;36:1433–

1437.

9. Levy S. The challenge of antibiotic resistance. Scientific American. 1998;

278:46–54.

10. Varaldo P E, Biavasco F, Mannelli S, Pompei R, and Proietti A.

Distribution and antibiotic susceptibility of extraintestinal clinical isolates of

Klebsiella, Enterobacter and Serratia species. Eur. J. Clin. Microbiol. Infect.

Dis. 1988;4: 495–500

11. Ryan K J, and Ray C G. Sherris Medical Microbiology (4th ed.). McGraw

Hill.2004; p. 370.

44

12. Brisse S, Grimont F, and Grimont P AD. Prokaryotes. New York, NY:

Springer New York. 2006; 159-196.

13. Ristuccia Patricia A, and Cunha Burke A. "Klebsiella". Topics in

Clinical Microbiology .1984; 5 (7): 343–348.

14. Podschun R, and Ullmann U. "Klebsiella spp. as nosocomial pathogens:

epidemiology, taxonomy, typing methods, and pathogenicity factors". Clin

Microbiol Rev . 1998; 11 (4): 589–603.

15. Lederman ER, and Crum NF. Pyogenic liver abscess with a focus on

Klebsiella pneumoniae as a primary pathogen: An emerging disease with

unique clinical characteristics. Am. J. Gastroenterol. 2005; 100: 322–331.

16. Fung CP, Chang FY, Lee SC, Hu BS, Kuo BI, Liu CY, Ho M, and Siu

LK A. global emerging disease of Klebsiella pneumoniae liver abscess: Is

serotype K1 an important factor for complicated endophthalmitis? Gut 2002;

50:420–424.

17. Laupland KB, Ross T, Pitout, JD, Church, DL, and Gregson DB.

Community-onset urinary tract infections: A population-based assessment.

Infection. 2007; 35, 150–153.

18. Yinnon AM, Butnaru A, Raveh D, Jerassy Z, and Rudensky B. Klebsiella

bacteremia: community versus nosocomial infection. Mon. J. Assoc.

Physicians 1996; 89: 933–941.

19. Niveditha S, Pramodhini S, Umadevi S, Kumar S, and Stephen S. The

isolation and the biofilm formation of uropathogens in the patients with

catheter associated urinary tract infections (UTIs). J. Clin. Diagn. Res. 2012;

6: 1478–1482.

20. Singhai M, Malik A, Shahid M, Malik MA, and Goyal R. A study on

device-related infections with special reference to biofilm production and

antibiotic resistance. J. Glob. Infect. Dis. 2012; 4: 193–198.

21. Lin MY, Lyles-Banks RD, Lolans K, Hines DW, Spear JB, Petrak R,

Trick WE, Weinstein RA, and Hayden MK, Centers for Disease Control

and Prevention Epicenters Program. The importance of long-term acute care

hospitals in the regional epidemiology of Klebsiella pneumoniae

carbapenemase-producing Enterobacteriaceae. Clin. Infect. Dis. 2013; 57:

1246–1252.

45

22. Orsi GB, Scorzolini L, Franchi C, Mondillo V, Rosa G, and Venditti M.

Hospital-acquired infection surveillance in a neurosurgical intensive care unit.

J. Hosp. Infect. 2006; 64: 23–29.

23. Ørskov I, and Fife-Asbury MA. New Klebsiella antigen K 82 and the

deletion of five of those previously assigned. Int. J. Syst. Bacteriol. 1977;

27:386–387.

24. Ørskov I. Nosocomial infections with Klebsiella in lesions of the urinary

tract. Acta Pathol. Microbiol. Scand. Suppl.1953; 92:259–271.

25. Hansen DS, Mestre F, Alberti S, Hernandez-Alles S, Alvarez D,

Domenech-Sanchez A, Gil J, Merino S, Tomas JM, and Benedi VJ.

Klebsiella pneumonia lipopolysaccharide O typing: Revision of prototype

strains and O-group distribution among clinical isolates from different sources

and countries. J. Clin. Microbiol.1999; 37(1):56–62.

26. Williams P, and Tomas JM. The pathogenicity of Klebsiella pneumoniae.

Rev. Med. Microbiol. 1990;1:196–204.

27. Straus DC. Production of an extracellular toxic complex by various strains of

Klebsiella pneumoniae. Infect. Immun. 1987; 55:44–48.

28. Brewer R.J, Galland RB, and Polk HC. Amelioration by muramyl

dipeptide of the effect of induced hyperferremia upon Klebsiella infection in

mice. Infect. Immun. 1982;38:175–178.

29. Payne SM. Iron and virulence in the family Enterobacteriaceae. CRC Crit.

Rev. Microbiol. 1988;16:81–111.

30. Ørskov I, Trevisan N R, Krieg, and Holt JG. Bergey’s Manual of

Systematic Bacteriology. Williams and Wilkins. Baltimore.1984. 1:461–465.

31. Brisse S, and Verhoef J. Phylogenetic diversity of Klebsiella pneumoniae

and Klebsiella oxytoca clinical isolates revealed by randomly amplified

polymorphic DNA, gyrA and parC genes sequencing and automated

ribotyping. Int. J. Syst. Evol. Microbiol. 2001;51(3):915–924.

32. Drancourt M, Bollet C, and Carta A, Rousselier P. Phylogenetic analyses

of Klebsiella species delineate Klebsiella and Raoultella gen. nov., with

description of Raoultella ornithinolytica comb. nov.,Int. J. Syst. Evol.

Microbiol.2001; 51(3):925–932.

33. Brisse S, van Himbergen T, Kusters K, and Verhoef J. Development of a

rapid identification method for Klebsiella pneumoniae phylogenetic groups

46

and analysis of 420 clinical isolates. Clin. Microbiol. Infect.2004b;10

(10):942–945.

34. Rolinson, GN. Evolution of β-lactamase inhibitors. Rev. Infect. Dis. 1991;

13(9):727–732.

35. Reading C, and Farmer T. The inhibition of periplasmic β-lactamase in

Escherichia coli by clavulanic acid and other β-lactamase inhibitors. McGraw-

Hill, New York, NY.1984;

36. Brown AG, Butterworth D, Cole M, Hanscomb G, Hood JD, Reading C,

and Rolinson GN. Naturally-occurring β-lactamase inhibitors with

antibacterial activity. J. Antibiot. (Tokyo) 1976; 29:668–669.

37. Albers-Schonberg G, Arison BH, Kaczka E, Kahan FM, Kahan JS, Lago

B, Maise WH, Rhodes RE, and Smith J. Abstr. 16th Intersci. Conf.

Antimicrob. Agents Chemother., abstr. 229. American Society for

Microbiology, Washington, DC.1976

38. Murakami K, Doi M, and Yoshida T. Asparenomycins A, B and C, new

carbapenem antibiotics. V. Inhibition of β-lactamases. J. Antibiot. (Tokyo).

1982; 35:39–45.

39. Kahan, JS, Albers-Schonberg G, Arison BH, Kaczka E, Kahan FM,

Kahan JS, Lago B, Maise WH, Rhodes RE, and Smith J. Thienamycin, a

new β-lactam antibiotic. I. Discovery, taxonomy, isolation and physical

properties. J. Antibiot. (Tokyo). 1979; 32:1–12.

40. Kropp H, Sundelof JF, Kahan JS, Kahan FM, and Birnbaum J. Abstr.

19th Intersci. Conf Antimicrob. Agents Chemother., abstr. 231. American

Society for Microbiology, Washington, DC.1979;

41. Nunez LE, Mendez C, Brana AF, Blanco, and Salas JA. The biosynthetic

gene cluster for the β-lactam carbapenem thienamycin in Streptomyces

cattleya. Chem. Biol. 2003;10:301–311.

42. Fainstein V, LeBlanc B, Weaver S, and Bodey GP. A comparative in vitro

study of thienamycin. Infection 1982; 10:50–52.

43. Basker MJ. The carbapenem family. J. Antimicrob. Chemother. 1982; 10:4–

7.

44. Miyadera, T, Sugimura Y, and Hashimoto T. Synthesis and in vitro activity

of a new carbapenem, RS-533. J. Antibiot. (Tokyo) 1983; 36:1034–1039.

47

45. Hashizume T, Ishino F, Nakagawa J, Tamaki S, and Matsuhashi M.

Studies on the mechanism of action of imipenem (N-formimidoylthienamycin)

in vitro: binding to the penicillin-binding proteins (PBPs) in Escherichia coli

and Pseudomonas aeruginosa, and inhibition of enzyme activities due to the

PBPs in E. coli. J. Antibiot. (Tokyo) 1984; 37:394–400

46. Hikida M, Kawashima K, Yoshida M, and Mitsuhashi S. Inactivation of

new carbapenem antibiotics by dehydropeptidase-I from porcine and human

renal cortex. J. Antimicrob. Chemother. 1992; 30:129–134.

47. Norrby SR, Alestig BK, Bjornegard , Burman LA, Ferber F, Hube JL, Jones

KH, Kahan FM, Kahan JS, and Kropp H. Urinary recovery of N-formimidoyl

thienamycin (MK0787) as affected by coadministration of N formimidoyl

thienamycin dehydropeptidase inhibitors. Antimicrob. Agents Chemother.

1983; 23:300–307.

48. Lee KS, Kang YK, Yoo KH, Kim DC, Shin KJ, and Paik Y-S. Novel 1β-

methylcarbapenems with isoxazoloethenyl moieties containing carboxylic acid

sodium salt. Bioorg. Med. Chem. Lett. 2005; 15:231–234.

49. Fukasawa, M, Sumita Y, Harabe ET, Tanio T, Nouda H, Kohzuki

T, Okuda T, Matsumura H, and Sunagawa M. Stability of meropenem and

effect of 1 β-methyl substitution on its stability in the presence of renal

dehydropeptidase I. Antimicrob. Agents Chemother. 1992;36:1577–1579.

50. Meroueh, S. Bencze KZ, Hesek D, Lee M, Fisher JF, Stemmler TL, and

Mobashery S. Three-dimensional structure of the bacterial cell wall

peptidoglycan. Proc. Natl. Acad. Sci. U. S. A. 2006; 103:4404–4409.

51. VanDam V, Olrichs N, and Breukink E. Specific labeling of peptidoglycan

precursors as a tool for bacterial cell wall studies. Chembiochem .2009;

10:617–624.

52. Rodriguez-Martinez JM, Poirel L, and Nordmann P. Molecular

epidemiology and mechanisms of carbapenem resistance in Pseudomonas

aeruginosa. Antimicrob. Agents Chemother. 2009; 53:4783–4788.

53. Koga, T, Chika S, Masayo K, Nobuhisa M, Eiko N, and Takashi F.

Affinity of tomopenem (CS-023) for penicillin-binding proteins in

Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa.

Antimicrob. Agents Chemother. 2009; 53:1238–1241.

48

54. Nordmann P, Picazo JJ, Mutters R, Korten V, Quintana A, Laeuffer JM,

Seak JC, Flamm RK, and Morrissey I. Comparative activity of carbapenem

testing: the COMPACT study. J. Antimicrob. Chemother. 2011; 66:1070–

1078

55. Livermore DM, and Woodford N. The β-lactamase threat in

Enterobacteriaceae, Pseudomonas and Acinetobacter. Trends Microbiol.

2006; 14:413–420.

56. Rasmussen BA, and Bush K. Carbapenem-hydrolyzing β-lactamases.

Antimicrob. Agents Chemother. 1997; 41:223–232.

57. Frere JM, Galleni K, Bush, and Dideberg O. Is it necessary tochange the

classification of β-lactamases? J. Antimicrob. Chemother. 2005; 55:1051–

1053.

58. Rasmussen BA, Bush K, Keeney DY, Yang R, Hare C, O’Gara, and

Medeiros AA. Characterization of IMI-1 β-lactamase, a class A carbapenem-

hydrolyzing enzyme from Enterobacter cloacae. Antimicrob. Agents

Chemother.1996; 40:2080–2086.

59. Watanabe M, Iyobe S, Inoue M, and Mitsuhashi S. Transferable imipenem

resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother.1991;

35:147–151.

60. Paton R, Miles RS, Hood J, and Amyes B. ARI 1 β-lactamase-mediated

imipenem resistance in Acinetobacter baumannii. Int. J.Antimicrob. 1993;

2:81–87.

61. Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW,

Steward CD, Alberti S, Bush K, and Tenover FC. Novel carbapenem-

hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of

Klebsiella pneumoniae. Antimicrob. Agents Chemother.2001; 45:1151– 1161.

62. Sykes RB, and Matthew M. The β-lactamases of Gram-negative bacteria

and their role in resistance to β-lactam antibiotics. J. Antimicrob. Chemother.

1976; 2:115–157.

63. Bush K, Jacoby GA, and Medeiros AA. A functional classificationscheme

for β-lactamases and its correlation with molecular structure. Antimicrob.

Agents Chemother.1995; 39:1211–1233.

64. Huovinen P, Huovinen S, and Jacoby GA. Sequence of PSE-2β-lactamase.

Antimicrob. Agents Chemother. 1988; 32:134– 136.

49

65. Medeiros AA, and Hare RS. β-Lactamase-mediated resistance to penems and

carbapenems amongst Enterobacteriaceae, abstr. 116. 26th Intersci.Conf.

Antimicrob. Agents Chemother. American Society for

Microbiology,Washington, DC. 1986.

66. Ambler RP, Coulson AFW, Frere JM, Ghuysen JM, Joris B, Forsman

M, Levesque RC, Tiraby G, and Waley SG. A standardnumbering scheme

for the class A β-lactamases. Biochem J.1991; 276:269–270.

67. Naas T, Vandel L, Sougakoff W, Livermore DM, and Nordmann P.

Cloning and sequence analysis of the gene for a carbapenem-hydrolyzing class

A β-lactamase, Sme-1, from Serratia marcescens S6. Antimicrob. Agents

Chemother. 1994; 38:1262–1270.

68. Bratu S, Landman D, M Alam M, Tolentino E, and Quale J. Detection

of KPC carbapenem-hydrolyzing enzymes in Enterobacter spp. From

Brooklyn, New York. Antimicrob. Agents Chemother. 2005; 49:776–778.

69. Miriagou V, Tzouvelekis LS, Rossiter S, Tzelepi E, Angulo FJ, and

Whichard JM. Imipenem resistance in a Salmonella clinical straindue to

plasmid-mediated class A carbapenemase KPC-2. Antimicrob. Agents

Chemother.2003; 47:1297–1300.

70. Moland ES, Hanson ND, Herrera VL, Black JA, Lockhart TJ, Hossain

A, Johnson JA, Goering RV, and Thomson KS. Plasmid mediated,

carbapenem-hydrolysing β-lactamase, KPC-2, in Klebsiella pneumoniae

isolates. J. Antimicrob. Chemother. 2003; 51:711–714.

71. Queenan AM, and Bush K. Carbapenemases: the versatile betalactamases.

Clin Microbiol Rev. 2007; 20: 440–458.

72. Giakkoupi P, Tzouvelekis LS, Tsakris A, Loukova V, Sofianou D, and

Tzelepi E. IBC-1, a novel integron-associated class A β-lactamase with

extended-spectrum properties produced by an Enterobacter cloacae clinical

strain. Antimicrob. Agents Chemother. 2000; 44:2247–2253.

73. Poirel L, Le I, Thomas, Naas T, Karim A, and Nordmann P.

Biochemical sequence analyses of GES-1, a novel class A extended-spectrum

β-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae.

Antimicrob. Agents Chemother. 2000; 44:622–632.

74. Poirel L, Weldhagen GF, Naas T, De Champs C, Dove MG, and

Nordmann P. GES-2, a class A β-lactamase from Pseudomonas aeruginosa

50

with increased hydrolysis of imipenem. Antimicrob. Agents Chemother.2001;

45:2598–2603.

75. Walsh TR, Toleman MA, Poirel L, and Nordmann P. Metallo-β-

lactamases: the quiet before the storm? Clin. Microbiol. Rev. 2005; 18:306–

325.

76. Lim HM, Pene JJ, and Shaw RW. Cloning, nucleotide sequence and

expression of the Bacillus cereus 5/B/6 β-lactamase II structural gene. J.

Bacteriol.1988; 170:2873–2878.

77. Iaconis JP, and Sanders CC. Purification and characterization of inducible

β-lactamases in Aeromonas spp. Antimicrob. Agents Chemother.1990; 34:44–

51.

78. Saino Y, Kobayashi F, Inoue M, and Mitsuhashi S. Purification and

properties of inducible penicillin β-lactamase isolated from Pseudomonas

maltophilia. Antimicrob. Agents Chemother. 1982; 22:564–570.

79. Riccio ML, Franceschini N, Boschi L, Caravelli B, Cornaglia G,

Fontana R, Amicosante G, and Rossolini GM. Characterization of the

metallo-β-lactamase determinant of Acinetobacter baumannii AC-54/97

reveals the existence of blaIMP allelic variants carried by gene cassettes of

different phylogeny. Antimicrob. Agents Chemother. 2000; 44:1229–1235.

80. Rolain JM, Parola P, and Cornaglia G. New Delhi metallo-betalactamase

(NDM-1): towards a new pandemia? Clin Microbiol Infect .2010; 16: 1699-

1701.

81. Poirel L, Ozdamar M, Ocampo-Sosa AA, Türkoglu S, Ozer UG, and

Nordmann P. NDM-1-producing Klebsiella pneumoniae now in Turkey.

Antimicrob Agents Chemother. 2012; 56:2784–5.

82. Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F,

Balakrishnan R, Chaudhary U, Doumith M, Giske CG, Irfan S, Krishnan

P, Kumar AV, Maharjan S, Mushtaq S, Noorie T, Paterson DL, Pearson

A, Perry C, Pike R, Rao B, Ray U, Sarma JB, Sharma M, Sheridan E,

Thirunarayan MA, Turton J, Upadhyay S, Warner M, Welfare W,

Livermore DM, and Woodford N. Emergence of a new antibiotic resistance

mechanism in India, Pakistan, and the UK: a molecular, biological, and

epidemiological study. Lancet Infect Dis .2010; 10: 597-602

51

83. Karthikeyan K, Thirunarayan MA, and Krishnan P. Coexistence of

blaOXA-23 with blaNDM-1 and armA in clinical isolates of Acinetobacter

baumannii from India. J Antimicrob Chemother 2010; 65: 2253-2254

84. Nordmann P, and Poirel L. The difficult-to-control spread of carbapenemase

producers among Enterobacteriaceae worldwide. Clin Microbiol Infect .2014;

20: 821-830

85. Lauretti L, Riccio ML, Mazzariol A, Cornaglia G, Amicosante G,

Fontana R, and Rossolini GM. Cloning and characterization of blaVIM, a

new integron-borne metallo-β-lactamase gene from a Pseudomonas

aeruginosa clinical isolate. Antimicrob. Agents Chemother.1999;43:1584–

1590.

86.Poirel L, He´ritier C, Tolu¨ NV, and Nordmann P. Emergence of

oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae.

Antimicrob Agents Chemother 2004; 48, 15–22

87. Castanheira M, Toleman MA, Jones RJ, Schmidt FJ, and Walsh TR.

Molecular characterization of a β-lactamase gene, blaGIM-1, encoding a new

subclass of metallo-β-lactamase. Antimicrob. Agents Chemother. 2004;

48:4654–4661.

88. Lee K, Yum JH, Yong D, Lee HM, Kim HD, Docquier JD, Rossolini

GM, and Chong Y. Novel acquired metallo-β-lactamase gene, blaSIM-1, in a

class 1 integron from Acinetobacter baumannii clinical isolates from Korea.

Antimicrob. Agents Chemother. 2005; 49:4485–4491.

89. Kim JY, Jung HI, An YJ, Lee JH, Kim SJ, Jeong SH, Lee KJ, Suh PG,

Lee HS, Lee SH, and Cha SS. Structural basis for the extended substrate

spectrum of CMY-10, a plasmid-encoded class C betalactamase. Mol

Microbiol. 2006; 60: 907-916

90. Quale J, Bratu S, Gupta J, and Landman D. Interplay of efflux system,

ampC, and oprD expression in carbapenem resistance of Pseudomonas

aeruginosa clinical isolates. Antimicrob Agents Chemother. 2006; 50: 1633-

1641.

91. Tzouvelekis LS, Markogiannakis A, Psichogiou M, Tassios PT, and

Daikos GL. Carbapenemases in Klebsiella pneumoniae and other

52

Enterobacteriaceae: an evolving crisis of global dimensions. Clin Microbiol

Rev .2012; 25: 682-707

92. Evans BA, Hamouda A, and Amyes SG. The rise of carbapenem resistant

Acinetobacter baumannii. Curr Pharm Des. 2013; 19: 223-238

93. Zhao WH, and Hu ZQ. Acinetobacter: a potential reservoir and dispenser

for β-lactamases. Crit Rev Microbiol .2012; 38: 30-51

94. Cuzon G, Ouanich J, Gondret R, Naas T, and Nordmann P. Outbreak of

OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in

France. Antimicrob Agents Chemother .2011; 55: 2420-2423

95. Sahuquillo-Arce JM, Hernández-Cabezas A, Yarad-Auad F, Ibáñez-

Martínez E, Falomir-Salcedo P, and Ruiz-Gaitán A. Carbapenemases: A

worldwide threat to antimicrobial therapy. World J Pharmacol .2015; 4(1): 75-

95

96. Karaaslan A, Soysal A, Altinkanat Gelmez G, Kepenekli Kadayifci E,

Syletir G, Bakir M. Altinkanat Gelmez G, Kepenekli Kadayifci E, Syletir

G, and Bakir M. Molecular characterization and risk factors for carbapenem-

resistant Gram-negative bacilli colonization in children: emergence of NDM

producing Acinetobacter baumannii in a newborn intensive care unit in

Turkey. J Hosp Infect. 2015; 92(1):67–72.

97. Sahin K, Tekin A, Ozdas S, Akin D, Yapislar H, Dilek AR, and Sonmez E.

Evaluation of carbapenem resistance using phenotypic and genotypic

techniques in Enterobacteriaceae isolates. Ann Clin Microbiol Antimicrob.

2015; 14:44.

98. Oguz Karabay, Mustafa A, Mehmet K, Onur K, zlem A, Aydemirand A,

and Fuat E. The carbapenem‑resistant Enterobacteriaceae threat is growing:

NDM‑1 epidemic at a training hospital in Turkey. Ann Clin Microbiol

Antimicrob. 2016; 15:6

99. Sonnevend Á, Ghazawi AA, Hashmey, Jamal W, Rotimi VO, and Shibl

AM. Characterization of Carbapenem-Resistant Enterobacteriaceae with High

Rate of Autochthonous Transmission in the Arabian Peninsula. PLoS ONE.

2015;10(6):

53

100. Lijun W, Haitong Gu, and Xinxin Lu. A rapid low-cost real-time PCR for

the detection of Klebsiella pneumoniae carbapenemase genes, Annals of

Clinical Microbiology and Antimicrobials , 2012;11:9

101. Martha FM, Stephen E, Mshana, Can Imirzalioglu, and Freddie B.

Carbapenemase Genes among Multidrug Resistant Gram Negative Clinical

Isolates from a Tertiary Hospital in Mwanza, Tanzania. Hindawi Publishing

Corporation BioMed Research International. 2014; Article ID 303104, 6.

102. Koksal C, Gonullu N, Kalayci F, and Kiraz N. Detection of

carbapenemase genes OXA-48, VIM, IMP, KPC and NDM in carbapenemase-

producing Klebsiella pneumoniae isolates from blood cultures of hospitalized

patients in Istanbul, Turkey, 17th International Congress on Infectious

Diseases / International Journal of Infectious Diseases 45S . 2016; 1–477.

103. Atef Shibl AB, Mohamed A, Ziad M, Abiola S, Shamshad Abdul

Khader d, and Abdullah A. The emergence of OXA-48- and NDM-1-

positive Klebsiella pneumoniae in Riyadh, Saudi Arabia, International

Journal of Infectious Diseases .2013; 17: 1130–1133.

104. Rojas MF, Mojica AV, Blanco M, Correa A, Montealegre MC, EDe

La Cadena, Maya JJ, Camargo RD, Quinn JP, and Villegasa MV.

Emergence of Klebsiella pneumoniae Coharboring KPC and VIM

Carbapenemases in Colombia, Antimicrobial Agents and Chemotherapy p.

2013; 57(2): 1101–1102.

105. Ripabelli G, Sammarco ML, Flocco R, Scutellà M, Recchia L, and

Grasso GM. Klebsiella Pneumoniae Isolated From Intensive Care Unit

Patients with Respiratory Tract Infections: Characterization by Pulsed-Field

Gel Electrophoresis, Antimicrobial Resistance and Pcrs for Carbapenemase

Genes Detection. J Respir Med Lung Dis. 2017; 2(1): 1008.

106. Christina S, Marco C, Camilla D, Silvia A, and Cartesio F. Rapid

detection of carbapenemase producing Klebsiella pneumonia strains derived

from blood cultures by Matrix-Assisted Laser Desorption Ionization-Time of

Flight Mass Spectrometry (MALDI-TOF MS). BMC Microbiology. 2017;

17:54.

107. Dalia M, and Doaa TM. Prevalence and characterization of carbapenem-

resistant Klebsiella pneumoniae isolated from intensive care units of

54

Mansoura University hospitals. Egyptian Journal of Basic and Applied

Sciences . 2017; 4: 37–41.

108. Mohammad A, El-Sweify, Nahed IG, Nermine NE, and Hasnaa AM.

Phenotypic Detection of Carbapenem Resistance among Klebsiella

pneumoniae in Suez Canal University Hospitals, Ismailiya, Egypt.

Int.J.Curr.Microbiol.App.Sci. 2015;4(2): 10-18.

109. Maryam A, Ali A, Manal A, and Hisham A. Comparison of phenotypic

and PCR methods for detection of carbapenemases production by

Enterobacteriaceae, Saudi Journal of Biological Sciences. 2017; 24:155–161.

110. Anika T, Zora J, Mira Mihajlović-Ukropina, Deana M, Branka Z, Vera,

G, and Milan Đ. Carbapenemase Production In Hospital Isolates Of

Multidrug-Resistant Klebsiella pneumoniae And Escherichia Coli In Serbia.

Vojnosanitetski Pregled. Military-Medical and Pharmaceutical Review

January .2016.

111. Amin A Aqela, b Panagiota Giakkoupic, Hamed Alzoubia, Ibrahim

Masalhad, Matthew J Ellingtone, and Alkiviadis Vatopoulos. Detection of

OXA-48-like and NDM carbapenemases producing Klebsiella pneumoniae in

Jordan: A pilot study, Journal of Infection and Public Health. 2017;10:150—

155.

112. Barguigua A, El Otmani F, Lakbakbi EF, Talmi M, and Zerouali K.

First report of a Klebsiella pneumoniae strain coproducing NDM-1, VIM-1

and OXA-48 carbapenemases isolated in Morocco. APMIS .2013; 121(7):

675−677.

113. Abdullah K, and Mehmet B.The First Klebsiella pneumoniae Isolate Co-

Producing OXA-48 and NDM-1 in Turkey. Ann Lab Med .2015; 35:382-383.

114. Meletis G, Tzampaz E, Protonotariou E, and Sofianou D. Emergence of

Klebsiella pneumoniae carrying blaVIM and blaKPC genes. HIPPOKRATIA.

2010;14,2: 139-140.

115. Ben Nasr A, Decré D, Compain F, Genel N, Barguellil F, and Arlet G.

Emergence of NDM-1 in association with OXA-48 in Klebsiella pneumoniae

from Tunisia. Antimicrob Agents Chemother .2013; 57:4089-4090.

116. Christine L, Gisele E, Meredith H, Kevin B, and Johann D. Surveillance

and Molecular Epidemiology of Klebsiella pneumoniae isolates that produce

55

Carbapenemases: First report. Antimicrob. Agents Chemother. 2012; 57(1):

130-136.

117. Varaldo PE, Nicoletti G, Schito GC, Maida A, Facinelli B, Stefan S,

Gianrossi G, and Muresu E. Circulation in Italy of beta-lactamase-

producing strains within the major groups of bacterial pathogens. Eur. J.

Epidemiol. 1990; 6: 287–292.

118. Traub WH, Schwarze I, and Bauer D. Nosocomial outbreak of cross-

infection due to multiple-antibiotic-resistant Klebsiella pneumoniae:

Characterization of the strain and antibiotic susceptibility studies.

Chemotherapy. 2000; 46:1–14.

119. Patel, G, and Bonomo RA. Status report on carbapenemases: Challenges

and prospects. Expert Rev. Anti Infect. Ther. 2011; 9: 555–570.

120. Ibrahim EH, G Sherman, S Ward, VJ Fraser, and MH Kollef . The

influence of inadequate antimicrobial treatment of bloodstream infections on

patient outcomes in the ICU setting. Chest . 2000; 118:146-155.

121. Cheesebrough Monica. District laboratory practice in tropical Africa 2nd

Press syndicate of the University of Cambridge 2nd edition.200; pp 62- 70

122. Clinical and Laboratory Standards Institute. Performance Standards for

Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement.

CLSI document M100-S25 (ISBN 1-56238-989-0 [Print]; ISBN 1-56238-990-

4 [Electronic]). Clinical and Laboratory Standards Institute, 950 West Valley

Road, Suite 2500, Wayne, Pennsylvania 19087 USA, 2015. CLSI, 2008.

123. Clinical and Laboratory Standards Institute (CLSI) 2012. Methods for

Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow

Aerobically; Approved Standard, 9th edn, M7- A9. Wayne, PA: Clinical and

Laboratory Standards Institute.

124. Dortet L, Aure´ lie Agathine, Naas T, Gae¨ lle Cuzon1, Poirel L, and

Nordmann P. Evaluation of the RAPIDECw CARBA NP, the Rapid CARB

Screenw and the Carba NP test for biochemical detection of carbapenemase

producing Enterobacteriaceae. Published by Oxford University Press on behalf

of the British Society for Antimicrobial Chemotherapy. 2015;

125. Chen L, Mediavilla JR, Endimiani A, Rosenthal ME, and Zhao Y.

Multiplex real-time PCR assay for detection and classification of Klebsiella

56

pneumoniae carbapenemase gene (bla KPC) variants. J Clin Microbiol .2011;

49: 579-585.

126. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W,

and Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of

protein database search programs. Nucleic Acids Res. 1997 Sep

1;25(17):3389-402.

127. John PQ, L Silvia M, Poirel L, Bonomo RA, Mitchell JS, George L

D, Martin C, Giuseppe C, Javier G, Marek G, Mary KH, Karthikeyan

K, David ML, Juan JM, Nordmann P, Jean BP, David LP, Johann P,

Maria VV, and Neil W. Clinical epidemiology of the global expansion

of Klebsiella pneumonia carbapenemases. Lancet Infect Dis. 2013 Sep; 13(9):

785–796.

128. McWilliam H, Li W, Uludag M, Squizzato S, Park YM, Buso N, Cowley

AP, and Lopez R. Analysis tool web services from the EMBL-EBI. Nucleic

Acids Res.2013; 41:597–600.

129. Us E, Tekeli A, Arıkan AO, Dolapçı I, Şahin F, and Karahan ZC.

Molecular epidemiology of carbapenem-resistant Klebsiella pneumoniae

strains isolated between 2004–2007 in Ankara University Hospital, Turkey.

Mikrobiyol Bul. 2010; 44(1):1–10.

130. Paterson DL. Resistance in gram-negative bacteria: Enterobacteriaceae.

Am. J. Infect. Control.2006; 34: 20–28.

131. Cheng-Yen K, and Jiunn-Jong W. Carbapenem resistance:epidemiology,

mechanisms and screening methods. J. Biomed.Lab. Sci.2015 ;27; 1–9.

132. Doyle D, Peirano G, Lascols C, Lloyd T, Church D, and Pitout J.

Laboratory detection of Enterobacteriaceae that produce carbapenemases. J.

Clin. Microbiol.2012; 50: 3877–3880.

133. Schechner V, Kotlovsky T, and Kazma M,. Asymptomatic rectal carriage

of blaKPC producing carbapenem-resistant Enterobacteriaceae: who is prone

to become clinically infected? Clin Microbiol Infect.2013; 19(5):451–456.

57

APPENDICES

Appendix (1): Questionnaire

بسم الله الرحمن الرحیم

Al-Neelain University

Medical Laboratory Sciences

Microbiology Department

Questionnaire

Research title: Molecular Characterization of Carbapenemase-ProducingKlebsiella pneumoniae Dominance of blaOXA-48, blaKPC, blaVIM and blaNDM

producers in Khartoum, Sudan

By: Abdelhakam Hassan Ibrahim Ali

Hospital name:

…………………………………………………………………………………………

Index No :……………………………………………………………………..

Type of sample:…………………………………………………………………

Time of collection:………………………………………………………………

Gender: Male: Female:

Duration:……………………………………………………………………..

Treatment: yes: No :

……………………………………………………………………………….

Others:…………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………

Signature:……………………………………………………………….

58

Appendix (2):

K.pneumoniae grown on MacConkey agar medium appeared purple color due to

lactose fermentation, mucoid colonies.

Appendix (3):Preparation of reagents and culture media1- Chromogenic media

CompositionsAgar………………………………………………….……..…… 15.0 g/LPepton ………………………………………………..…….…… 15.0 g/LChromogenic mix…………………………………………..… 13.125 g/LYeast extract…………………………………………..………..… 3 g/LSodium chloride ……………………………………………………. 5 g/LFinal pH…………………………………………………..……..…. 7 ± 0.2DirectionsSuspend 5.125 grams of Chromogenic Medium in 1 liter of distilled water. Mix welland sterilize by autoclaving at 121°C for 15 minutes. Cool the medium to 50°C andpour into sterile Petri dishes.2. McFarland Standard Turbidity tube 0.5:

IngredientsConc. Sulphuric acid ………………………………………….…1 mlDehydrated barium chloride ……………………..……..………..0.5gDistilled water …………………………………..………..……..99 mlPrepare 1% V/V of sulphuric acid solution by adding 1 ml of concentratedsulphuric acid to 99 ml of DW and mix. Prepare 1% w/v solution of bariumchloride by dissolve 0.5g of dehydrated barium chloride in 50 ml of distilled water.Add 0.6 ml of sulphuric acid then mix well.

59

3. Muller Hinton agarMuller Hinton agar is used for testing susceptibility of common and rabidly growingbacteria using antimicrobial disc, it manufactured to contain low level of thymine,thymidine, calcium and magnesium.CompositionsIngredients Gms/LCasein acid hydrolysate……………………………………..………… 17Beef heart infusion………. ……………………………….…………… 2Starch soluble…………………………………………………………. 1.5Agar…………………………………………………….………………17Final pH (at 25°C)…………………………………………..………... 7.3DirectionsSuspend 38 grams in 1000 ml distilled water. Heat to boiling to dissolve themedium completely. Sterile by Autoclave at 15 ibs pressure (121°C) for 15 min.mix and pour.4. PCR Master Mix

except primers and DWcomponentsThat includes all reactionCompositionTag DNA polymerase (2.5 Unit/100 µl reaction)PCR nucleotide mix (0. 4 mM of each nucleotideOptimized reaction buffer

2MgclLoading dye

Appendix (4):

K. pneumoniae grown on chromoginic medium appeare as dark blue color.

60

Appendix (5)

Modified Hodge Test: A laboratory strain of pan-susceptible Escherichia coli(ATCC 25922) was streaked across the entire plate and a Meropenem disc placed inthe center of the plate. Isolates have the code numbers of 344,380,356,365 and 351were clinical isolates with carbapenem resistant activity by initial screening. Theyare streaked linearly from the periphery to a central carbapenem disk. Isolate 351 wasnegative for carbapenemase. Isolate 365 is show positive but few amount of enzymeindicated by the small arcing growth. Isolates 356,380 and 344 were positive withlarge amount of enzyme production remarked by large arcing growth toward themeropenem disc.

61

Appendix (6)

Carba NP test direct: The well labeled A: positive control while B: Negative

controle. After the plate were incubated at 35°C for 2 h, indicator (Bromothymol

blue ) was added to each well a yellow color indicated acidic pH which result from

hydrolysis of substrate (Meropenem) which means carbapenemase production

(positive test) , greenish yellow color indicate the isolate were produced few amount

of enzyme and the blue color indicate no enzyme produced ( negative test).

BA

62

Appendix (7):

Antimicrobial susceptibility test, carbapenem Resistant organism (no zone of

inhibition around disk of both imipenem & meropenem).

Appendix (8):

Antimicrobial susceptibility test, carbapenem Sensitive organism (large zone of

inhibition around disk of both imipenem & meropenem).

63