Immunopharmacology and inflammation

Activation of central muscarinic receptor type 1 prevents developmentof endotoxin tolerance in rat liver

Golnar Eftekhari a, Khalil Hajiasgharzadeh a, S. Mohammad Ahmadi-Soleimani a,Ahmad R. Dehpour b, Saeed Semnanian a, Ali R. Mani a,b,n

a Department of Physiology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iranb Experimental Medicine Research Center, Tehran University of Medical Sciences, Tehran, Iran

a r t i c l e i n f o

Article history:Received 28 February 2014Received in revised form24 June 2014Accepted 26 June 2014Available online 4 July 2014

Keywords:Endotoxin toleranceInflammationLiverMuscarinic type 1 receptor

a b s t r a c t

Endotoxin tolerance is a mechanism in which cells receiving low doses of endotoxin, enter a transientphase with less inflammatory response to the next endotoxin challenges. Central nervous system isknown to modulate systemic inflammation through activation of the cholinergic system; however, therole of central anti-inflammatory pathway in pathophysiology of hepatic endotoxin tolerance isunknown. Our study was designed to assess the effect central muscarinic type 1 receptor (M1) activationon development of endotoxin tolerance in rat liver. Endotoxin tolerance was induced by dailyintraperitoneal injection of endotoxin (1 mg/kg) for 5 days. Animals were randomly divided into twogroups which received intracerebroventricular injection of either MCNA-343 (an M1 agonist, 5 ng/kg) orsaline 1 h after intraperitoneal injection of saline or endotoxin. The responsiveness to endotoxin wasassessed by measuring hepatic MCP-1 (monocyte chemotactic protein-1), iNOS (inducible nitric oxidesynthase) and TNF-α (tumor necrosis-α) mRNA expression 3 h after intraperitoneal administration ofendotoxin using quantitative RT-PCR. A significant reduction in hepatic expression of MCP-1, iNOS andTNF-α was observed in rats with 5 days endotoxin challenge in comparison with rats given a single doseof endotoxin. There was no significant difference in hepatic expression of MCP-1, iNOS or TNF-α betweenacute and chronic LPS-treated groups in rats given MCNA-343. Central MCNA-343 stimulation couldprevent the induction of hepatic endotoxin tolerance in animals receiving repeated doses of endotoxin.This indicates that M1 cholinergic receptor activation in the central nervous system can modulateendotoxin tolerance in rat liver.

& 2014 Elsevier B.V. All rights reserved.

1. Introduction

Sepsis is still the major reason for mortality in intensive careunits (Angus et al., 2001). Endotoxin or lipopolysaccharide (LPS) isthe most important constituent of the outer membrane in gram-negative bacteria which stimulates the production of pro-inflammatory cytokines in sepsis. Sepsis is hard to cure and suchdifficulty stems from its complicated biphasic nature. It beginswith an initial inflammatory response that leads to an immuno-adaptive phase in which cells become un-responsive and tolerantto endotoxin (Biswas and Lopez-Collazo, 2009; Medvedev, 2000;Buras et al., 2005). Endotoxin tolerance is a classic form ofprotective mechanisms in which cells receiving low doses ofendotoxin, enter a transient phase of hypo-responsiveness to thenext endotoxin challenges (Cavaillon and Adib-Conquy, 2006;

Biswas et al., 2007). This phenomenon has been observed in bothin vitro and in vivo models (Cavaillon and Adib-Conquy, 2006;Biswas et al., 2007; Biswas and Lopez-Collazo, 2009; Biswas andTergaonkar, 2007; Dobrovolskaia and Vogel, 2002; Del Fresno etal., 2009).

Liver is an important organ that is involved in pathophysiologyof systemic inflammation and releases acute phase proteins inresponse to endotoxin challenge. Liver is the only organ in thebody that is in continuous exposure to gut-derived endotoxins(Fox et al., 1989). It appears that there is a reciprocal relationshipbetween liver and central nervous system during inflammation(Campbell et al., 2008). Systemic inflammation is a major compo-nent in the genesis of neural dysfunction in patients with liverfailure (Wright et al., 2007). Neuro-inflammation is also associatedwith activation of hepatic nuclear factor kappa B (NFκB) activation(Campbell et al., 2008). Thus, it seems that there might be amutual connection between brain and liver during inflammation.

There are internal protective mechanisms which regulate theimmune response and prevent extensive inflammation. Centralnervous system is able to inhibit the release of inflammatory

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/ejphar

European Journal of Pharmacology

http://dx.doi.org/10.1016/j.ejphar.2014.06.0500014-2999/& 2014 Elsevier B.V. All rights reserved.

n Corresponding author at: Department of Physiology, Faculty of MedicalSciences, Tarbiat Modares University, Jalal-Ale-Ahmad Highway, Tehran, Iran.Tel.: þ98 2188853577.

E-mail address: mani@modares.ac.ir (A.R. Mani).

European Journal of Pharmacology 740 (2014) 436–441

cytokines and decrease systemic inflammatory response throughactivation of the cholinergic system in a significant and rapidmanner (Tracey, 2002; Borovikova et al., 2000). Pavlov et al. (2006)showed that stimulation of brain muscarinic type 1 receptor (M1)modulates systemic inflammation probably through activation ofthe vagus nerve. It appears that the alpha7 nicotinic acetylcholine(α7nACh) receptor is the main target of vagus nerve-mediatedcholinergic anti-inflammatory pathway in a variety of tissuesincluding liver (Wang et al., 2003). Recent studies showed thatthe highest accumulation of a radio-labeled α7nAChR ligand wasobserved in the liver in humans (Sakata et al., 2011). Hypo-responsiveness to chronic endotoxin exposure (endotoxin toler-ance) has also been reported in liver (Fernández et al., 2002),however, the role of central anti-inflammatory pathway in patho-physiology of hepatic endotoxin tolerance is unknown. In order tostudy the effect of neural mechanisms on hepatic inflammation wedesigned an experiment and discovered that central M1 receptoractivation can modulate hepatic inflammation in rats and thisstudy reports our investigations on the effects of central M1

receptor activation on development of hepatic endotoxin tolerancein rats.

2. Materials and methods

2.1. Animals

All experimental procedures, animal care and maintenancewere in accordance with the guidelines of Animal Ethics Commit-tee of Tarbiat Modares University. Male Sprague-Dawley ratsweighting 260–330 g were purchased from Razi Institute (Hesarak,Iran). Rats were kept four per cage under standard room tempera-ture conditions (22–25 1C), with wood chip bedding and adlibitum access to pellet food and water on a 12 h light/dark cycle.

2.2. Experimental groups

The study was carried out in 6 groups which are presentedschematically in Fig. 1 (n¼6–10 in each group). All rats underwentstereotaxic cannulation of left cerebral ventricle 2 weeks beforesaline or endotoxin injections. Endotoxin tolerance was induced bydaily intraperitoneal injection of 1 mg/kg lipopolysaccharide (LPS,

from Salmonella typhimurium) for 5 days (Fernández et al., 2002).Control groups were considered by daily intraperitoneal injectionof saline for 5 days. During this 5 days LPS or saline injections,animals were randomly divided into two groups which receivedintracerebroventricular (i.c.v.) injection of either MCNA-343 (5 ng/kg) (a muscarinic type 1 receptor agonist) (Pavlov et al., 2006) orsaline 1 h after intraperitoneal injection of saline or LPS. At day6 the responsiveness to endotoxin was assessed by intraperitonealadministration of LPS (1 mg/kg) or saline as shown in Fig. 1. In allexperiments, liver tissue samples were harvested 3 h after the lastLPS or saline injection and were kept in liquid nitrogen until theday of RNA extraction.

2.3. Stereotaxic surgery

In preparation for surgery, all animals were anesthetized byintraperitoneal injection of a mixture of Ketamine (100 mg/kg) andXylazine (10 mg/kg). Rats were placed in stereotaxic apparatus(model 51603, Stoelting Co) and the animal's heads were immobi-lized using bilateral rodent ear bars. Stainless steel guide cannulae(23 gauge) were lowered down stereotaxically to 1 mm above theleft ventricle. This was to minimize the physical damages in the siteof injection. Anatomical coordinates were also as follows: 1.3 mmlateral and 0.9 mm caudal to Bregma at a depth of 3.5 mm (relativeto the dura matter). The guide cannulae were also firmly anchoredto the skull using dental acrylic cement and two tiny stainless steelscrews. To prevent obstruction, at the end of each surgery, theopenings of the guide cannulae were capped with an equal lengthstainless steel stylet (gauge 30) which was then removed at thetime of injection. After surgery, animals were allowed to recover fortwo weeks. MCNA-343, dissolved in saline, was injected intracer-ebroventricularly (i.c.v., 5 ng/kg) (Pavlov et al., 2006) via a 10-μlHamilton syringe which was indirectly connected to an injectioncannulae (gauge 30) through a no. 20 polyethylene tube. Also, equalvolumes of saline were injected in control groups to rule out theeffect of solvent. In all experiments, drugs were injected during2 min and the injection cannulae were also left in the site for 2 minbefore being gently removed to let the drug diffusion evolve andprevent from drug's backflow. The position of the cannulae washistologically verifies at the end of experiment using i.c.v. injectionof Pontamine sky blue as described (Ranjbar-Slamloo et al., 2012).

Control

Acute LPS

Chronic LPS

Fig. 1. The timeline of the study in the experimental groups.

G. Eftekhari et al. / European Journal of Pharmacology 740 (2014) 436–441 437

2.4. Real time RT-PCR protocol

Quantitative RT-PCR was used to study the expression of MCP-1(monocyte chemotactic protein-1, also known as CCL2), iNOS(inducible NO synthase), TNF-α (tumor necrosis-α) and transform-ing growth factor-beta (TGF-β) in the experimental groups. Forquantitative RT-PCR, 18 s ribosomal RNA was used as internalstandard (housekeeping gene). Total RNA extraction was carriedout using Roche high pure RNA tissue kit (Mannheim, Germany)according to the manufacturer protocol. DNA elimination wasachieved by adding DNase (Qiagen, Germantown, MD, US) duringRNA extraction. Reverse transcription was performed using cDNAreverse transcription kit (Aryatous Biotech, Tehran, Iran). Oligonu-cleotide primers used for PCR were as follows:

a. Rattus norvegicus MCP-1, NM-031530.1, PCR product size:157 bp.Forward: 50–GGGCCTGTTGTTCACAGTTGC-30, Reverse: 50- GGG-ACACCTGCTGCTGGTGAT-30.

b. Rattus norvegicus iNOS, NM- 012611.3, PCR product size: 121 bp.Forward: 50–ACCCAAGGTCTACGTTCAAGACA, Reverse: 50–GCA-TGGCTCGGGATGTG.

c. Rattus norvegicus TNF-α, NM012675.3, PCR product size: 213 bp.Forward: 50–CCGATTTGCCATTTCATACC, Reverse: 50–GAGTCCGG-GCAGGTCTACTT.

d. Rattus norvegicus TGFβ1, NM-021578.2, PCR product size: 294 bp.Forward: 50–ATACGTCAGACATTCGGGAA-30, Reverse: 50–AGCAAA-GATAATGTACTCCAC-30.

e. Rattus norvegicus 18S, NR-046239.1, PCR product size: 109 bp.Forward: 50–ATCAACTTTCGATGGTAGTCG-30, Reverse: 50–TCC-TTGGATGTGGTAGCCG-30.

PCR reactions comprised of 1 μl of cDNA template, 10 pmol each offorward and reverse oligonucleotide primers, 10 μl of optimized PCRmastermix (Ampliqon, Denmark) in a total reaction volume of 20 μl.

After 15 min incubation at 95 1C, PCRs were done using a 60 sannealing step, followed by a 45 s elongation step at 72 1C and a45 s denaturation step at 95 1C.

The expression of TNF-α, iNOS, MCP-1 and TGF-β was assessedby real-time PCR using a Rotor-Gene Q machine (Qiagen, Hilden,Germany). The level of transcriptional difference between experi-mental group and control group was evaluated relative to the levelof 18S RNA expression.

2.5. Serum alanine aminotransferase (ALT), aspartateaminotransferase (AST) assay

Serum samples from the control and BDL groups were analyzedfor alanine aminotransferase (ALT), aspartate aminotransferase(AST) and total bilirubin using an auto-analyzer.

2.6. Statistical analysis

Data are expressed as Mean7S.E.M. We used a Kolmogorov–Smirnov method to test the distribution of our data and our datadid not show a Gaussian distribution. Therefore, non-parametricKruskal–Wallis and Dunn's post hoc tests were used for statisticalanalyses. P-values less than 0.05 were considered significant.

3. Results

Overall, 47 animals were used in the experimental groups and5 animals did not complete the study due to complications ofchronic i.c.v. injections. These rats were from groups 3 (n¼1),4 (n¼2) and 6 (n¼2). Gene expression analyses were performed

on 42 liver samples. Serum AST and ALT activity of rats given acuteor chronic injection of endotoxin (7 MCNA-343) is shown inTables 1 and 2. There was no statistically significant difference inplasma liver enzymes activity between the experimental groups.This indicates that in our experimental setting acute or chronicinjection of endotoxin (1 mg/kg) does not induce hepatocytenecrosis in rats.

3.1. Effect of chronic endotoxin administration on hepatic expressionof MCP-1, iNOS, TNF-α and TGF-β

Fig. 2 shows the expression of hepatic MCP-1 in rats givenacute or chronic LPS in comparison with control group. The resultsshowed that acute LPS injection could significantly induce anincrease (�25-fold, Po0.01) in the expression of MCP-1. ChronicLPS injection for 6 days was associated with a significant reductionin hepatic MCP-1 mRNA level in comparison with acute LPS group(Po0.05). Likewise, hepatic iNOS expressed increased (�29-fold,Po0.001) after acute LPS challenge (Fig. 3). Chronic LPS adminis-tration was unable to increase iNOS expression and there was asignificant difference in iNOS mRNA level between acute LPS andchronic LPS treated animals (Po0.01, Fig. 3).

The expression of TNF-α in liver samples is shown in Fig. 4.There was a �31-fold and significant increase in TNF-α mRNAafter acute LPS injection (Po0.001). Attenuation of hepatic TNF-αexpression did not reach a statistically significant level afterchronic LPS administration (Fig. 4).

We also assessed hepatic TGF-βmRNA levels and observed thatunlike acute injection, chronic administration of endotoxin wasassociated with a significant increase in TGF-β expression(Po0.05). TGF-β mRNA level in chronic LPS-treated rats was alsohigher in comparison with acute LPS group (Po0.05) (Fig. 5).

3.2. Effect of chronic endotoxin administration on hepatic expressionof MCP-1, iNOS, TNF-α and TGF-β in presence of MCNA-343

Fig. 2 shows the expression of hepatic MCP-1, in experimentalanimals that had received the muscarinic type 1 receptor agonist(MCNA-343) for 5 days. The results showed that both acute andchronic injection of LPS could significantly increase the expressionof MCP-1 in rats given MCNA-343 (Po0.05). There was nosignificant difference in hepatic expression of MCP-1 betweenacute and chronic LPS-treated groups in presence of 5 days centralmicroinjection of MCNA-343. This indicates that stimulation ofcentral muscarinic type1 receptors prevents the induction ofendotoxin tolerance in animals receiving repeated doses of LPS.

Table 1Serum activity of alanine aminotransferase (ALT, U/l) in the experimental groups.6–10 rats were used in each group.

Experimental group i.c.v. injection of saline i.c.v. injection of MCNA-343

Saline 6275 4473Acute LPS 79717 82713Chronic LPS 6079 6078

Table 2Serum activity of aspartate aminotransferase (AST, U/l) in the experimental groups.6–10 rats were used in each group.

Experimental group i.c.v. injection of saline i.c.v. injection of MCNA-343

Saline 9676 10677Acute LPS 11577 96717Chronic LPS 11276 11078

G. Eftekhari et al. / European Journal of Pharmacology 740 (2014) 436–441438

As shown in Fig. 2, within the chronic LPS injected groups, therewas a significant difference in MCP-1 expression between MCNA-343-treated (i.c.v.) and saline-treated (i.c.v.) groups (Po0.05).

The expression of hepatic iNOS in experimental animals givenMCNA-343 for 5 days is shown in Fig. 3. The results showedthat acute LPS injection could significantly induce an increase(Po0.01) in the expression of hepatic iNOS inMCNA-343-treated

animals. Likewise, Chronic LPS injection could also significantlyincrease the hepatic expression of iNOS in presence of chronicMCNA-343 administration. There was no significant difference inhepatic expression of iNOS when acute LPS (þ MCNA-434) groupwas compared with chronic LPS (þ MCNA-343) animals. As shownin Fig. 3, within the chronic LPS injected groups, there was asignificant difference in iNOS expression between MCNA-343-treated (i.c.v.) and saline-treated (i.c.v.) groups (Po0.05).

Fig. 4 shows the expression of hepatic TNF-α, in rats receivedacute or chronic LPS in presence of daily MCNA-343 administra-tion for 5 days. The results showed that both acute and chronicinjection of LPS could significantly increase the expression of TNF-α in rats given MCNA-343 (Po0.01 and Po0.05 respectively).There was no significant difference in hepatic expression of TNF-αbetween acute and chronic LPS-treated groups in rats givenMCNA-343. All above findings indicate that central MCNA-343stimulation prevents the induction of endotoxin tolerance inanimals receiving repeated doses of LPS.

Hepatic TGF-β expression in MCNA-343-treated rats showedthe same pattern that was observed in rats that received its vehicle(Fig. 5). Chronic LPS injection significantly induced a 4.3-fold in theexpression of TGF-βmRNA level in comparison with control group(Po0.05). Also, there was a significant elevation of TGF-β mRNAlevel when acute LPS group was compared with chronic LPS group(Po0.05, Fig. 5).

4. Discussion

Our study was designed to assess the effect central M1 receptoractivation on development of endotoxin tolerance in liver. Weobserved that chronic administration of endotoxin leads to areduction in hepatic expression of MCP-1, TNFα and iNOS. Thisobservation shows the occurrence of endotoxin tolerance in ourexperimental model (rat liver tissue). This finding is in line withScott et al. (2009) report indicating the occurrence of endotoxintolerance in isolated hepatocytes. Our data demonstrate that inanimals receiving i.c.v. microinjection of an M1 receptor agonist,both acute and chronic endotoxin administration significantlyincreased the expression of MCP-1, TNFα and iNOS. However,there was no significant difference between animals receiving M1

receptor agonist after acute LPS injection and animals receiving M1

receptor agonist after chronic LPS administration. Thus, it stands toreason that the central stimulation of M1 receptor agonist couldprevent endotoxin tolerance in liver tissue which in turn seems tobe a novel finding. We used 1 mg/kg endotoxin challenge based onprevious reports that indicate that 5 days injection of this dose(1 mg/kg) of LPS can induce hepatic tolerance (Fernández et al.,

Saline Acute LPS Chronic LPS0.5

1248

163264

128

icv salineicv MCNA343

b,d

a a*

MC

P-1

mR

NA

expr

essi

on(r

elat

ive

to 1

8S)

++++#

Fig. 2. Hepatic expression of MCP-1 mRNA in the experimental groups. þPo0.05,and þþPo0.01 in comparison with corresponding Saline-treated rats. # Po0.05in comparison with chronic LPS (given saline intracerebroventricularly). * Po0.05.6–10 rats were used in each group. Y-axis represents the relative level oftranscriptional difference (MCP-1/18s).

Saline Acute LPS Chronic LPS0.5

1248

163264

128

icv salineicv MCNA343

*a

bc,e

iNO

S m

RN

Aex

pres

sion

(rel

ativ

e to

18S

)

+

+++++##

Fig. 3. Hepatic expression of iNOS mRNA in the experimental groups. þPo0.05,þþPo0.01, and þþþPo0.001 in comparison with corresponding Saline-treatedrats. ## Po0.01 in comparison with chronic LPS (given saline intracerebroven-tricularly). * Po0.05. 6–10 rats were used in each group. Y-axis represents therelative level of transcriptional difference (iNOS/18s).

Saline Acute LPS Chronic LPS0.5

1248

163264

128

icv salineicv MCNA343

cb a

TNF-

mR

NA

expr

essi

on(r

elat

ive

to 1

8S) +++

+++

Fig. 4. Hepatic expression of TNF-α mRNA in the experimental groups. þPo0.05,þþPo0.01, and þþþPo0.001 in comparison with corresponding Saline-treatedrats. 6–10 rats were used in each group. Y-axis represents the relative level oftranscriptional difference (TNF-α/18s).

Saline Acute LPS Chronic LPS0.5

1

2

4

8

TGF-

mR

NA

expr

essi

on(r

elat

ive

to 1

8S)

Fig. 5. Hepatic expression of TGF-βmRNA in the experimental groups. þPo0.05 incomparison with corresponding Saline or Acute LPS-treated rats. 6–10 rats wereused in each group. Y-axis represents the relative level of transcriptional difference(TGF-β/18s).

G. Eftekhari et al. / European Journal of Pharmacology 740 (2014) 436–441 439

2002). Another advantage of this dose is that acute injection of1 mg/kg of LPS is associated with hepatic and systemic inflamma-tion without inducing hepatocyte necrosis or mortality (Mani etal., 2006; Mazloom et al., 2013).

The mechanism of endotoxin tolerance is not well understood.It appears that a complex network of pathways is involved(Fu et al., 2012). There is evidence to support that TGF-β mightplay a role in development of endotoxin tolerance (Sly et al., 2004;Haddadian et al., 2013). Draisma et al. (2009) showed that TGF-βexpression increased in the refractory phase of endotoxin toleranceand may play a role in development of endotoxin tolerance. Ourresults indicated that the expression of TGF-β increased signifi-cantly in animals receiving chronic LPS injections in comparisonwith control group as well as rats with acute LPS challenge. Thisfinding corresponds with previous reports indicating that theexpressionof TGF-β increases significantly during endotoxin tolerance phase(Sly et al., 2004; Biswas and Lopez-Collazo, 2009). As mentionedabove, endotoxin tolerance did not occur in animals receiving M1

receptor agonist after chronic LPS administration. Thus theincreased level of TGF-β expression in rats which had not developedendotoxin tolerance, rules out direct involvement of TGF-β in theinduction of endotoxin tolerance through central stimulation of M1

muscarinic receptor. Another postulated mechanism for hepaticendotoxin tolerance seems to be mediated by SOCS1 (Suppressor ofCytokine Signaling-1)–Dependent Mechanisms (Scott et al., 2009).We measured hepatic SOCS1 expression in our samples and wewere unable to show a significant change in SOCS1 mRNA levelsfollowing central M1 receptor stimulation (unpublished observa-tion). We do not know the precise mechanism of the effect ofcentral M1 receptors on hepatic inflammation but it seems thatthere is no evidence for the involvement of TGF-β or SOCS1 in thegenesis of this effect.

Although there is evidence to indicate that there is a reciprocalrelation between liver and brain during inflammation, the exactmechanism of this interaction is unknown (Campbell et al., 2008).Liver receives innervation from sympathetic and parasympathetic(vagal) nervous system. According to Tracey (2002), vagus nervestimulation is able to decrease inflammation in a variety organs; aphenomenon which is mainly mediated through activation ofα7nACh receptors. Previous findings have shown that α7nAChreceptors are expressed in liver (Soeda et al., 2012) and involved inmodulation of mouse hepatocyte apoptosis (Hiramoto et al., 2008)and ischemia reperfusion injury in rats (Park et al., 2013). Based onabove evidence we hypothesized that the hepatic branch the vagusnerve may play a role in modulation of inflammation duringendotoxin tolerance. Pavlov et al. (2006) demonstrated that i.c.v.injection of an M1 agonist (MCNA-343) increases the vagal activityand could modulate inflammation in rats with systemic inflam-mation. Based on this report we assessed the effect of MCNA-343on development of hepatic endotoxin tolerance. Our initial expec-tation was that chronic i.c.v. administration of MCNA343 mightfacilitate endotoxin tolerance. In contrast we observed that centralMCNA-343 administration prevents development of endotoxintolerance in the liver. Liver is the only organ in the body that isin continuous exposure to gut-derived endotoxins. Portal vein isthe main source of gut-derived LPS and the liver has the ability toclear endotoxin from circulation (Fox et al., 1989). Since thehepatocytes are in continuous exposure to endotoxins, it remainsan open question why hepatocyte do not develop tolerance toexogenous endotoxin challenges and keep their ability to produceacute phase proteins and cytokines in response to LPS. We suggestthat tonic activation of the central cholinergic anti-inflammatorypathway might increase the threshold of activation of inflamma-tory response to the gut-derived endotoxins by hepatocytes. Suchmechanism increases the threshold for innate immune system

activation in the liver and ensures minimal inflammatory responseto gut-derived endotoxins. Based on this hypothetical mechanism,chronic stimulation of the central anti-inflammatory pathway (e.g.through central M1 receptor activation) might be associated with ahigher threshold for hepatic inflammatory response. Thus, con-current chronic endotoxin and central MCNA-343 administrationmay suppress the inflammatory response and inhibit initiation ofthe pathways leading to endotoxin tolerance. Although suchspeculation is interesting within the context of cholinergic anti-inflammatory reflex, this model can be tested experimentally infuture studies.

One of the limitations of the present study is that we did notmeasure hepatic vagal activity after central MCNA-343 injections.Pavlov et al. (2006) showed that based on heart rate variabilitystudies, central M1 activation can increase vagal activity in rats.Short-term heart rate variability deals with cardiac vagal activityand does not necessarily reflect the activity of hepatic vagus nerve(Mani et al., 2009). Electrophysiological recoding from hepaticbranch of the vagus nerve in conscious rats is technically challen-ging and was not carried out in our study. Therefore, the effect ofMCNA-343 might not exclusively be explained through activationof the hepatic vagus nerve and other mechanism may be involved.

We used real time RT-PCR which is a very sensitive and reliabletool for assessment of gene expression during inflammation. Toconfirm our results at protein level, we collected sera from controland endotoxemic animals (treated with i.c.v. microinjection ofeither saline or MCNA-343) and measured interleukin-6 (IL-6)levels using a commercial kit (rat IL-6 platinum ELISA, eBioscience,Vienna, Austria). Although we could see a linear standard curve forrat recombinant IL-6 (30–2000 pg/ml), the level of IL-6 in most ofour samples was below the detection limit of most commerciallyavailable ELISA kits (10 pg/ml). Therefore we could not compareserum IL-6 level between our experimental groups and ourinvestigation could only represent hepatic expression of pro-inflammatory markers at mRNA level. Another limitation of ourstudy is that we only looked at the effects of i.c.v. injection of a M1

cholinergic agonist of expression of pro-inflammatory markers inthe liver. Endotoxemia is associated with systemic inflammationand affects most of tissue and organs (e.g. kidney, and centralnervous system). We did not investigate the effect of central M1

receptor activation on extra hepatic tissues and this can be carriedout in future studies.

The network of cholinergic signaling and innervation is complexwithin the central nervous system and our current knowledge onbrain cholinergic areas that interact with the immune system is verylimited. Therefore, we did not choose any specific brain nuclei for themicroinjection of MCNA-343 and instead administered this M1

cholinergic agonist using an i.c.v. cannulae. The selection of dose andthe type of cholinergic agonist were based on Pavlov et al. (2006)report who demonstrated that i.c.v. injection of MCNA-343 canmodulate systemic inflammation. In the same report, Pavlov et al.(2006) showed that cholinergic modulation of systemic inflammationis a complex process and both cholinergic antagonists and antagonistmay suppress systemic inflammation. This observation indicates thecomplexity of cholinergic control and can be explained by theexistence of pre-synaptic muscarinic auto-receptors that regulate therelease of acetylcholine in the synaptic cleft (Pavlov et al., 2006).Future studies can test the effect of gene silencing or antagonists ofdifferent subtypes of cholinergic receptors in development of endo-toxin tolerance in experimental animals.

Endotoxin tolerance is linked with mortality in critically illpatients (Otto et al., 2011). We showed that central M1 receptorsmight be a pharmacologic target in animal model of systemicinflammation. Understanding the role of central mechanism inmodulation of endotoxin tolerance might pave the way to developnew therapies for critically ill patients.

G. Eftekhari et al. / European Journal of Pharmacology 740 (2014) 436–441440

Acknowledgments

This study was supported by Grants from Tarbiat ModaresUniversity as well as Experimental Medicine Research Center(Tehran University of Medical Sciences). The authors would liketo thank Dr. Mohammad Javan (Tarbiat Modares University) forsupport.

References

Angus, D.C., Linde-Zwirble, W.T., Lidicker, J., Clermont, G., Carcillo, J., Pinsky, M.R.,2001. Epidemiology of severe sepsis in the United States: analysis of incidence,outcome, and associated costs of care. Crit. Care Med. 29, 1303–1310.

Biswas, S.K., Bist, P., Dhillon, M.K., Kajiji, T., Del Fresno, C., Yamamoto, M., Lopez-Collazo, E., Akira, S., Tergaonkar, V., 2007. Role for MyD88-independent, TRIFpathway in lipid A/TLR4-induced endotoxin tolerance. J. Immunol. 179,4083–4092.

Biswas, S.K., Lopez-Collazo, E., 2009. Endotoxin tolerance: new mechanisms,molecules and clinical significance. Trends Immunol. 30, 475–487.

Biswas, S.K., Tergaonkar, V., 2007. Myeloid differentiation factor 88-independenttoll-like receptor pathway: sustaining inflammation or promoting tolerance?Int. J. Biochem. Cell Biol. 39, 1582–1592.

Borovikova, L. V, Ivanova, S., Zhang, M., Yang, H., Botchkina, G.I., Watkins, L.R.,Wang, H., Abumrad, N., Eaton, J.W., Tracey, K.J., 2000. Vagus nerve stimulationattenuates the systemic inflammatory response to endotoxin. Nature 405,458–462.

Buras, J. a, Holzmann, B., Sitkovsky, M., 2005. Animal models of sepsis: setting thestage. Nat. Rev. Drug Discov. 4, 854–865.

Campbell, S.J., Anthony, D.C., Oakley, F., Carlsen, H., Elsharkawy, A.M., Blomhoff, R.,Mann, D.a., 2008. Hepatic nuclear factor kappa B regulates neutrophil recruit-ment to the injured brain. J. Neuropathol. Exp. Neurol. 67, 223–230.

Cavaillon, J.-M., Adib-Conquy, M., 2006. Bench-to-bedside review: endotoxintolerance as a model of leukocyte reprogramming in sepsis. Crit. Care 10, 233.

Del Fresno, C., García-Rio, F., Gómez-Piña, V., Soares-Schanoski, A., Fernández-Ruíz,I., Jurado, T., Kajiji, T., Shu, C., Marín, E., Gutierrez del Arroyo, A., Prados, C.,Arnalich, F., Fuentes-Prior, P., Biswas, S.K., López-Collazo, E., 2009. Potentphagocytic activity with impaired antigen presentation identifyinglipopolysaccharide-tolerant human monocytes: demonstration in isolatedmonocytes from cystic fibrosis patients. J. Immunol. 182, 6494–6507.

Dobrovolskaia, M. a, Vogel, S.N., 2002. Toll receptors, CD14, and macrophageactivation and deactivation by LPS. Microbes Infect. 4, 903–914.

Draisma, A., Pickkers, P., Bouw, M.P.W.J.M., van der Hoeven, J.G., 2009. Developmentof endotoxin tolerance in humans in vivo. Crit. Care Med. 37, 1261–1267.

Fernández, E., Flohe, S., Siemers, F., 2002. Endotoxin tolerance in rats: influence onLPS-induced changes in excretory liver function. Inflamm. Res. 51, 500–505.

Fox, E.S., Thomas, P., Broitman, S.A., 1989. Clearance of gut-derived endotoxins bythe liver. Release and modification of 3H, 14C-lipopolysaccharide by isolated ratkupffer cells. Gastroenterology 96, 456–461.

Fu, Y., Glaros, T., Zhu, M., Wang, P., Wu, Z., Tyson, J.J., Li, L., Xing, J., 2012. Networktopologies and dynamics leading to endotoxin tolerance and priming in innateimmune cells. PLoS Comput. Biol. 8, e1002526.

Haddadian, Z., Eftekhari, G., Mazloom, R., Jazaeri, F., Dehpour, A.R., Mani, A.R., 2013.Effect of endotoxin on heart rate dynamics in rats with cirrhosis. Auton.Neurosci. 177, 104–113.

Hiramoto, T., Chida, Y., Sonoda, J., Yoshihara, K., Sudo, N., Kubo, C., 2008. The hepaticvagus nerve attenuates Fas-induced apoptosis in the mouse liver via alpha7nicotinic acetylcholine receptor. Gastroenterology 134, 2122–2131.

Mani, A.R., Ebrahimkhani, M.R., Ippolito, S., Ollosson, R., Moore, K.P., 2006.Metalloprotein-dependent decomposition of S-nitrosothiols: studies on thestabilization and measurement of S-nitrosothiols in tissues. Free Radic. Biol.Med. 40, 1654–1663.

Mani, A.R., Montagnese, S., Jackson, C.D., Jenkins, C.W., Head, I.M., Stephens, R.C.,Moore, K.P., Morgan, M.Y., 2009. Decreased heart rate variability in patientswith cirrhosis relates to the presence and degree of hepatic encephalopathy.Am. J. Physiol. Gastrointest. Liver Physiol. 296, G330–G338.

Mazloom, R., Eftekhari, G., Rahimi, M., Hajizadeh, S., Khori, V., Dehpour, A.R., Mani,A.R., 2013. The role of α7 nicotinic acetylcholine receptor in modulation ofheart rate dynamics in endotoxemic rats. PLoS ONE 8, e82251.

Medvedev, A., 2000. Inhibition of lipopolysaccharide-induced signal transductionin endotoxin-tolerized mouse macrophages: dysregulation of cytokine, chemo-kine, and toll-like receptor 2. J. Immunol. 164, 5564–5574.

Otto, G.P., Sossdorf, M., Claus, R. a, Rödel, J., Menge, K., Reinhart, K., Bauer, M.,Riedemann, N.C., 2011. The late phase of sepsis is characterized by an increasedmicrobiological burden and death rate. Crit. Care 15, R183.

Park, J., Kang, J.-W., Lee, S.-M., 2013. Activation of the cholinergic anti-inflammatorypathway by nicotine attenuates hepatic ischemia/reperfusion injury via hemeoxygenase-1 induction. Eur. J. Pharmacol. 707, 61–70.

Pavlov, V. a, Ochani, M., Gallowitsch-Puerta, M., Ochani, K., Huston, J.M., Czura, C.J.,Al-Abed, Y., Tracey, K.J., 2006. Central muscarinic cholinergic regulation of thesystemic inflammatory response during endotoxemia. Proc. Natl. Acad. Sci. U.S.A 103, 5219–5223.

Ranjbar-Slamloo, Y., Azizi, H., Fathollahi, Y., Semnanian, S., 2012. Orexin receptortype-1 antagonist SB-334867 inhibits the development of morphine analgesictolerance in rats. Peptides 35, 56–59.

Sakata, M., Wu, J., Toyohara, J., Oda, K., Ishikawa, M., Ishii, K., Hashimoto, K.,Ishiwata, K., 2011. Biodistribution and radiation dosimetry of the α7 nicotinicacetylcholine receptor ligand [11C]CHIBA-1001 in humans. Nucl. Med. Biol. 38,443–448.

Scott, M.J., Liu, S., Shapiro, R. a, Vodovotz, Y., Billiar, T.R., 2009. Endotoxin uptake inmouse liver is blocked by endotoxin pretreatment through a suppressor ofcytokine signaling-1-dependent mechanism. Hepatology 49, 1695–1708.

Sly, L.M., Rauh, M.J., Kalesnikoff, J., Song, C.H., Krystal, G., 2004. LPS-inducedupregulation of SHIP is essential for endotoxin tolerance. Immunity 21,227–239.

Soeda, J., Morgan, M., McKee, C., Mouralidarane, A., Lin, C., Roskams, T., Oben, J.a.,2012. Nicotine induces fibrogenic changes in human liver via nicotinicacetylcholine receptors expressed on hepatic stellate cells. Biochem. Biophys.Res. Commun. 417, 17–22.

Tracey, K., 2002. The inflammatory reflex. Nature 420, 853–859.Wang, H., Yu, M., Ochani, M., Amella, C.A., Tanovic, M., Susarla, S., Li, J.H., Wang, H.,

Yang, H., Ulloa, L., Al-Abed, Y., Czura, C.J., Tracey, K.J., 2003. Nicotinic acetylcho-line receptor alpha7 subunit is an essential regulator of inflammation. Nature421, 384–388.

Wright, G., Davies, N. a, Shawcross, D.L., Hodges, S.J., Zwingmann, C., Brooks, H.F.,Mani, A.R., Harry, D., Stadlbauer, V., Zou, Z., Zou, Z., Williams, R., Davies, C.,Moore, K.P., Jalan, R., 2007. Endotoxemia produces coma and brain swelling inbile duct ligated rats. Hepatology 45, 1517–1526.

G. Eftekhari et al. / European Journal of Pharmacology 740 (2014) 436–441 441