Ag Expo 2010 - Spokane WA

WWW.EXCHANGEPUBLISHING.COM - 1/29/10- Supplement to The Exchange 1

TODAY’S FARMING…PART-TIME TO ALL THE TIME!Convention Center Group Health Hall ~ Spokane, Washington

February 2-4, 2010

— Special Ag Expo Supplement

Cable-Lok™ Spool Tarp

Cable-Lok™ is the smoothest move in tarping – from open to closed, simply andeasily. Spring-loaded tension with cable attachment keeps your tarp tight, evenin moderate wind conditions. Engineered for secure tarp attachment, the extrud-ed tarp attachment slot runs the full length of the roll tube. It anchors with a safe-ty rod, making for easy tarp removal down the road. Pressure is distributed even-ly along the fabric – no binding, overlap or friction. Durable nylon spools and agalvanized steel cable keep the system operating smoothly, year after year.

See the Cable-Lok™ Spool Tarp in action at Booth #135 atthe Spokane Ag Expo Feb. 2-4. Ask about Show Specials!

1.866.355.9173 Shur-Co. of CO www.shurco.com

The Cable-Lok™ (above) is available in applications for grain carts,grain wagons and farm bodies. The spring-loaded spool (left) withsteel cable, ratchet and flexible elbow attached to the crank arm.SOURCE CODE SPA

EVERYTHING YOU NEED TO TARP SMARTER.

Super-smoothtarp operation!

Stop by & Visit Us at Our Booth for Great AG Show Specials!

Factory Reps Available

LOCATIONS ALL OVER THE INLAND NORTHWEST!SPOKANECd’ALENEof Spokane

.hotsy.comS.

WE REPAIR & SERVICE & CARRY PARTS & ACCESSORIES FOR MOST MAKES OF PRESSURE WASHERS!

PRESSURE WASHERSUPERSTORE

Call Us Today!We’ve Got the

Model to Suit Your Needs!

Let Us Build You a “Quality” Building Don’t Sign a Contract Until You Talk to Us!

(509) 468-1606 1-800-775-0125ID LIC# RCE-991WA LIC# QUALISB081C7

Quality Steel Buildings, Inc.GENERAL CONTRACTORS

POLE BUILDINGSIMMEDIATE BUILD

OR KITS!

Visit our website: www.qsbinc.com

Locations in Spokane & Newport

DVD CONSTRUCTION VIDEO U-BUILD-IT

CONSTRUCTION

DVDComplete Plans Included with Kit

2 Supplement to The Exchange - 1/29/10 - 509-922-3456

2010 Pacific Northwest Farm Forum SeminarsDouble Tree Hotel - Feb. 2-4, 2010 Revised 1/6/10

TOPIC PRESENTER MEETING ROOM SPONSORTuesday Feb. 2, Noon

Winter Cutworm -- A New Exotic Ed Bechinski Shades Conf. Rm. CHS Ag Pest in the Inland Northwest Pesticide Recertification Course Shades Conf. Rm. CHSRecent Developments in Leases, Kenneth D. Carpenter Salon I Brock, Carpenter, 1031 Exchanges and Split and Todd King McGuire, & DeWulf Interest Purchases from the Perspective of the Ag Attorney and Accountant Fuel Price Analysis: Tools That Tina Hampton Save You Money Salon II Bank of Fairfield Cash is King - Building a Cash Jim Leffel Flow Budget That You’ll Use Salon III Leffel, Otis & Warwick

Tuesday Feb. 2, 1:30 p.m.Fuel Storage on the Farm Bill Koll Shades Conf. Rm. CHSPlanning For Transition of the Family Norm Brock and Salon I Brock, Carpenter & Farm: What Works, What Doesn’t, Corey Brock McGuire, & DeWulf What to DoSimple Tools to Aid in the Marketing Jim Leifer Salon II Bank of Fairfield of Your Grain Federal Taxes, State Taxes, CRC, Todd King Salon III Leffel, Otis & Warwick SCP, ACRE - Keeping Current with Changes That Make a Difference

Tuesday Feb. 2, 3:00 p.m.NPDES Aquatic Pesticide Rules Danelle Farmer Shades Conf. Rm. CHSPesticide Recertification Course Shades Conf. Rm. CHSUtilizing the LLC to Its Fullest Potential Norm Brock and for the Family Farm: Asset Corey Brock Salon I Brock, Carpenter, Protection and Asset Control in a McGuire, & DeWulf Nutshell Direct Marketing Small Farm Products - Patrice Barrentine Salon II Bank of Fairfield How to Make It Work College Planning & Financial Aid for Karla Jaeger Salon III Leffel, Otis & Warwick Farm Families

Wednesday Feb. 3, 10:30 a.m. Wireworm Control in Cereal Grains Aaron Esser Shades Conf. Rm. CHSPesticide Recertification Course Shades Conf. Rm. CHSBuying and Selling Water Rights: Mark DeWulf The Do’s and Don’ts Salon I Brock, Carpenter & McGuire, & DeWulfSimple Tools to Aid in the Marketing Jim Leifer Salon II Bank of Fairfield of Your GrainTrends in Sales & Leases of Farmland Todd King and Saloon III Leffel, Otis & Warwick - A Shortage of Land or A Shortage Ken Carpenter of Farmers?

Wednesday Feb. 3, Noon2009 Research Highlights on Soilborne Tim Paulitz Shades Conf. Rm. CHS Pathogens: Rhizoctonia, Fusarium, Nematodes and Acid Soils Pesticide Recertification Course Shades Conf. Rm. CHSEstate Planning Made Easy Kenneth D. Carpenter Salon I Brock, Carpenter & McGuire, & DeWulfBeefing Up the Palouse: An Economic Maurice Robinette and Feasibility Study of an Alternative to CRP Dick Coon Salon II Bank of Fairfield College Planning & Financial Aid for Karla Jaeger Salon III Leffel, Otis & Warwick Farm Families

TOPIC PRESENTER MEETING ROOM SPONSORWednesday Feb. 3, 1:30 p.m.

Agricultural Land Value Trends Larry Kloster Shades Conf. Rm. CHSFarm Family Facing the Nursing Home Rusty McGuire Salon I Brock, Carpenter & or Assisted Living: How It Works McGuire, & DeWulf and How to Pay For ItThe Modular Abattoir – Affordable, Joel Huesby Salon II Bank of Fairfield Scalable, Portable Federal Taxes, State Taxes, CRC, SCP, Todd King Salon III Leffel, Otis, & Warwick ACRE - Keeping Current with Changes That Make a Difference

Wednesday Feb. 3, 3:00 p.m.New Spray Droplet Size Requirements Scott Nielsen Shade Conf. Rm. CHS on Some Herbicide Labels Pesticide Recertification Course Shades Conf. Rm. CHSAre You Getting the Most Out of the Corey Brock Salon I Brock, Carpenter & Farm?: Wind Leases, Development, McGuire, & DeWulf Hunting Rights Understanding Nutrition for Ruminant & Ty Cochran Salon II Bank of Fairfield Non-Ruminant Animals Cash is King - Building a Cash Flow Jim Leffel Salon III Leffel, Otis, & Warwick Budget That You’ll Use

Thursday Feb. 4, 10:30 a.m.Farm Ponds - Planning, Design and Steve Sprecher Shade Conf. Rm. CHS ConstructionMaximizing the Future: Retirment Corey Brock Salon I Brock, Carpenter & Planning, Financial Planning, McGuire, & DeWulf Transition Planning

USDA Assistance for CRP Takeout Judy Olson, State Salon II Bank of Fairfield Using Direct Seeding Technology Director of USDA Farm State Service Agency and Roylene Rides At The Door State Conservationist, USD Natual Resources Conservation Service

USDA Assistance for CRP Takeout Judy Olson, State Salon III Leffel, Otis & Warwick Using Direct Seeding Technology Director of USDA Farm State Service Agency and Roylene Rides At The Door State Conservationist, USD Natual Resources Conservation Service

Thursday Feb. 4, NoonWind and Solar Applications for Homes John Wiley Shades Conf. Rm. CHS and Small Acreage Producers Buying and Selling Water Rights: Mark DeWulf Salon I Brock, Carpenter & The Do’s and Don’ts McGuire, & DeWulf

USDA Assistance for CRP Takeout Judy Olson, State Salon II Bank of Fairfield Using Direct Seeding Technology Director of USDA Farm State Service Agency and Roylene Rides At The Door State Conservationist, USD Natual Resources Conservation Service

DATE SPECIAL SEMINARS SPEAKERS ROOM Tuesday, 9 a.m Farm Forum Main Session John Oades & Art Douglas Salon IV Wednesday, 9 a.m. Dean’s Discussion Dean Bernardo (WSU) & Dean Hammel (UI) Salon IV Thursday, 7:30 a.m. Direct Seed Breakfast Russ Zenner, Past President PNDSA & Mark Richter, President PNDSA Salon IV Thursday 9 a.m. FFA Program Dan DeGon, CoAg Salon IV

Small Acreage Farmers Mean Big BusinessSpokane Ag Expo and the Pacific NW Farm Forum continue to meet the needs of a growing number of small acreage farming and ranching operations in the Inland Northwest. Many rural property owners have moved from more urban areas of the region and purchased 5, 10 and 20 acres of land for

both the investment and the enjoyment of a tranquil, rural lifestyle.

This migration has seen an increase in business opportunities for agricultural related companies to provide equipment and services to these small acreage owners. Many have little, if any, experience in stewarding their land and are turning to agri-businesses for direction in what they can do with their property. Few realize that their land can become productive and profitable for them given direction and planning. Spokane Ag Expo has tailored portions of this three-day event to these small acreage owners to help them gain knowledge. Seminars include the planning and construction of farm ponds, wind and solar energy applications, alternative options for producing farm revenues, markets for locally grown food and more.

Spokane Ag Expo has many exhibitors on the floor during these three days that will provide answers to the many questions on the minds of small acreage property-owners. In addition, the Pacific NW Farm Forum has lined up many of their thirty-six, hour-long seminars to topics that directly relate to small acreage operations. It is the hope of the Spokane Ag Bureau that this expanded di-rection of Spokane Ag Expo and Pacific NW Farm Forum will provide the information thousands of small acreage property owners in the Inland Northwest with options and answers to making their property productive.


Is Your Single Source Supplier:WWWWWW.OOXXAARRCC.CCOOMM

OpOpenen M Monondadayy ththruru F FriridadayySome Items Limited to Stock on Hand.

Boise 208-376-0377 La Grande 541-963-2890 Okanogan 509-826-3205 Sunnyside 509-837-6212Coeur d’Alene 208-765-3311 Lewiston 208-743-6571 Pasco 509-547-2494 Walla Walla 509-529-3060Colville 509-684-3776 Moses Lake 509-765-9247 Sandpoint 208-263-1016 Wenatchee 509-662-8417Ellensburg 509-925-1518 Nampa 208-442-8910 Spokane 509-535-7794 Yakima 509-248-0827Hermiston 541-567-7377

OPTREL SATELLITE

WELDING HOODK60X (0, 1, 2, 3, 4)

$246While They Last!

Since the Optrel Satellite was launched, most welders cannot imagine life without this comfortable helmet. The Satellite really is near to perfection, not only with regard to comfort and safety, but also where additional functions are concerned. The DIN 4/5-9/9-13 protective level function gives the welder the freedom to use different materials and welding processes. Other options enable the helmet to be individually adapted to the needs of the welder.

We have a full selection of Welding Helmets & Helmet Liners

Journeyman Select#JRNSELECT510

$298

Deluxe Journeyman#DLXJRN510 (Pictured)

$498

Contractor Plus#DLXCONPLUS

$433

Specials Good

Feb. 1-5 only!

Welding Products Industrial SuppliesIndustrial, Medical & Specialty Gases

Rental EquipmentLeasing & Layaway Options

Fire Equipment First Aid SuppliesSafety Products Beverage Systems

Welding Inspections & TestingFinancing Options Available

WWW.OXARC.COMOnline Shopping

Save$150

Great Selection!

FEBRUARY FIRST-WEEK SALE AT OXARCAll items subject to stock on hand

W

$2,093 #0558008121

PC 900 Plasma Cutter

The PowerCut® 900 from ESAB makes plasma cutting easier and more economical than ever before, delivering reliability, high production and a wide variety of performance features. With design features that simplify operation, reduce set-up time and enhance con-sumable life, it lets you spend less time trouble-shooting and more time cutting.

Manual Cut Capacity:

Mechanized Pierce Capacity:

CUTTINGOUTFITS

Migmaster 250

$1763 #604561

superior arc performance

Includes: 15 ft. GM250 MIG Gun, gas flowmeter and 6 ft. gas hose, 8 ft. primary input cable with plug & receptacle, 10 ft. work cable with ground clamp

Ranger GXT 225

Unmatched Compact Welding for Pros or Hobbyists.

Lower Noise with X-tra Welding Performance

emergency power.

$2,758#K2733-1

Mig WelderSP14OT$498

#K2688-1Precision TIG 275$3,897 #K2618-1

Power MIG 255XT$1,903 #K2701-1

Technology delivers precision arc performance to improve arc starting, welding and weld cratering with features like the patented Auto-Balance and a built-in simple pulse control.

drive system aid arc performance for the

stainless and aluminum.

Outback 185 Takes Power To the Job Site

$2,205#K2706-1

watt generator. The Outback is powered wit a Kohler engine

Precision TIG 225$1,958

#K2535-2

Ranger 250$3,022 #K1725-12

ready for a workout, all day, ev-eryday! Intended for contractors, construction and maintenance applications, this tough Lincoln gasoline-driven welder/generator

is recommended for stick welding, including a separate, dedicated


2010 Photo Contest Winners Announced

(Spokane, WA) The winners of the 2010 Spokane Ag Expo Photography contest are listed below. The theme of the contest was Agriculture in the Inland Northwest. Photographers were asked to submit pho-tos that depict agriculture in the Inland Northwest. Entries were judged in two categories, youth and adult. All of the en-tries will be displayed at the 2010 Spokane Ag Expo at the Convention Center Com-plex in the Group Health Hall on February 2-4, 2010. Following the show, the winning photos will be posted on the show website

(www.agshow.org).

The purpose of the contest is to pro-mote Inland North-west Agriculture and to give amateur photographers, par-ticularly from rural areas, an opportu-nity for their work to be shown and recognized

Adult Category:

1st Place: Chuck Wood, Gig Harbor, WA—“Tim Iksic”

2nd Place: Rick Barlow, Coeur d’Alene, ID—“Gold Dust”

3rd Place: Cara Allen, Spokane, WA—“Blue Dew”

Manager’s Choice: Randi Bafus, St. John, WA—“Seedin’”

Honorable Mentions:

Michelle Fode-Smith, Ritzville, WA—“Coyote Flats”

Doug Overlock, Spokane, WA—“A Long Row of Hay”

Stacey Timm-Rasmussen, Harrington, WA—“First Frost”

Karen Bafus, St. John, WA—“Harvest”

Otto Stevens, Spokane, WA—“Palouse Springtime”

Heather Yirak, Harrington, WA—“Untitled”

Youth Category

1st Place: Daniel Leitz, Spokane, WA—“Anna Leitz”

2nd Place: Alysa Norton, Otis Orchards, WA—“The Wooden Window”

3rd Place: Cassie Blank, Spokane, WA—“Olenora Valley Barn”

Manager’s Choice: Alysa Norton, Otis Orchards, WA—“Days End”

Honorable Mentions: Garrett Lewis, Rockford, WA—“The Old Log Barn”

Kelsey Glynn, Veradale, WA—“Over the Hill”

Jessicca Weitman, Otis Orchards, WA—“Heel to Toe”

AG Enterprise Supply Inc.

Sales * Service * Satisfaction - Since 1980

Cheney - Wilbur509-235-2006 www.agenterprise.com 800-782-7786

BANK OF FAIRFIELD

We focus on your finances,So you can focus on your farm.

Fairfield283-2126

Spangle245-3226

Rockford291-5029

Rosalia523-3208

Spokane328-6000

Valley 927-2265

Member

Meeting Your Lubrication Needs at Fair Prices & Excellent Service Since 1983

SAVE $$$


Visit www.SCCD.org for Full Color Pictures & More Descriptions of All Seedlings For Sale

ORDERS DUE: March 19, 2010 — SEEDLINGS AVAILABLE FOR PICKUP April 9-10, 2010

CASH OR CHECK ONLY! WE DO NOT ACCEPT CREDIT OR DEBIT CARDS!

ORDER FORMPlease print legibly to ensure the correct species & quantity is ordered

Species Ordered Quantity Price Species Ordered Quantity Price

Seedling Subtotal $

x 8.7% WA Sales Tax $

Order Total $

Less Deposit (must enclose 50% min) $

Balance Due (at time of Pickup) $

Havana, Spokane, WA

Name*

Mailing Address*

City, State, Zip*

Phone*

* Required

Spokane County Conservation District

2010Tree & Shrub Seedling Sale

NOTE: Most of the tree & shrub seedlings for sale are bareroot. They are not potted. They can be used for a variety of conservation practices, such as re-forestation, windbreaks and screens, wildlife habitats, Christmas tree plantations, and for landscape beautification in your urban backyard. If you have any questions about the trees and shrubs, please call our Forestry Department at 509-535-7274.

SALE INFORMATION Order deadline is March 19, 2010. Plants can be picked up April 9-10 at the District office. Plants cannot be mailed A minimum payment of 50% must be included with your order form.

The remainder is due when your order is picked up. We only accept cash and checks. We do not accept credit or debit cards. Orders not picked up by April 10 will be forfeited. Seedlings come in bundles of five (5).

If you would like to receive next year’s tree sale brochure by e-mail, please enter your email address belowEmail:

NATIVE & ORNAMENTAL DECIDUOUS TREESQuantity of Seedlings 5 10 15 20 25 50 100Price (per bundle of 5) $9 $18 $27 $36 $45 $90 $180 Black Cottonwood Largest of the American poplars, it is fast-growing, adaptable to a variety of soil & prefers most areas. Mountain Ash Small tree or large shrub, it has white bloom spikes followed by red fruit. Prefers well-drained soil.Paper Birch A fast-growing tree with white paper-like bark. It requires moist soil & should be planted near water. Black Walnut A Large tree that produces an edible walnut. It prefers moist, well-drained soils and full sunlight.Quaking Aspen Tall and narrow with heart-shaped leaves, it thrives near streams and should be planted near water. Water Birch A fast-growing and shade tolerant small tree or large shrub. It is usually found on moist to wet soils.Ginkgo A Large shade tree, it is a slow grower with green fan-shaped leaves. It is tolerant of urban conditions. Japanese Maple A slow-growing tree with small red or purple flowers. It is shade tolerant and prefers moist soil.Northern Red Oak Often planted as a shade or street tree, its large leaves turn dark red in fall. A good wildlife species.

NATIVE & ORNAMENTAL SHRUBS & GROUNDCOVERQuantity of Seedlings 5 10 15 20 25 50 100Price (per bundle of 5) $9 $18 $27 $36 $45 $90 $180 Caragana A deciduous shrub that has yellow flowers that develop into pea pods. Good choice for a windbreak.Black Hawthorn Large shrub or small tree, it has wide thickets and globe-shaped flowers. Prefers full sun & deep soil.Chokecherry A rapidly-growing hardy shrub whose flowers produce cherry-like fruit. Good for windbreaks. Golden Currant A favorite of wildlife, this shrub produces a dark edible fruit and has bright yellow spring flowers. Kinnikinnick A ground cover with white to light pink flowers that produce red berries in the late fall. Mock Orange The state flower of Idaho, it has fragrant white flowers and is moderately drought-tolerant. Potentilla A dense shrub with bright yellow flowers. It is tolerant of cold weather and good for mass plantings.Rocky Mountain Maple A shrubby, deciduous tree, it is found naturally along streams & moist sites and is shade tolerant. Serviceberry A large shrub with white flowers that produce edible fruit. Drought tolerant and needs little care.Tall Oregon Grape A sprawling shrub with holly-like leaves and a dark purple fruit. Drought tolerant, it prefers shade.

FEATURED SPECIES: A must-have for the Lilac City, the Common Lilac is a deciduous shrub with a medium-growth rate. It is known for its lilac-colored, fragrant flowers that bloom in May. Highly adaptable to a variety of soil, it prefers full sun. Its mature height

is between 8-15’, & can be planted as a hedgerow. Price: $9.00 per bundle of 5

NATIVE & ORNAMENTAL CONIFERSQuantity of Seedlings 5 10 15 20 25 50 100Price (per bundle of 5) $6 $12 $18 $24 $30 $60 $120 Dawn Redwood An ancient deciduous tree with light bronze fall color, it prefers moist soil & full sunlight.Colorado Blue Spruce A slow growing evergreen with dark green to dark blue needles. It prefers moist, well-drained soil. Fraser Fir A slow-growing evergreen with short, dark green needles. A great Christmas tree. Prefers full sun. Western White Pine A tall and straight conifer that produces very large and long cones. An important timber species.Douglas Fir A large evergreen tree that is valued for its timber. Great as a Christmas tree and for re-forestation.Engelmann Spruce A large, narrowly pyramidal evergreen. Produces ovoid cones and make good Christmas trees. Western Red Cedar A pyramidal evergreen that is good for hedges, screens and windbreaks. Very shade tolerant. Ponderosa Pine The most common conifer in Spokane County, it is an important timber resource and wildlife tree.Rocky Mtn. Juniper A large shrub or small evergreen tree, it is narrow and conical in shape. Good for screens and hedges. Western Larch A deciduous conifer with lime green needles in the spring that turn a golden color in the fall.

Vistit www.SCCD.org for full color pictures and more descriptions of all seedlings for sale.

Common Lilac (Syringa vulgaris)Mature Height 8-15'A deciduous shrub with a medium growth rate, the common lilac is known for its fragrant lilac-colored

fl owers that bloom in May. Highly adaptable to a vari-ety of soil, it prefers miost, well-drained, slighly acidic soils and performs best in full sun. The Offi cial Flower of Spokane

Ginkgo (Ginkgobiloba)Mature Height: 60-80’The ginkgo is a large shade tree with a slow growth rate that has unique fan shaped green leaves that fl utter in the breeze. It prefers full sun to partial shade, and grows best on moist, deep and sandy soil. It is tolerant of urban conditions.

Western Larch (Larix occidentalis)Mature Height 140-180'NativeThe Western Larch is a deciduous conifer. Often referred to as Tama-rack, though many consider this a misnomer. The needles are lime green in the spring, darkening in the sum-mer, and turning a golden color in the autumn before falling off. Larch grow best on moist sites and will need

supplemental irrigation in this area. Use as a specimen or in a group with evergreens.

Ponderosa Pine (Pinus ponderosa)Mature Height 120-140'NativeThe most common conifer in Spokane County. It is an important timber re-source and wildlife habitat tree. This pine is very drought tolerant and easy to propagate on even the poorest soils. It is not recommended as a street tree in urban areas. Give it plenty of room to grow. Wildlife Benefi t: Pon-derosa Pine provides excellent cover

and nesting sites for many birds. Chipmunks, ground squirrels, and birds, including grosbeaks, chickadees, fi nches, siskins, crossbills, nuthatches, and turkeys will eat the seeds.

Rocky Mountain Juniper (Juniperus scopulorum)Mature Height: 30-40’NativeA large shrub, or small evergreen tree, it is narrow and conical in shape. It has thick branches, scale-like leaves, and bluish needles. It is good for screens, mass plant-ings and hedges. It is highly adaptable and

tolerant of most conditions. It prefers well-drained soils and full sunlight.

Chokecherry (Prunus virginiana) Mature Height 10'-15’NativeChokecherry is a deciduous, hardy shrub that grows rapidly. It bears white clustered flowers that later produce dark purple fruit that is excel-lent food for birds and is great in pies and jellies. The dense growth makes the chokecherry a good species in windbreaks. Prefers sun, but tolerates

partial shade. Average water needs. Grows well in sandy soils. Wildlife Benefi t: The fruit is a prime source of food for chipmunks and many songbirds in the fall.

6 Supplement to The Exchange - 1/29/10 - 509-922-3456TRUCK SCALES • LIVESTOCK SCALES • WAREHOUSE SCALES • RENTAL SCALES

S C A L E S E R V I C E • S YS T E M S • PA R T S • S A L E S A N D C O N S T R U C T I O N

Axle Scales • Truck Scales • Livestock ScalesFloor Scales • Electronic Low-Profile Scales

Portable Truck Scale RentalsSelf-Contained Livestock Scales

Mechanical/Electronic Pit (and Pitless) Scales

www.scalesnw.com • [email protected] • SCALES 800-451-0187 Since 1959 - Manufactured in Scio, Oregon

Main OfficePowell Scales NW, Inc.39120 West Scio Rd.Scio, OR 97374(503) 394-3660Fax (503) 394-3502Toll Free: 1-800-451-0187

Spokane OfficeInland Scales NW5602 E. Desmet Ave.

PO Box 11335Spokane, WA 99211

(509) 535-4295Fax (509) 535-4296

CUSTOM SIZES AVAILABLE4'x8' - 3,000 lb. capacity8'x15' - 15,000 lb. capacity8'x20' - 20,000 lb. capacity10'x20' - 20,000 capacity

POWELL-INLAND

SCALESNW

Steve Orr 503-510-3540

WSU Spokane County Small Farms Program

The WSU Small Farms Program strives to connect small acre-age farm producers and landowners with the resources, education and networking opportunities to improve their farm operations and sustainably manage their land.

As part of WSU Extension Small Farm Program, this gives farmers and landowners access to the resources and expertise of WSU faculty and staff across the state and Northwest. That means if a farmer or land owner has a question about how to do something, we can go to our network and draw on the experiences and research of people who work with agriculture across Wash-ington Oregon and Idaho as well has the research done at the region’s land grant universities.

The Spokane County program offers workshops on topics im-portant to growers and producers, one-on-one consulting on farm management and marketing and advanced training opportuni-ties like Cultivating Success

Article and Photo by Pat Munts

15% OFF EVERYTHING! Store-Wide Sale During Ag Expo*

Need a Particular Tool or Piece of Equipment?

Our Inventory Changes all the time!

NEW & USED HAND TOOLS, ACCESSORIES & PARTSELECTRICAL, HYDRAULIC, & POWER TRANSMISSIONWELDING & CUTTING APPARATUSWELDER & EQUIPMENT REPAIR PARTSWELDING SUPPLIES & ACCESSORIES

ABRASIVES (GRINDING, SANDING, CUTTING)

About Us....

Located in Spokane, Washington, The Industrial Liquidation Center offers a large selection of Industrial prod-ucts at liquidation prices. We carry a moving inventory of new, used and surplus fabrication, welding, tools and industrial safety products.

With a retail sales location and internet ordering options we can handle your industrial product needs. Stop by and browse often, because we are continually updating our inventory to provide you with the products at below market value.

7321 E. Trent Spokane, WA 99212 am– pm am– pm 509 509 www. .bz

*sale prices are limited to stock on hand & excludes consignments

SAVE UP TO 70%

OFF RETAIL


HAY EQUIPMENTLoc. Make Model Description RetailG JD 935 ROTARY MOCO .......................................... $13,995N JD 920 ROTARY MOCO .......................................... $10,000N CIH 8340 MOWER CONDITIONER ............................. $8,500S NH 488 SICKLE BAR, RUBBER COND. .................... $6,995N NH 166 HAY TURNER ............................................. $5,000N JD 468 ROUND BALER .......................................... $32,500N JD 466 RD. BALER ................................................. $20,000T VERMEER 504 SUPER I, 4X5 BALE.................................... $7,000S NH 846 ROUND BALER .......................................... $3,800S CIH 8430 ROUND BALER .......................................... $9,995S NH 630 ROUND BALER .......................................... CALLT CIH SBX550 16X18 SQ. BALER, 540 PTO, SIDE DROP ... $14,500N CIH 8530 INLINE SQ. BALER ..................................... $10,500N JD 347 SQ. BALER ................................................. $9,000T JD 336 SQ. BALER ................................................. $7,000S IH 440 SQ. BALER ................................................. $1,595S NH 1085 BALE WAGON ........................................... JUST INN JD 4995 SP WINDROWER, 16’ JD 995 PLAT .......... $68,995G MACDON 9000 WINDROWER W/15’ MULTICROP & COND .... $29,995S HESS 6400 WINDROWER ............................................ $3,995T WHITE 6200 WHITE SP WINDROWER, 21’ PLAT ........... $5,750M VERS 400 WINDROWER ............................................ $1,000M JD BALE SQUEEZE .......................................... $1,200T FRONT ROUND BALE SQUEEZE ............................. $1,500

CHECK OUT OUR WEBSITE!www.columbiatractorinc.com

Information, Hundreds of Pictures, More Used Equipment & Some “New” Items at Ridiculously LOW Prices!!

‘08 JD 5525 (S)Tractor, Loader,

MFWD, 12/12 Trans $48,500

SERVING YOU AT 7 LOCATIONS IN THE NORTHWEST: Spokane, WA (S) (T) (B) (G)

(M) (N) (P)

MONTANA 5740 (B)Like New, 55 HP,

Cab, Loader $30,000

‘98 JD 7410 (T)Tractor, Cab, MFWD,

4812 Hours $49,500

JD 4040 (S)Tractor, Cab,

MFWD $21,950

‘08 JD 9770 (N)Level Land,

Duals $265,000

JD 9610 (N)2-9610 w/Hillco, 930 Plat Leveler

CALL

‘86 JD 7722 (M)Hillside w/924 Plat,

Nice Condition$45,000

‘97 GLEANER R72 (M)4WD, Overhauled, 3000 Hours, 2-Plat

$72,000

COLUMBIA TRACTOR, Inc.4009 E. Francis

Spokane, WA 99217(888) 636-2257 (509) 483-2868

Highway 274 Tekoa, WA 99033

(800) 543-6070 (509) 284-2501

1201 Fontaine Dr.Ponderay, ID 83852

(800) 828-0741 (208) 267-3116

6606 Main St. Bonners Ferry, ID 87805

(800) 448-4260 (208) 267-3116

1906 South MainMoscow, ID 83843

(888) 349-3899 (208) 882-0303

BELL EQUIPMENT, Inc.511 4th Street

Nezperce, ID 83543

118 W. South StreetGrangeville, ID 83530

(800) 753-3373 (208) 983-1730

4WD TRACTORSLoc. Make Model Description RetailN JD 9400 4WD, 24 SPD, 710 DUALS, 4-SCV ................ $109,000N JD 9300 4WD TRACTOR ............................................. $105,000N JD 9300 4WD, 24 SPD, 710 DUALS, RADAR, 4SCV ... $89,000N JD 9300 4WD, 710 DUALS, 24 SPD ........................... $89,000T JD 8960 4WD, 30.5X32 DUALS, 4SCV ....................... IN SOONT JD 8770 4WD, 18.4X46 DUALS .................................. IN SOONM JD 8630 4WD, 3-SCV’S, PTO, FRT. TANK .................... $12,000M JD 8450 4WD, NEW 23.1 DUALS, NEW ENG, ........... $38,000M JD 8430 4WD TRACTOR ............................................. $11,500B STGR ST270 4WD, BAREBACK, DUALS ............................ $7,500N IH 4386 4WD TRACTOR ............................................. $7,495

MISC EQUIPMENTLoc. Make Model Description RetailM SUMMERS 90’, 1200 GAL, RAVEN, 4000 ACRES........$43,500M MISC. 92’ SPRAYER .............................................CALLM BRANDT 80’ 80’ SPRAYER, FOAM MARKER, LIKE NEW ......$34,900M JD 27 14’ FLAIL SHREDDER, 1000 RPM .............$8,000N JD AMS AUTO TRAC, SFII ......................................$13,500

TILLAGE EQUIPMENTLoc. Make Model Description RetailN JD 1610 CHISEL PLOW ............................................. $7,995N JD 680 CHISEL PLOW ............................................. $29,000M WIL-RICH 36’ S-TINE CULT. W/FLEX HARROW .......... $6,000M JD 980 44’, 6” SPACE, SPRAY BOOMS, TINE HARR ...... $25,000N JD 980 44’ CULTIVATOR ......................................... $19,000M Glencoe 45’ GLENCOE 45’ FIELD CULT ........................... $3,000M WIL-RICH 34’ 2-DANISH TINE CULT. 38’ AND 42’ ............. $6,000M MISC 42’ DANISH TINE CULT ............................... $4,200M JD 3710 JD 12 BTM PLOW ...................................... $18,000N JD 3710 10 BTM JD 3710 PLOW ............................. $16,000N JD 3710 JD 3710 PLOW ........................................... $16,000T JD 3710 10 BTM SAFETY TRIP PLOW ...................... $6,500N JD 3600 6 + 5 BTM PLOW W/HITCH ...................... $10,500T JD 3600 2-JD 3600 5BTM W/HITCH ........................ $4,500M WIL-RICH 8 8 BOTTOM PLOW ....................................... $2,500M IH 800 10 BTM SPRING RESET .............................. $5,000M IH 800 10 BTM SPRING RESET .............................. $5,000

SEEDING EQUIPMENTLoc. Make Model Description RetailM FLEX 5000 39’, 9” SPACING, HOE DRILL, TOOL ONLY ....$32,000M JD 1860 30’, 7.5” SPACE, NEW BOOTS & BLADES ...$60,000N JD 1560 15’ NO-TILL DRILL .......................................$22,000M JD 455 3000 ACRES, 35’, 7.5” PLAIN, 4” PW.........$52,000T JD 455 35’, PLAIN GRAIN, 4X12 PW ......................$32,500T JD 455 35’ COMBO, 2X13” PRESS WHEELS ..........$25,000T GP 15’ GREAT PLAINS 15’ CHISEL DRILL ...............$6,500

COMBINESLoc. Make Model Description RetailM JD 9870 HILLCO, 4WD, LOADED, 250 HRS ...............JUST ING JD 9770 LEVEL LAND COMBINE ...............................$151,500N JD 9770 LEVEL LAND, DUALS ..................................$265,000N JD 9770 LEVEL LAND, DUALS, LOADED ...................IN SOONN JD 9770 LEVEL LAND, DUALS, LOADED ...................IN SOONN JD 9770 LEVEL LAND, DUALS, LOADED ...................IN SOONM JD 9760 HILLCO, 1500 SEP HRS, 630 PLAT. .............$237,000T JD 9650W COMBINE W/44% RAHCO, 930R PLAT. ......IN SOONN JD 9610 2-9610 W/HILLCO, 930 PLAT LEVELER .......CALLN JD 9600 REA HILLSIDE COMBINE ...........................IN SOONG JD 9600 JD 9600 COMBINE .....................................$43,000N JD 9600 JD 9600 COMBINE .....................................$45,000M JD 7722 HILLSIDE W/924 PLAT, NICE COND ............$45,000N JD 7722 HILLSIDE COMBINE, 224R, CHOPPER ........$35,000N JD 7722 HILLSIDE COMBINE, 224R ..........................$35,000N JD 6620 SIDEHILL COMBINE W/JD 220 PLAT. .........$9,000M JD 6620 SIDEHILL COMBINE W/PLAT. ......................$6,000M GLEANER R72 4WD, OVERHAULED, 3000 HRS, 2-PLAT ....$72,000N IH 1460 LEVEL LAND COMBINE ...............................$12,000

COMPACT UTILITY TRACTORSLoc. Make Model Description RetailP JD 4720 TRACTOR, MFWD, LDR ..........................CALLP JD 4720 TRACTOR, MFWD, LDR ..........................$32,500P JD 4720 TRACTOR, MFWD, LDR ..........................CALLS JD 3520 TRACTOR, MFWD, LDR ..........................$19,995B JD 1070 MFWD, LDR, BACKHOE, 600 HRS. .........$18,000P JD 855 COMPACT TRACTOR W/MOWER ...........$5,500B KUBOTA L345DT TRACTOR, LOADER ................................CALLS KUBOTA L345DT TRACTOR W/LDR, MFWD ......................$7,995S KUBOTA L3010 TRACTOR, MFWD, LDR, HYDRO .............$10,500M KUBOTA L2950 TRACTOR, LDR, MFWD ..........................$8,500S HERCULES 3320 30HP TRACTOR, MFWD, LDR, 8 SPD. ....$9,000

UTILITY TRACTORSLoc. Make Model Description RetailB JD 6400 TRACTOR W/JD 640 LDR ............................. CALLN JD 2955 TRACTOR ...................................................... $28,500S JD 5525 TRACTOR, LDR, MFWD, 12/12 TRANS ........ $48,500S JD 2940 TRACTOR, CAB, LDR, 2WD .......................... $13,495N JD 5400 TRACTOR, MFWD, LDR ................................ $29,000B MONT. 5740 LIKE NEW, 55 HP, CAB, LDR ......................... $30,000S JD 5325 TRACTOR, MFWD, O/S, 12/12 TRANS,LDR .. JUST INN JD 5310 MFWD, LDR, O/S, SYNCHRO ........................ $35,000T JD 2640 2WD, CANOPY ............................................. $12,000T JD 2440 2WD TRACTOR W/DUAL LOADER ................ $13,500T JD 2440 2WD, LDR, 16.9X28, 2006 HRS .................... $15,000M JD 2440 MFWD TRACTOR W/LDR ............................. $14,500G JD 2040 2WD TRACTOR ............................................. $9,000S AGCO 8745 O/S TRACTOR, MFWD, LOADER ................... $28,950B JD 2520 GAS, FARMHAND F11 LOADER .................... $8,500M JD 820 3CYL UTILITY TRACTOR W/LDR ................... $8,500S ZETOR 7000 UTILITY TRACTOR ......................................... CALLN IH 400 2WD UTILITY TRACTOR W/LDR ................... $5,500S MF 245 ORCHARD TRACTOR .................................... $3,995S JD U OLD UTILITY TRACTOR ................................. $3,000

TRACK TRACTORSLoc. Make Model Description RetailN JD 9620T 36” TRACKS, BAREBACK, 2500 HRS ....... $200,000M CAT 75C NEW TRACKS, SERVICE RECORDS.......... $80,000M CAT D4E 5 ROLLER, FACT. CAB, 3-SCV, 200HP ...... $21,000M CAT D4 84J TRACTOR W/BLADE ................................ $7,800G CAT D5 98J CRAWLER................................................ $4,500

ROW CROPLoc. Make Model Description RetailN JD 8300 MFWD, 20.8X42 DUALS, PTO, RADAR .......$65,000S JD 8110 MFWD,20.8X38 DUALS, PTO, 3PT .............$79,000N JD 7420 TRACTOR, CAB, MFWD .............................$69,000T CIH JX100U CAB, MFWD, LX152 LOADER .....................ON RENTT JD 7410 TRACTOR, CAB, MFWD, 4812 HRS. ...........$49,500T JD 4040 CAB, 2WD, LOADER, P.S. ............................$33,500S JD 4040 TRACTOR, CAB, MFWD .............................$21,950S JD 4020 2WD TRACTOR ...........................................CALLG JD 4020 2WD TRACTOR, LOADER, NICE ..................CALLG CIH 7110 TRACTOR, CAB, 2WD, 3PT. PTO .................$39,000B JD 4050 ROW CROP TRACTOR ................................$25,000


With equipment depreciation, the original lump-sum value of equipment is reduced in asset value over the life of the equip-ment. Each year the dollar value of that year’s depreciation is reflected as an expense for that year. The IRS allows taxpayers to use equipment depreciation as a tax deduction provided that the specific equipment is used in a business or business activity.

Use Equipment Depreciation as a Tax Deduction

Step 1 - Maintain a file on each piece of equipment for which you will use equipment depreciation as a tax deduction. Include the purchase date, the date it was placed in service, the purchase price, usage and maintenance records and disposition or salvage. Include a schedule of amounts charged to annual depreciation based on IRS instructions and your actual tax filings.

Step 2 - Keep a master depreciation spreadsheet, listing all the information contained in these equipment files. Use this spread-sheet as your guide when it is time to file your tax return.

Step 3 - Read the IRS Form 4562 Instructions to learn how equipment depreciation figures in your business taxes and what

the IRS expects in the form of record keep-ing from busi-nesses that use equipment de-preciation as a tax deduction.

Step 4 - Con-sult with your

How to Use Equipment Deprecia

1602 E. Trent Ave.

509-535-1708 1-800-873-7428

www.adamstractorco.com

CELEBRATING 80 YEARS

IN BUSINESS!

We Are Very Thankful For Your Business

Since 1929!

M5640SUD with LA102 Loader

B3200 HST with Loader

RTV500

L3240 HST

L2800 HST

M135XDTC

Prices Include LoaderL3240 L2800

-

KUBOTA M SERIES

SHOW SPECIALS

$27,250

$17,545

$18,550

$23,995

$8,495

Photo Circa 1939

Ask About Our 0 DOWN Financing

M7040HDC

Photo Circa 2007

HYDRAULIC, PNEUMATIC & MATERIAL HANDLING HOSE SPECIALISTS

5520 E. Sprague, Spokane WA 99212Serving The Inland Northwest Since 1967

For Making Us Your“ONE-STOP HOSE SHOP”

Gauges • Valves • FittingsQuick Couplers • All Major Brands

SAME DAY LOCAL DELIVERY!1-800-541-6351 www.SpokaneHose.com


accountant or profes-sional tax service or use your commercial tax software to de-termineeach piece of equipment’s statutory depreciation schedule and annual deprecia-tion allowance.

Step 5 - Record this information for Step 4 in your equipment depreciation files, your master depreciation spreadsheet and in the appropriate line for that type of equipment on IRS Form 4562.

Step 6 - Complete IRS Form 4562 with any supplemental sched-ules that may be required to provide additional information.

Step 7 - Record information from IRS Form 4562 as required on your business Schedule C. File both forms with your annual tax return.

Step 8 - Maintain copies of all annual Form 4562 filings at-tached to your Master Depreciation Spreadsheet so that when fil-ing your taxes in future years, you can access the record of your annual depreciation deductions. The most common error that tax-payers make in taking deductions for equipment depreciation is to state prior year depreciation account balances and schedules incorrectly.

There are also many different tax software programs that can be tailored to your needs, which will also keep track of your equip-ment depreciation.

ation as a Tax Deduction

5603 E. 3rd Ave. Spokane, WA | (509) 534-3698 | 1-800-348-8337(Behind House of Hose on Sprague)

WE ARE YOUR FACTORWWWWWWWWWEEEEEEEEEEEEE AAAAAAARRRRRRREEEEEEEEEEEEE YYYYYYYYYOOOOOOOOOUUUUUUUUURRRRRRRRRRRRR FFFFFFFFAAAAAAACCCCCCCCTTTTTTTTOOOOOOOORRRRRRRRRYYYYYYYYYYYYYYRRRRRRRAAAAAAAAAUTHORIZED UUUUUUUUUUUTTTTTTTTHHHHHHHHOOOOOOOOORRRRRRRRIIIIIIIZZZZZZZZZEEEEEEEEEDDDDDDDDDDDD TTTTTTTTTOOL OOOOOOOOOOOOOOOOOOOLLLLLLLLLL RRRRRRRRREBUILDERSEEEEEEEEEBBBBBBBBBBUUUUUUUUUUIIIIIIILLLLLLLLDDDDDDDDDDEEEEEEEEERRRRRRRRSSSSSSSSSSSS

SALESPARTS

SERVICE

MOTORSPARTS

SERVICE

GAS & ELECTRICUNITS IN STOCK!

FS 45 TRIMMER

$14995

Easy-to-use, well- • balanced trimmer for homeowner use

Lightweight, reliable •

and fast starting

Can use nylon line or • STIHL PolyCutTM head

BG 55 HANDHELD BLOWER

$14995

Gret for quickly cleaning driveways, side-• walks and hard-to-reach places

Optional vacuum and gutter kit • attachments available

MS 170 CHAIN SAW

$17995

Designed for occasional wood-• cutting tasks around the home

Includes many of the excel• lent design features of our professional models

Anti-vibration system for • comfortable operation

All prices are XXX-SRP at participating dealers while supplies last. © 2010 STIHL

1602 E. Trent Ave.

509-535-1708 1-800-873-7428

www.adamstractorco.com

We are an AuthorizedService Center

Are you ready for a ?


Call anytime 24 hours a day, 7 days a week. www.findssa.net • Lic #STEELSA044BD • ID Lic. # RCE-391

Spokane, WA New Spokane Office2915 N. DivisionWalkins Welcome

Mon-Fri, 8-5; Sat., 9-5; Sunday by appt.

Finance Officer On Duty Now!Most Approvals Within 24 Hours

ZERO DOWN100% FINANCING

BUY NOW!

“Spit in the eye of

the recession”

NEW PRICES - MAY 2009 ERECTED MONTHLY

SIZE PRICE PAYMENTS (OAC)

24’x24’x10’.....$7,335......$99.00 OAC 120 Mos

24’x30’x10’.....$8,455....$114.12 OAC 120 Mos

24’x36’x10’.....$9,194....$124.09 OAC 120 Mos

30’x30’x10’.....$9,475....$127.88 OAC 120 Mos

30’x40’x10’...$11,279....$152.23 OAC 120 Mos

30’x40’x12’...$12,116....$163.53 OAC 120 Mos

36’x48’x14’...$17,212....$232.31 OAC 120 Mos

40’x60’x14’...$21,923....$295.90 OAC 120 MosPrices do not include tax, delivery, concrete or permits. Erected prices include: 1 overhead

door and 1 man door. Prices include: 40 lb. snow load, higher snow load will be additional.LOCALLY OWNED & OPERATED IN POST FALLS, ID

STEEL PRICES DROP 25%

Slow Cooker Lentil Rice SoupBusy schedules are just the way life is nowadays, so here is a quick slow cooker soup that’s super easy to prepare and healthy for you and your family. Rice, lentils and mixed veggies seasoned with garlic, salt and pepper.

Ingredients

• 2 cups dry lentils

• 2 cups uncooked long grain brown rice

• 1 cup chopped carrots

• 1/2 cup chopped celery

• 1/2 onion, chopped

• 8 cups water

• 1 cup vegetable broth

• 1 teaspoon garlic powder

• 1/2 teaspoon ground black pepper

• 1 tablespoon salt

• 1 cup sliced fresh mushrooms

Directions

1. Place the lentils, rice, carrots, celery, onion, water, broth, garlic powder, ground black pepper and salt in a slow cooker.

2. Cover and cook on low setting for 7 to 8 hours. Stir in the mushrooms 1 hour before serving. Recipe yields 10-12 Servings.


509 927-0655 1-800-735-6347Find Out Why Spokane Structures, Inc.

Is Consistently At The Top … Year After Year

~ 25 Years Under Same Ownership ~ www.spokanestructures.com

SO MUCH MORE THAN A

“POLE BARN”Experience the Flexibility

of Post Frame Construction

Churches

Custom Homes Commercial Centers

Shops Stud Frames Arenas Horse Barns Warehouses

Come See Our Booth at the Ag ShowAsk About Our “5 Free Options”


ST. JOHN HARDWARE & IMPLEMENT CO., INC.

(509) 244-4902Locations also in St. John • Fairfield • Moscow • Nez Perce

THE SAVINGS ARE LOCKED. THE TRACTORS ARE LOADED.

*Offer good at participating dealers. For commercial use only-not intended for personal, family or household use. Customer participation subject to credit qualif cation and approval by CNH Capital America LLC. See your Case IH dealer fori details and eligibility requirements. Down payment may be required. Offer good for a limited time. Not all customers or applicants may qualify for this rate or term. CNH Capital America LLC standard terms and conditions will apply. Taxes, freight, setup, delivery, additional options or attachments not included in suggested retail price. Offer subject to change or cancellation without notice.

0% FINANCING FOR UP TO 48 MONTHS ON FARMALL SERIES TRACTORS*

Take advantage of great rates. Farmall™ Series tractors are tough Case IH tractors that offer the rugged versatility to tackle a variety of chores fast. Models range from 50 to 90 PTO hp, so you're sure to f nd a tractor that's perfectly powered for the jobs you do. With this great f nancing deal,ii our reliable parts and our expert service, there has never been a better time to talk to your Case IH dealer. Stop by today or visit www.caseih.com for more information.

JOIN US TO CELEBRATE THE AXIAL-FLOW EVOLUTION!

ST. JOHN HARDWARE & IMPLEMENT CO., INC.

(509) 244-4902Locations also in St. John • Fairfield • Moscow • Nez Perce

©2009 CNH America LLC., 700 State Street, Racine, WI 53404 USA. All rights reserved. Case IH and CNH Capital are registered trademarks of CNH America LLC.

LET THE CELEBRATION BEGIN HERE! Built by the world leader in harvesting equipment, the Axial-Flow® combine puts more of the grain you grow in its tank. The reason: rotary technology. The harvesting gold standard that Case IH pioneered and perfected over 30 years. Join us to celebrate the 30th anniversary of the Axial-Flow combine.

By Barbara AdamsIn this new world of eco-consciousness,

concern of global warming, home business and entrepreneurship, a gourmet treasury of backyard mini-farm opportunities are

being born. They range from substan-tial extra streams of income to full-time income, and from rooftops, even apart-ments (!) to farms on small acreage. Out of the ashes of the farming disaster in the 1980s came a new form of organ-ic small acreage or backyard farm, the “micro eco-farm.” The Center for the Micro Eco-Farming Movement, there are reports of angora rabbits being raised in apartments, or-ganic herb gardens in backyards selling herbal crafts over the internet, minia-ture sheep, minia-

Start a Mini Farm Business in Your Backyard Or Small Acreage

ture dairy cows, organic fl ower farms on small acreage, heirloom vegetable farms on small acreage, garlic farms on small acreage, fl ower seed farms from backyards, and the list goes on.

Often, they are matched with a home cottage industry, such as spinning wool products from the angora rabbits’ wool or teaching cooking classes on the heirloom vegetable farm.

While most of these home businesses are farms from backyards to small acreages, some of these very small farms are with-in bigger farms. One operates a full time

8321 N. Market St. Spokane, WA 509-467-3130

QUALITY LUBRICANTS OILS & GREASES FOR


ST. JOHN HARDWARE & IMPLEMENT CO.Moscow, ID Nezperce, ID Spokane, WA (509) 244-4902

www.stjohnhardware.com

4 cyl. Diesel Engine50 hp, 4WD, HST

Come See the New “Retro Look:

The Boomer™ T2300 Series utility tractors offer a

surprising combination of power and maneuverable

size. Underneath their stylish exterior lie big horsepower and hydraulic capacity that

allow you to do more work fast.

See Us for Your HAY EQUIPMENT,

TRACTORS & IMPLEMENTS

... on Any New New Holland Tractor or Hay Equipment

thru Feb. 15 Only

Coeur d’Alene, ID208-676-9860

business from two acres, but lives on a 130 acre farm. Another’s husband farms huge acreage owned by a corporate farm, but their own seven acres hosts her full time business of growing beautiful herb and fl ower gardens, growing unusual bedding plants and making gifts from her garden crops for sale in her on-farm gift shop, and hosting weddings and other special events on the farm.

Here’s how it works.

In the 80s, as just one example, hun-dreds of smaller dairy farmers had to go out of business. Cows were injected with hormones to produce massive amounts of milk, and wholesale prices got so cheap, smaller dairy farms just couldn’t earn enough from sales anymore. It was get big or get out. Each cow cost more to keep than what was returned. Plus, many of those who used to see milk as nature’s most wholesome food began to question its health, and sales dropped even further.

So, how would a micro eco-dairy farm to-day make money with fi ve cows on a little more than fi ve acres? They raise the cows organically or certifi ed naturally grown on green pasture (the health benefi ts of this to humans are well-documented, and as-tounding). With that milk, they handcraft artisan cheese, and sell this premium product often retail to upscale markets for eager buyers seeking healthy, humanely

raised, grass-fed artisan cheese... cheese in which customers can even name the cows it came from! The cost to keep each cow is returned many times over. Times have changed. Today, hand-tending, handcraft-ing and allowing customers to reconnect with animals and nature don’t work for large-scale agribusinesses, but they work for smaller parcels and have an eager mar-ket waiting.

For more information about these fami-ly-friendly home businesses that help reju-venate the earth and our connection to it, visit the Center for the Micro Eco-Farming Movement at Micro Eco-Farming www.MicroEcoFarming.comArticle Source http://EzineArticles.com

LUTHERAN CHURCHESServing You in

Rural Areas and Small Towns in Eastern Washington & Idaho

Visit Exhibit #L6 Just Ahead of Main Entrance Lobby on North Wall

Sponsored by The Eastern Washington/Idaho Synod of

The Evangelical Lutheran Church in America314 S. Spruce, Ste. A, Spokane, WA 99201

Questions? We’re here to answer your inquiries.

509-838-9871


Goat farming can provide you with many benefi ts. Goats pro-duce two very important products, milk and meat. Aside from the serious profi ts that you may earn, farming goats can also do won-ders in keeping the ecology at balance. Not only that, many older farmers fi nd raising goats to be an enjoyable activity as it helps keep them busy, without the strain or rigidity that is connected with other farming activities. However, goat raising does require a certain level of expertise, more so if you’re thinking of turning this activity into a business venture. Here are the 3 basic things you need to consider in planning out your very own goat farm.

I. Housing and location

In order to be able to take care of goats properly, you need to make sure that you have an adequate amount of space that is re-quired. Goats are very active animals so keeping them in enclosed spaces will surely be detrimental to their development. The shel-ter that you plan to put up for them should be high and wide enough to accommodate them when they become fully-grown. When it comes to choosing a location, your goat farm shouldn’t be anywhere near forests where wolves and foxes naturally roam.

II. Food and water

Goats naturally need food and water to survive so don’t forget to include these two important aspects in your plans. As goats are known to chew on just about anything and everything, you need to make sure that there are no harmful plants or poisonous vines in your goat farm. There have been many instances of free-range goats dying because of nightshade and mold. If there are any natural water sources within the proximity of the potential goat farm, try to track where the water is coming from, as you wouldn’t want your goats to be drinking water that has been al-ready contaminated by factory waste.

III. Breeds and Breeding

Depending on your motives for farming goats, it’s important that you choose a breed according to their specifi c characteristics. Be sure to check on the lineage of your goats before you purchase them from a breeding farm so that you can avoid any genetic de-

Farming Goats - 3 Basic Essential Factors to Consider in Planning Your Own Goat Farm

TransCanada’s GTN Natural Gas Transmission Pipeline System

has operated safely in the Idaho, Washington and Oregon

markets since 1961

In case of pipeline emergency call 1.800.447.8066www.gastransmissionnw.com

You can also get information about other pipelines that might be located in your community by accessing the federal National Pipeline Mapping System (NPMS)

via the internet at http://www.npms.phmsa.dot.gov

WWW.EXCHANGEPUBLISHING.COM - 1/29/10- Supplement to The Exchange 15formations happening in your own goat farm. As some breeds can cost more than others, you need to research on which type of goats will be able to give you lucrative returns in the long run.

The breeding season for goats in farms is from August to March. The goat’s pregnancy lasts for four months and they are generally bred once a year, so their kids are born between January and Au-gust. The female goats give birth to one to fi ve kids and twins are to be expected.

A female goat in a farm can start mating after the age of seven to nine months while it can be milked when the goat reaches a year. Goats give birth easily, so no special help is needed. However, the farmers need to make sure that the kids nurse from their mother, if they don’t, they should be fed from a bottle. This should be done right after the kid is born as this is when it receives the critical fi rst milk which is called colostrum. After it is fed with colostrum containing minerals, vitamins and antibodies for a few days, the kid could be fed with milk formula or could nurse from its mother.

Breeding goats in a farm is quite similar to breeding cows. The kids of goats should be given a milk formula until they can be weaned; this is after they reach fi ve to sev-en weeks of age. This is the time when the goats are then milked.

If the farmer is interested more in meat production, then the kids of the goats should be nursed from eight to ten weeks. After that they are to be fed hay, grain and pas-ture until they gain enough weight, which can vary from 35 to 90 pounds.

When a farmer is breeding goats for their meat, he should consider the goats’ breed and then decide what optimal weight the goats should reach. Different breeds of goat reach different weight.

There you have it, the 3 basic essential factors you need to consider before you start farming goats. Whether you’re planning to raise goats for profi t or for leisure, being duly prepared is the fi rst step in turning this endeavor into a success.

ORNAMENTAL IRON

OPEN TO THE PUBLIC

METALS

509-535-6363

SINCE 1884

(509) 922-34561-800-326-2223

[email protected]

Call Us Today!

WWW.FLEXXIFINGER.COM QD INDUSTRIES INC.

A NECCESSITYFOR PULSEGROWERS

“My brother and I harvested 1200 acres of peas in 2005-2006, and bumped our seeded acres up to 1600 for the 2006-2007

crop year. The Flexxifinger™ QD™ Pulse Crop Lifter is superior to any pea lifter we have used in the past. We were looking for a lifter that would allow us to pick our header up off the ground just far enough to allow us to travel at a good ground speed without

damaging the header. If you do hit a dead head, repairs take two minutes, and this lifter does not interfere with the reel. If the neighbors ask me what I know about growing peas, I tell them to

put Felxxifinger™ QD™ Pulse Crop Lifters on the header.”

- Barrie Elliot (Reston, Manitoba)

The choice of mechanized farmers worldwide.™FOR MORE INFORMATION, CALL 306.642.4555

Winner, Best New Invention, 2006 Western Canada Farm Progress Show

Stop by and See us at Booth #22


2004 FORD F-350

2003 FORD F-250 XLT 2002 CHEVY 1500 LS 2005 DODGE RAM 1500 SLT

1995 CHEVY K-3500

2008 CHEVY 1500 4x4 2000 CHEVY SILVERADO 4x4 2005 FORD F-150 4x4

2006 FORD F-350 XLT 1997 FORD F-150 XLT 2008 DODGE RAM 2500

2004 CHEVY Z71 4x4 2004 CHEVY DURAMAX 2500 2002 CHEVY 1500 4x4

We Take Anything in Trade!

CONSUMERCONSUMER AUTO LIQUIDATORSAUTO LIQUIDATORS

CARFAX Available on All

VehiclesMILITARY DISCOUNT ~ Thank You for Your Service

The Corner of Hwy 2 & Hayford Road • Airway Heights

509 509 244-2277244-2277 www.wesayyes.net

WE ARE A LIQUIDATOR.We Handle Repo’s, Commercial

Consignments, Returns, Overstocks, etc.All Prices Are Negotiable. Your Satisfaction Is Not.

All Vehicles Subject to Prior Sale • Prices based on Kelley Book Jan. ‘10Prices Good Until 2/4/2010

Open 7 Days a Week • Mon-Sat 9-7 • Sun 11-5

VALLEY3711 E. Sprague Ave.

Spokane Valley, WA 99202

PASCO1226 Auto Plex WayPasco, WA 99301

#15427

PowerstrokePowerstroke

4x4!4x4!

HemiHemi4x4!4x4!

#14694

4x4!4x4!#14880

#15491

#15484

4x44x4Lifted Lifted RightRight

#15718

$15,961$15,961

AG SHOW AG SHOW

SPECIAL!SPECIAL!

LiftedLiftedBad Bad

Jonny!Jonny!

10k10kUpgrades!Upgrades!

#15636

4x4 4x4 LiftedLifted

Bad Boy!Bad Boy!

#15667

LowLowMiles!Miles!14,38314,383

$31,991$31,991

Low MilesLow Miles

Super Bad Jonny!Super Bad Jonny!

#15407

AG SHOW AG SHOW

SPECIAL!SPECIAL!

AG SHOW AG SHOW

SPECIAL!SPECIAL!AG SHOW AG SHOW

SPECIAL!SPECIAL!4x4 4x4

For Less!For Less!

$3,997$3,997

AG SHOW AG SHOW

SPECIAL!SPECIAL!

$26.433$26.433

$17,238$17,238

#14226

AG SHOW AG SHOW

SPECIAL!SPECIAL!Nice Nice

Pickup!Pickup! AG SHOW AG SHOW

SPECIAL!SPECIAL!

Call for Call for

PricePrice

#15579

49k!49k!

This Truck Is This Truck Is

a True Custom a True Custom

Sleeper!Sleeper!

$19,973$19,973

#15592

AG SHOW AG SHOW

SPECIAL!SPECIAL!LiftedLiftedRightRight

& Tight!& Tight!

2007 CHEVY SILVERADO 4x4

$19,378$19,378

AG SHOW AG SHOW

SPECIAL!SPECIAL! Long Bed!Long Bed!

#14939

$19,993$19,993

LiftedLiftedBad Johnny!Bad Johnny!

#15170

PowerstrokePowerstroke

4x4!4x4!

AG SHOW AG SHOW

SPECIAL!SPECIAL!

$5,993$5,993

#14867

AG SHOW AG SHOW

SPECIAL!SPECIAL! Dually 4x4Dually 4x4

Work Horse!Work Horse!

AG SHOW AG SHOW

SPECIAL!SPECIAL!

$11,991$11,991

AG SHOW AG SHOW

SPECIAL!SPECIAL!

$8.793$8.793 $12,138$12,138

AG SHOW AG SHOW

SPECIAL!SPECIAL!

$20,238$20,238

COME SEE US AT THEFEB. 2-4, 2010

Spokane Convention Center!

500500

120 TRUCKS!120 TRUCKS! 30 DIESELS!30 DIESELS!

AG SHOW AG SHOW

SPECIAL!SPECIAL!

4x44x4Cummins!Cummins!

SuperSuperCrew!Crew!

Ag Expo 2010 - Spokane WA

Documents

Transcript of Ag Expo 2010 - Spokane WA