actinidiae isolated from Europe and - Plant Pathology · Box PCR Pattern cts haplotype Virulence...

24
The New Zealand Institute for Plant & Food Research Limited Molecular characterisation of Pseudomonas syringae pv. actinidiae isolated from Europe and Asia J.L. Vanneste, J. Yu, D.A. Cornish, F. Poliakoff ACPP APPS Conference, 29 April 2011 Darwin Australia

Transcript of actinidiae isolated from Europe and - Plant Pathology · Box PCR Pattern cts haplotype Virulence...

The New Zealand Institute for Plant & Food Research Limited

Molecular characterisation of Pseudomonas syringae pv.

actinidiae isolated from Europe and Asia

J.L. Vanneste, J. Yu, D.A. Cornish, F. PoliakoffACPP APPS Conference, 29 April 2011 Darwin Australia

The New Zealand Institute for Plant & Food Research Limited

History and background1989 Japan first description of Pseudomonas

syringae pv actinidiae1992 Presence of Psa reported in Korea and in

Italy1992 – 2008 economic impact of the disease on

the global production of kiwifruit limited2009 Major outbreak of Psa in LatinaToday Psa is present in Japan, Korea, (China),

Italy, France, Portugal, New Zealand and Chile.

All major growing regions of kiwifruit are affected by this disease

The New Zealand Institute for Plant & Food Research Limited

Symptoms of bacterial canker of kiwifruit in spring

The New Zealand Institute for Plant & Food Research Limited

Symptoms of bacterial canker of kiwifruit in summer

The New Zealand Institute for Plant & Food Research Limited

Evolution of the disease in an A. chinensis Latina orchard

April 7 April 24 May 8 May 24

Vanneste JL et al. 2011 In Press

The New Zealand Institute for Plant & Food Research Limited

Evolution of Psa in Latina (Italy) from

May 2009 March 2010 June 2010

Vanneste JL et al. 2011 In Press

The New Zealand Institute for Plant & Food Research Limited

Economic impact of Pseudomonas syringae pv. actinidae

Before Psa After Psa

The New Zealand Institute for Plant & Food Research Limited

Gel electrophoresis of BOX PCR

Pst Psa

Vanneste et al. 2010

The New Zealand Institute for Plant & Food Research Limited

Gel electrophoresis of BOX PCR

Pst Psa Italy Psa Asia

Vanneste et al. 2010

The New Zealand Institute for Plant & Food Research Limited

Summary of the results

Geographic origin Box PCR Pattern

Asia (Japan and Korea) (15) 1

Italy 1992 (2) 1

Europe from 2008 Italy (40) and France (13) 2

The New Zealand Institute for Plant & Food Research Limited

Position of the genes used for MLST analysis in Pseudomonas syringae

Pseudomonas syringaepv. tomatoDC3000 (6 539 198 bp)

cts

gapA

pgi

rpoD

gyrBpfk

acn1

The New Zealand Institute for Plant & Food Research Limited

DNA sequence of the cts gene from strains of Pseudomonas syringae pv. actinidiae

TAGCGGTCTGACCGCCACCGGCCGCGTTCACATTTGACCCTGGTTTCATGTCCACGGCTCTTGCGAGTCGAAGATCACCTACATCGATGGTGACAACGGAATTCTGCTGCACCGCGGCTACCCGATCGAACAACTGGCCGAGCAGTCCGATTATCTCGAGACCTGCTACCTGTTGCTCAACGGCGAGCTGCCAACCGCCGAACAGAAAGCCCAGTTCGTGGCCGTGGTCAAGAACCAC(A)ACGATGGTTCACGAACAACTCAAGACCTTCTTCAACGGCTTTCGCCGTGACGCCCACCCGATGGCCGTCATGTGCGGTGTAGTCGGCGCCCTGTCGGCGTTCTACCACGATTCGCTGGACATCAATAACCCGCAGCACCGCGAAATTTCGGCTGTACGCCTGGTCGCCAAGATGCCGACC(T)CTGGCAGCGATGGTCTACAAGTACTCCATGGGCCAACCCATGATGTACCCGCGCAACGACCTCAGCTACGCCGAAAACTTCCTGCACATGATGTTCAACACGCCGTGCGAGATCA

Vanneste et al. 2010 New Zealand Plant Protection 63:7-14

The New Zealand Institute for Plant & Food Research Limited

Summary of the results

Geographic origin Box PCR Pattern cts haplotype

Asia (Japan and Korea)(15) 1 1 (A/T)

Italy 1992 (2) 1 1 (A/T)

Europe from 2008 Italy (40) and France (13) 2 2 (C/C)

The New Zealand Institute for Plant & Food Research Limited

Pathogenicity and virulence assay for Pseudomonas syringae pv. actinidiae

The New Zealand Institute for Plant & Food Research Limited

Virulence of cts haplotypes on A. chinensis seedlings

The New Zealand Institute for Plant & Food Research Limited

Summary of the results

Geographicorigin

Box PCR Pattern

cts haplotype Virulence

Systemic % leaf spots

Asia (Japanand Korea) 1 1 No Low

Italy 1992 1 1

Europe from 2008 Italy and

France2 2 Yes High

The New Zealand Institute for Plant & Food Research Limited

Type Three Secretion System and effectors in Pseudomonas syringae pv actinidiae

P. syringae pv. actinidiae

Infected Plant Cell

Effectors: avrD1,avrAE1,hopB1,hopD1, hopAN1 and hrpK1 hopA1

Ferrante and Scortichini 2010

The New Zealand Institute for Plant & Food Research Limited

Summary of the results

Geographicorigin

Box PCR Pattern

ctshaplotype

Virulence Presence of hopA1

Systemic % leaf spots

Asia (Japanand Korea) 1 1 No Low -

Italy 1992 1 1

Europe from 2008 Italy

and France2 2 Yes High +

The New Zealand Institute for Plant & Food Research Limited

Summary of the results

Geographicorigin

Box PCR Pattern

ctshaplotype

Virulence Presence of hopA1

Systemic % leaf spots

Asia (Japanand Korea) 1 1 No Low -

Italy 1992 1 1 +

Europe from 2008 Italy

and France2 2 Yes High +

The New Zealand Institute for Plant & Food Research Limited

Conclusions

• Psa which causes bacterial canker of kiwifruit is not ahomogenous pathovar

• Based on BOX PCR patterns, cts haplotypes andvirulence in laboratory assays, at least 2 differentraces

• Good correlation between BOX PCR patterns, ctshaplotype and virulence

• Molecular basis for differential virulence betweenraces not elucidated yet

• Whole genome of 40 strains will be sequenced andanalysed in an international collaboration

The New Zealand Institute for Plant & Food Research Limited

The New Zealand Institute for Plant & Food Research Limited

www.plantandfood.com

[email protected]

The New Zealand Institute for Plant & Food Research Limited

Summary of the results

Geographicorigin

Box PCR Pattern

ctshaplotype

Virulence Presence of hopA1

Systemic % leaf spots

Asia (Japanand Korea) 1 1 No Low -

Italy 1992 1 1 (High) +

Europe from 2008 Italy

and France2 2 Yes High +

The New Zealand Institute for Plant & Food Research Limited

Pseudomonas syringae pv actinidiae in Italy

The New Zealand Institute for Plant & Food Research Limited

Economic impact of Pseudomonas syringae pv. actinidae

BEFORE AFTER