actinidiae isolated from Europe and - Plant Pathology · Box PCR Pattern cts haplotype Virulence...
Transcript of actinidiae isolated from Europe and - Plant Pathology · Box PCR Pattern cts haplotype Virulence...
The New Zealand Institute for Plant & Food Research Limited
Molecular characterisation of Pseudomonas syringae pv.
actinidiae isolated from Europe and Asia
J.L. Vanneste, J. Yu, D.A. Cornish, F. PoliakoffACPP APPS Conference, 29 April 2011 Darwin Australia
The New Zealand Institute for Plant & Food Research Limited
History and background1989 Japan first description of Pseudomonas
syringae pv actinidiae1992 Presence of Psa reported in Korea and in
Italy1992 – 2008 economic impact of the disease on
the global production of kiwifruit limited2009 Major outbreak of Psa in LatinaToday Psa is present in Japan, Korea, (China),
Italy, France, Portugal, New Zealand and Chile.
All major growing regions of kiwifruit are affected by this disease
The New Zealand Institute for Plant & Food Research Limited
Symptoms of bacterial canker of kiwifruit in spring
The New Zealand Institute for Plant & Food Research Limited
Symptoms of bacterial canker of kiwifruit in summer
The New Zealand Institute for Plant & Food Research Limited
Evolution of the disease in an A. chinensis Latina orchard
April 7 April 24 May 8 May 24
Vanneste JL et al. 2011 In Press
The New Zealand Institute for Plant & Food Research Limited
Evolution of Psa in Latina (Italy) from
May 2009 March 2010 June 2010
Vanneste JL et al. 2011 In Press
The New Zealand Institute for Plant & Food Research Limited
Economic impact of Pseudomonas syringae pv. actinidae
Before Psa After Psa
The New Zealand Institute for Plant & Food Research Limited
Gel electrophoresis of BOX PCR
Pst Psa
Vanneste et al. 2010
The New Zealand Institute for Plant & Food Research Limited
Gel electrophoresis of BOX PCR
Pst Psa Italy Psa Asia
Vanneste et al. 2010
The New Zealand Institute for Plant & Food Research Limited
Summary of the results
Geographic origin Box PCR Pattern
Asia (Japan and Korea) (15) 1
Italy 1992 (2) 1
Europe from 2008 Italy (40) and France (13) 2
The New Zealand Institute for Plant & Food Research Limited
Position of the genes used for MLST analysis in Pseudomonas syringae
Pseudomonas syringaepv. tomatoDC3000 (6 539 198 bp)
cts
gapA
pgi
rpoD
gyrBpfk
acn1
The New Zealand Institute for Plant & Food Research Limited
DNA sequence of the cts gene from strains of Pseudomonas syringae pv. actinidiae
TAGCGGTCTGACCGCCACCGGCCGCGTTCACATTTGACCCTGGTTTCATGTCCACGGCTCTTGCGAGTCGAAGATCACCTACATCGATGGTGACAACGGAATTCTGCTGCACCGCGGCTACCCGATCGAACAACTGGCCGAGCAGTCCGATTATCTCGAGACCTGCTACCTGTTGCTCAACGGCGAGCTGCCAACCGCCGAACAGAAAGCCCAGTTCGTGGCCGTGGTCAAGAACCAC(A)ACGATGGTTCACGAACAACTCAAGACCTTCTTCAACGGCTTTCGCCGTGACGCCCACCCGATGGCCGTCATGTGCGGTGTAGTCGGCGCCCTGTCGGCGTTCTACCACGATTCGCTGGACATCAATAACCCGCAGCACCGCGAAATTTCGGCTGTACGCCTGGTCGCCAAGATGCCGACC(T)CTGGCAGCGATGGTCTACAAGTACTCCATGGGCCAACCCATGATGTACCCGCGCAACGACCTCAGCTACGCCGAAAACTTCCTGCACATGATGTTCAACACGCCGTGCGAGATCA
Vanneste et al. 2010 New Zealand Plant Protection 63:7-14
The New Zealand Institute for Plant & Food Research Limited
Summary of the results
Geographic origin Box PCR Pattern cts haplotype
Asia (Japan and Korea)(15) 1 1 (A/T)
Italy 1992 (2) 1 1 (A/T)
Europe from 2008 Italy (40) and France (13) 2 2 (C/C)
The New Zealand Institute for Plant & Food Research Limited
Pathogenicity and virulence assay for Pseudomonas syringae pv. actinidiae
The New Zealand Institute for Plant & Food Research Limited
Virulence of cts haplotypes on A. chinensis seedlings
The New Zealand Institute for Plant & Food Research Limited
Summary of the results
Geographicorigin
Box PCR Pattern
cts haplotype Virulence
Systemic % leaf spots
Asia (Japanand Korea) 1 1 No Low
Italy 1992 1 1
Europe from 2008 Italy and
France2 2 Yes High
The New Zealand Institute for Plant & Food Research Limited
Type Three Secretion System and effectors in Pseudomonas syringae pv actinidiae
P. syringae pv. actinidiae
Infected Plant Cell
Effectors: avrD1,avrAE1,hopB1,hopD1, hopAN1 and hrpK1 hopA1
Ferrante and Scortichini 2010
The New Zealand Institute for Plant & Food Research Limited
Summary of the results
Geographicorigin
Box PCR Pattern
ctshaplotype
Virulence Presence of hopA1
Systemic % leaf spots
Asia (Japanand Korea) 1 1 No Low -
Italy 1992 1 1
Europe from 2008 Italy
and France2 2 Yes High +
The New Zealand Institute for Plant & Food Research Limited
Summary of the results
Geographicorigin
Box PCR Pattern
ctshaplotype
Virulence Presence of hopA1
Systemic % leaf spots
Asia (Japanand Korea) 1 1 No Low -
Italy 1992 1 1 +
Europe from 2008 Italy
and France2 2 Yes High +
The New Zealand Institute for Plant & Food Research Limited
Conclusions
• Psa which causes bacterial canker of kiwifruit is not ahomogenous pathovar
• Based on BOX PCR patterns, cts haplotypes andvirulence in laboratory assays, at least 2 differentraces
• Good correlation between BOX PCR patterns, ctshaplotype and virulence
• Molecular basis for differential virulence betweenraces not elucidated yet
• Whole genome of 40 strains will be sequenced andanalysed in an international collaboration
The New Zealand Institute for Plant & Food Research Limited
The New Zealand Institute for Plant & Food Research Limited
www.plantandfood.com
The New Zealand Institute for Plant & Food Research Limited
Summary of the results
Geographicorigin
Box PCR Pattern
ctshaplotype
Virulence Presence of hopA1
Systemic % leaf spots
Asia (Japanand Korea) 1 1 No Low -
Italy 1992 1 1 (High) +
Europe from 2008 Italy
and France2 2 Yes High +
The New Zealand Institute for Plant & Food Research Limited
Pseudomonas syringae pv actinidiae in Italy