AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you...
-
Upload
chastity-lamb -
Category
Documents
-
view
220 -
download
4
Transcript of AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you...
![Page 1: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/1.jpg)
AIDS Defining and AIDS AIDS Defining and AIDS Associated MalignanciesAssociated Malignancies
![Page 2: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/2.jpg)
Objective: Objective: Think about concepts you don’tthink about in your every day evidence based
approach to the practice of medicine without falling asleep
![Page 3: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/3.jpg)
What are the AIDS Defining What are the AIDS Defining Malignancies?Malignancies?
AIDS Associated Malignancies?
![Page 4: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/4.jpg)
AIDS Defining MalignanciesAIDS Defining Malignancies
• Kaposi’s sarcoma
• Non Hodgkin’s lymphoma
• Squamous cell carcinoma of the cervix/anus*
* AIDS associated malignancy
![Page 5: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/5.jpg)
Variations on a ThemeVariations on a Theme• Oncogenic viral infection
– KS – Lymphoma – SCCa cervix/anus
• Proliferation of a benign cell- KS - Lymphoma - SCCa cervix/anus
• Immune dysregulation- Up regulation - Down regulation- Direct role of HIV
![Page 6: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/6.jpg)
Variations on a ThemeVariations on a Theme• Oncogenic viral infection
– KS = KSHV– Lymphoma = EBV and KSHV– SCCa cervix/anus = HPV
• Proliferation of a benign cell- KS = lymphatic endothelial cell- Lymphoma = B lymphocyte- SCCa cervix/anus = squamous epithelium
• Immune dysregulation- Increased production of inflammatory cytokines- Loss of cell mediated immunity to control viral infections- Any direct role of HIV: Tat up regulation of virus gene expression
![Page 7: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/7.jpg)
How do viruses cause cancer?How do viruses cause cancer?
What about cytokinesWhat about cytokines
How does being CD4 T lymphopenicHow does being CD4 T lymphopenicmake you susceptible to cancer?make you susceptible to cancer?
![Page 8: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/8.jpg)
Case 1Case 1
• A 28 year old man with early stage HIV presented anxious and upset over the development of disfiguring skin lesions.
![Page 9: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/9.jpg)
Kaposi’s Sarcoma can range from disfiguring to …..Kaposi’s Sarcoma can range from disfiguring to …..
![Page 10: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/10.jpg)
organ and limb threatening …organ and limb threatening …
![Page 11: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/11.jpg)
Kaposi’s SarcomaKaposi’s Sarcoma
![Page 12: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/12.jpg)
Don’t treat without meat…...Don’t treat without meat…...
This is bacillary angiomatosis, an infection due to Bartonella sp.
It is treated with erythromycin
![Page 13: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/13.jpg)
Kaposi’s SarcomaKaposi’s Sarcoma
• Was among the initial features of AIDS• Three epidemiologic subsets
– Endemic - seen in sub Saharan Africa– Epidemic - associated with HIV infection– Sporadic - aging men of Mediterranean descent
• Strong relationship with immune deficiency– Transplant patients– Recipients of immunosuppressive agents – Aged individuals
• Long thought to have an infectious etiology– HHV-8 or KSHV was discovered in 1994 by Moore and Chang
![Page 14: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/14.jpg)
Kaposi Sarcoma Herpes VirusKaposi Sarcoma Herpes VirusHuman Herpes Virus - 8Human Herpes Virus - 8
• How prevalent is KSHV in the US population?
• How prevalent is KSHV in HIV infected persons?
• What is the primary route of transmission of KSHV
• Does everyone with KSHV infection get KS?
![Page 15: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/15.jpg)
Kaposi Sarcoma Herpes VirusKaposi Sarcoma Herpes VirusHuman Herpes Virus - 8Human Herpes Virus - 8
• Prevalence of KSHV infection is 5% in USA.
• Prevalence of KSHV infections is 26% to 40% in HIV infected persons.
• Shed in the SALIVA, the primary route of transmission
• KS develops in a minority of immune competent persons, but 50% of HIV infected persons.
• Present in ALL KS lesions from ALL types of KS
![Page 16: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/16.jpg)
Two types of KSHV (HHV-8) InfectionTwo types of KSHV (HHV-8) Infection
• Latent seen in Kaposi’s sarcoma– No virus replication
– Limited expression of virus genes
• Lytic seen primary effusion lymphoma
– Production of virus progeny
– Expression of many viral genes
![Page 17: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/17.jpg)
Many of the KSHV genes operate to create the perfect environment for malignancy
• Inhibition of cell cycle regulation
• Prevent apoptosis
• Modulate the immune system
• Promote angiogenesis
• Latent infection can be converted to lytic infection under conditions of hypoxia.
![Page 18: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/18.jpg)
PathogenesisPathogenesis
• KSHV has tropism for lymphatic endothelial cells, B cells, macrophages, and epithelial cells.
• In KS latent infection is more prevalent than lytic.
• Latent state KSHV genes codes for proteins that support KS oncogenesis– LANA-1 inhibits p53
– vCyclin (homolog of cyclin D2) that is resistant to CDK inhibitors
– vFLIP (homolog of FLIP) that inhibits apoptosis
![Page 19: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/19.jpg)
Role of cytokines in pathogenesisRole of cytokines in pathogenesis
• Cytokines
– From HIV-infected macrophages and activated T cells
– IL-1, IL-2, PF4, IFN-, TNF-
– Cause proliferation of lymphatic endothelial cells
– Permissive environment for KSHV infection
![Page 20: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/20.jpg)
TreatmentTreatment• First Line: protease inhibitor containing regimen
– 20% to 60% of patients may respond with HAART alone.
– Best responses: drug naïve, skin only, and CD4 increase >150
– CR is not necessarily protective against recurrence.CR is not necessarily protective against recurrence.
• Advanced KS in late stage AIDS often requires more Rx
– Enhanced immunity against KSHV is not enough
– VEGF inhibitors, liposomal adriamycin, conventional cytotoxic Rx
• Goal of treatment is palliation
![Page 21: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/21.jpg)
Where has all the KS gone?Where has all the KS gone?
• There has been a dramatic decline in incidence with HAART
- Adjusted incidence pre HAART: 15.2/1000 person years
- Adjusted incidence post HAART: 4.9/1000 person years
• Immune reconstitution and better control of KSHV
• Anti angiogenesis effects of protease inhibitors
![Page 22: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/22.jpg)
![Page 23: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/23.jpg)
AIDS associated LymphomasAIDS associated Lymphomas
![Page 24: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/24.jpg)
AIDS associated LymphomasAIDS associated Lymphomas
• Peripheral lymphomas Peripheral lymphomas
• ??
• ??
![Page 25: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/25.jpg)
AIDS associated LymphomasAIDS associated Lymphomas
• Peripheral lymphomas Peripheral lymphomas
• Primary effusion lymphomasPrimary effusion lymphomas
• Primary CNSPrimary CNS
![Page 26: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/26.jpg)
EpidemiologyEpidemiology
• Rates may be under estimated 2° to hierarchy of reporting.
• Incidence in AIDS is estimated from 4 to 16%.
• Risk of NHL in HIV is 100-200X risk of HIV neg.– 80% of HIV lymphomas are high grade, 15% are low grade.
– Just the opposite for HIV negative persons
![Page 27: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/27.jpg)
What viruses contribute to What viruses contribute to lymphomagenesis?lymphomagenesis?
• EBV
• KSHV
• HIV
![Page 28: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/28.jpg)
Lymphomagenesis: virusLymphomagenesis: virus
• HIV - not directly involved in malignant transformation.
• EBV - causes polyclonal B cell proliferation leading to genetic instability increasing the chance of a transforming mutation, such as myc translocation.
– Implicated in CNS and Primary Effusion Lymphomas
• KSHV - how could this virus possibly cause lymphoma?
– Implicated in primary effusion lymphoma and multicentric Castleman’s disease
![Page 29: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/29.jpg)
LymphomagenesisLymphomagenesis
• Cytokines– IL-6 and IL-10
• Loss of immune surveillance– Loss of CD4 clones that control EBV infected B cells– Loss of CD8 function (due to loss of CD4 help)– Permits proliferation of EBV infected B lymphoblasts– EBV infected lymphs can evade immune detection
![Page 30: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/30.jpg)
PrognosisPrognosis• Most prognostic data comes from pre-HAART era
– CD4< 200 median survival = 4 months– CD4 >200 median survival = 11 to 18 months
• Overall median survival in HAART era 24 months
• NCI AIDS Malignancy Branch peripheral lymphoma patients receiving EPOCH ± R - at 53 months follow up overall survival is 60%.
• Median survival for PEL 3 to 6 months.
• Median survival for primary CNS lymphoma– Radiation alone - 4 months– Chemotherapy 10 to 18 months
![Page 31: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/31.jpg)
Antiviral therapy and EpidemiologyAntiviral therapy and Epidemiology
• Modern antiretroviral therapy does not prevent lymphoma, but rather maintains CD4 counts at levels that prevents development of the poor prognosis lymphomas (immunoblastic and primary CNS lymphoma).
![Page 32: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/32.jpg)
Case 2Case 2
• A 37 year old man with long standing HIV infection presents with mid epigastric pain, hemoccult positive stools, and a microcytic hypochromic anemia.
• Upper endoscopy revealed:
![Page 33: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/33.jpg)
Peripheral Lymphoma HistologyPeripheral Lymphoma Histology
• Burkitt’s and Burkitt’s-like– Occurs in state of relative immune preservation– Bone marrow and nodal sites predominate– EBV is absent esp in sporadic Burkitt's
• Diffuse Large B cell Lymphoma; centroblastic– Occurs in state of relative immune preservation– GI and CNS sites predominate– Good prognosis
• Diffuse Large B cell Lymphoma; immunoblastic– Occurs in later stage HIV infection
– GI and CNS sites predominate
– Poor prognosis
![Page 34: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/34.jpg)
Peripheral LymphomasPeripheral Lymphomas
• Extranodal involvement is common.– CNS (leptomeninges) - 20 to 40% at presentation– GI - 30% at presentation– Orbit, skin, salivary glands, heart, lung, muscle,
bones, adrenals, rectum, gonads, placenta
• Stage– Most present with stage III, IV or IE bulky disease
![Page 35: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/35.jpg)
TreatmentTreatment
• Induction of remission requires chemotherapy.
•All patients receive CNS prophylaxis
• Controversial Issues
– Dose intensity and regimen
– Infusional (EPOCH) vs. bolus (CHOP) therapy
– Concurrent use of HAART
– Use of rituximab WHY?WHY?
![Page 36: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/36.jpg)
Case 3Case 3
• A 39 year old man, known to be HIV positive presents with new onset ascites.
• Further examination and evaluation reveal bilateral pleural effusions and pericardial effusion.
• A pericardiocentesis reveals:
![Page 37: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/37.jpg)
Primary Effusion LymphomaPrimary Effusion Lymphoma• Usually occurs in young, homosexual men with advanced HIV
• Epidemiology similar to that of KS
• Disease usually restricted to pericardium, pleura, peritoneal cavity without contiguous tumor mass.
• Poor outcome (survival <5 mos).
• Tumor cell is B cell lineage:– Kappa and lambda light chain mRNA– Ig heavy chain with k light chain mRNA– Uniformly express KSHVKSHV; frequently EBV
![Page 38: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/38.jpg)
PEL TreatmentPEL Treatment
• Refractory to conventional chemotherapy
• Some short remissions with EPOCH
• Experimental therapies exploit KSHV pathophysiology
– KSHV codes for several kinases
– These kinases phosphorylate (activate) AZT and ganciclovir
– Theoretically, the drugs will be activated primarily in KSHV
infected B cells, killing primarily those cells.
![Page 39: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/39.jpg)
GuanosineGanciclovir
AZT Thymidine
![Page 40: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/40.jpg)
AZT and GCV are phosphorylated and then incorporated into a growing chain of DNA. What do you think happens next?
![Page 41: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/41.jpg)
AZT AZT
ACTGACTGACTGACTGACTTGACTGACTGACTGACTGA
AZT AZT
AZT
GCV GCV
GCV GCV
AZT
AZTGCV
cKINASE
B lymphoctye from person treated with AZT, GCVB lymphoctye from person treated with AZT, GCV
![Page 42: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/42.jpg)
AZT AZT
ACTGACTGACTGACTGACTTGACTGACTGACTGACTGA
AZT AZT
AZT
GCV GCV
GCV GCV
AZT
AZTGCV
cKINASE
- (PO4)3
- (PO4)3
Kinases triphosphorylate both AZT, GCVKinases triphosphorylate both AZT, GCV
![Page 43: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/43.jpg)
AZT AZT
ACTGACTGACTGACTGACTTGACTGACTGACTGACTGA
AZT AZT
AZT
GCV GCV
GCV GCV
AZT
AZTGCV
cKINASE
- (PO4)3
- (PO4)3
v KINASE
KS
HV
KSHV infected B cell has additional kinase activityKSHV infected B cell has additional kinase activity
![Page 44: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/44.jpg)
AZT AZT
ACTGACTGACTGACTGACTTGACTGACTGACTGACTGA
AZT AZT
AZT
GCV GCV
GCV GCV
AZT
AZTGCV
KINASE
- (PO4)3
- (PO4)3
v KINASE
KS
HV
- (PO 4
) 3
- (PO 4
) 3
- (PO4)3
- (PO4)3
What do you think happens to this cell?What do you think happens to this cell?
![Page 45: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/45.jpg)
ACTGACTGACTGACTGACT ACTGACTGACTGACTGACT
Theoretically, there is more cell kill in theKSHV infected B cells because there is more
phosphorylation of the drugs.
Yes this therapy is toxic, but it targets virus infected cells.
![Page 46: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/46.jpg)
Case 4Case 4
• A 45 year old man with long standing HIV infection presents with focal neurologic deficits.
• Imaging reveals:
![Page 47: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/47.jpg)
Primary CNSPrimary CNS• Occurs in setting of severe immune suppression
• 20X decrease incidence with modern antivirals
• Multifocal (few large 3 to 5 cm lesions), developing at perivascular cuffs
• Primarily immunoblastic histology
• Monoclonal B cell population, EBV+ ALWAYS
• PET +, thallium +, EBV PCR of CSF for dx vs. brain bx
– Nuc med scan + and PCR + has neg predictive value of 100%
![Page 48: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/48.jpg)
Primary CNS TreatmentPrimary CNS Treatment
• Optimize antiretrovirals to restore or enhance EBV immunity.
• Radiation, 4000cGy, is standard approach
• Considerable morbidity associated with WB XRT
• Rubinstein (ASCO 2006): high dose methotrexate with leucovorin rescue, temozolomide, and rituximab for induction, then high dose ARA-C with etoposide infusion for consolidation.
– 52% complete remission rate
– Median progression free survival is 11.5 months
– Median overall survival has not been reached with 27.5 months follow up.
• Median survival pre HAART 4 months; HAART era 15 mos.
![Page 49: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/49.jpg)
![Page 50: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/50.jpg)
Case 5Case 5
• 48 year old man presents for follow up of rectal bleeding, a sensation of rectal fullness, and some pain with defecation.
• On exam he is found to have a numerous anal condylomata and a firm 4cm mass just inside the anal verge which is tender to palpation and slightly ulcerated.
![Page 51: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/51.jpg)
Squamous Cell CarcinomaSquamous Cell Carcinoma
• SCCa of the anus is notnot AIDS defining, but is an AAM– Relative risk is 6.8 in women, 37.9 in men
– About 130 to 160 fold increase over HIV- population
• SCCa of the cervix isis and AIDS defining illness.
– Incidence still rising as of 1998
– RR is 3.2 in HIV infected women
– 20% of infected women without cervical disease developed SIL within 3 yrs. (versus 5% of HIV neg women)
![Page 52: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/52.jpg)
Role of HPVRole of HPV
• HIV + persons are 2-6X more likely to have HPV infection than HIV- persons.
• HIV + persons are 7X more likely to have persistent HPV infections compared to HIV-.
• HPV infection is poorly controlled in HIV+– Cell mediated immune defects– Humoral defects
• HPV16 or 18 is detected in most anal carcinomas
• HPV 16 is detected in nearly 50% of cervical cancers.
![Page 53: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/53.jpg)
E1 E2 E3 E4 E5 E6 E7
HPV Genome and Development of MalignancyHPV Genome and Development of Malignancy
EARLYGENES
• HPV episomal episomal (circular): E2 controls E6 and E7 gene transcription.
• When episomal, HPV does no harm.• By poorly understood mechanisms, HPV can become linear
and integrate into our DNA.• The E2 gene is disrupted in this process.
![Page 54: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/54.jpg)
E1 E 2 E3 E4 E5 E6 E7
HPV Genome and Development of MalignancyHPV Genome and Development of Malignancy
EARLYGENES
• HPV integrates:integrates: E2 control is lost and E6 & E7 are over expressed.
• E6 and E7 gene products bind and inactivatebind and inactivate p53 and RB
• p53 and RB are tumor suppressor genes.
• Tat up regulates E6 and E7 transcription further inhibiting tumor suppression.
Loss of transcriptional control of E6 and E7 genes
binds p53; loss of suppressor
function
binds RB, inactivating RB gene product
![Page 55: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/55.jpg)
Clinical Features of Anal CarcinomaClinical Features of Anal Carcinoma
• Most common location for anal cancer is at transformation zone approximately 2 cm from the anal verge.
• Rectal bleeding is the most common sign
• 30% have pain or sensation of a mass
• Often asymptomatic
![Page 56: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/56.jpg)
Clinical Features of Cervical CancerClinical Features of Cervical Cancer
• Presentation is usually at the junction of the primary columnar epithelium of the endocervix and the squamous epithelium of the ectocervix.
• Abnormal bleeding is most common sign
• High grade intraepithelial lesions may not bleed.
• Early disease is usually painless.
![Page 57: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/57.jpg)
TreatmentTreatment• High grade squamous cell intraepithelial neoplasia
– 85% trichloroacetic acid– Liquid N2– Imiquimod (an immune response modifier)– Topical 5-FU– Podophyllotoxin– Surgical resection of the transformation zone
• These therapies do not eradicate the HPV infectiondo not eradicate the HPV infection and recurrence of neoplasm is is common.– Preventive vaccines prevent HPV-16 infx in HIV neg women.– No evidence to suggest a therapeutic vaccine would work.
![Page 58: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/58.jpg)
TreatmentTreatment
• Invasive DiseaseInvasive Disease
– HIV infected persons should be offered same therapy used in HIV negative persons.
– Antiretroviral medications should be continued.
– Responses are comparable to HIV- patients, but toxicity is much higher.
– Large prospective trials are sorely missing.
![Page 59: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/59.jpg)
AAM - a unique opportunityAAM - a unique opportunity
• Restore immune response to oncogenic viruses with combination antiviral therapy
• Control cytokine dysregulation by controlling HIV infection with combination antiretroviral therapy
• Specific therapy for oncogenic viruses– Therapeutic vaccination– Targeted therapies, i.e. directed at virus gene products, i.e.
bevacizumab– Take advantage of viral proteins, i.e, KSHV, AZT, GCV
![Page 60: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/60.jpg)
And the winner of January Mustache…….
![Page 61: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/61.jpg)
Case 5Case 5
• 32 yo year old HIV infected man presents with several day history of fevers, chills, orthostatic symptoms, extreme fatigue, anorexia, and dyspnea at rest.
• T = 102 BP 90/40 P=120 RR 34/min O2 sat 92% Acutely ill appearing man
• Diffuse lymphadenopathy, course rhonchi bilaterally, decreased bowel sounds, mild diffuse abdominal tenderness, scattered KS lesions on legs
• Labs: WBC 2.5, Hgb 7.6, Plt 43,000 Na 122, albumin 2.8, CRP 9.43, LDH 254 (nl).
![Page 62: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/62.jpg)
Castleman’s DiseaseCastleman’s Disease
• Unicentric Castleman’s DiseaseUnicentric Castleman’s Disease
– Described by Benjamin Castleman in 1956.
– Isolated benign lymphoproliferative disorder of young adults
– Pathology is usually hyalin vascular type. (20% are plasma cell variant)
– M=F, median age 35 yrs
– Large asymptomatic mediastinal or hilar nodes
– Cured with resection, radiation, rituximab
– May be associated with increased risk for B cell lymphoma
![Page 63: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/63.jpg)
Castleman’s DiseaseCastleman’s Disease
• Described in 1978
• Male predominance, median age 52, younger if HIV infected
• Present with waxing and waning symptoms over variable period of time; may be difficult to dx if not considered.
• Symptoms: chills, wt loss, anorexia, fatigue, cough, abdominal pain
• Signs: Fever, generalized lymphadenopathy, hepatomegaly, splenomegaly
• In HIV+ patients, 100% are associated with HHV-8
– Co-exists with Kaposi’s sarcoma
– Pathology: preserved architecture, proliferation of follicles, blood vessels and plasma cells in the interfollicular areas, increased immunoblasts.
![Page 64: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/64.jpg)
Plasma cell variant Castleman’s disease
![Page 65: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/65.jpg)
Hyaline variant
![Page 66: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/66.jpg)
PathogenesisPathogenesis• HHV-8 infection of B lymphocytes (mantle zone lymphs)
• Lytic infection (latent infx in KS)
• HHV-8 codes for vIL-6 which in turn stimulates VEGF production.
• VEGF production stimulates human IL-6 from endothelial cells
• IL-6 is responsible for the constitutional symptoms and generalized adenopathy
• Most of the symptoms are thought related to IL-6 and is a novel therapeutic target.
![Page 67: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/67.jpg)
TreatmentTreatment• Combination chemotherapy
– Etoposide, vincristine, cladribine, chlorambucil, prednisone
– EPOCH-R and CHOP
• Rituximab alone
• High dose AZT and ganciclovir
• Interferon alpha (low dose escalating x 6 to 12 mos)
• Anti – IL-6 receptor– Tocilizumab and atilzumab
• Cidofovir
![Page 68: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/68.jpg)
… … life threatening diseaselife threatening disease
![Page 69: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/69.jpg)
Immune Reconstitution KSImmune Reconstitution KS
Before HAART After 2 months of HAART
![Page 70: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/70.jpg)
![Page 71: AIDS Defining and AIDS Associated Malignancies. Objective: Objective: Think about concepts you don’t think about in your every day evidence based approach.](https://reader038.fdocuments.in/reader038/viewer/2022103006/56649e8a5503460f94b8f2e2/html5/thumbnails/71.jpg)
TreatmentTreatment
• When considering treatment other than HAART:
– Treat life threatening disease
– Treat limb or organ threatening disease
– Cosmetically significant lesions
• Complete remission does not protect against later recurrence.