A20 Ubiquitin Ligase–Mediated Polyubiquitination of RIP1...
Transcript of A20 Ubiquitin Ligase–Mediated Polyubiquitination of RIP1...
ReseaRch aRticle
A20 Ubiquitin Ligase–Mediated Polyubiquitination of RIP1 Inhibits Caspase-8 Cleavage and TRAIL-Induced Apoptosis in GlioblastomaAnita C. Bellail1, Jeffrey J. Olson2, Xiaolu Yang3, Zhijian J. Chen4, and Chunhai Hao1
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
FEBRUARY 2012 CANCER DISCOVERY | OF2
The BATTLE Trial: Personalizing Therapy for Lung Cancer ReseARCh ARTICLe
regulates these biochemical processes (13). Ubiquitin is co-valently attached to lysine residues of the substrate proteins through the catalytic reactions mediated by the ubiquitin-ac-tivating enzyme (E1), conjugating enzyme (E2), and ligase (E3) and is removed by deubiquitinating enzymes (14). Ubiquitin has 7 lysine (K) residues and an N-terminal methionine (M1), each of which can be linked to the C-terminal glycine residue of another ubiquitin to form polyubiquitin chains (15); this regulates TNF-α–induced signaling (13). Upon TNF-α bind-ing, TNF receptor 1 (TNFR1) recruits receptor-interacting protein 1 (RIP1), cellular inhibitor of apoptosis protein 1 and 2 (cIAP1 and cIAP2), and TNFR-associated factor 2 (TRAF2) for the assembly of TNFR1-associated complex I (16). TRAF2, cIAP1, and cIAP2 are E3 ligases that activate NF-κB through the attachment of polyubiquitin chains to RIP1 (17) and bind-ing of the polyubiquitin chain to IκB kinase γ (IKKγ) (18). TRAF2 and RIP1 then detach from TNFR1 and recruit FADD and caspase-8 for the assembly of the cytoplasmic complex II (19), where the deubiquitinating cylindromatosis removes the polyubiquitin chains from RIP1 to promote caspase-8 cleav-age for TNF-α–induced apoptosis (20).
In contrast to TNFR1, DR4 and DR5 recruit FADD and caspase-8 in the assembly of a plasma membrane-bound DISC, where caspase-8 becomes dimerized and cleaved, initi-ating apoptosis (21, 22). Cullin 3 (CUL3), an E3 ligase, adds K48- and K63-linked polyubiquitin chains to caspase-8 and facilitates its dimerization and cleavage in the DISC, where A20 deubiquitinating enzyme removes the polyubiquitin chains from caspase-8 (23). A20 (TNF-α–induced protein 3; TNFAIP3) is well known for its anti-inflammatory activities (24) through its N-terminal ovarian tumor domain (OTU), which acts as a deubiquitinating enzyme and removes K63-linked polyubiquitin chains from RIP1, TRAF6, and RIP2, thus restricting TNFR1, Toll-like receptor, and nucleotide-binding oligomerization domain-induced NF-κB signaling
The TNF-related apoptosis-inducing ligand (TRAIL) apoptotic pathway has emerged as a therapeutic target for the treatment of cancer. However, clinical
trials have proven that the vast majority of human cancers are resistant to TRAIL apoptotic path-way-targeted therapies. We show that A20-mediated ubiquitination inhibits caspase-8 cleavage and TRAIL-induced apoptosis in glioblastoma through 2 signaling complexes. A20 is highly expressed in glioblastomas and, together with the death receptor 5 and receptor- interacting protein 1, forms a plasma membrane-bound preligand assembly complex under physiologic conditions. Treatment with TRAIL leads to the recruitment of caspase-8 to the plasma membrane-bound preligand assembly complex for the assembly of a death-inducing signaling complex. In the death-inducing signaling complex, the C-terminal zinc finger (Znf) domain of the A20 ubiquitin ligase mediates receptor-in-teracting protein 1 polyubiquitination through lysine-63-linked polyubiquitin chains, which bind to the caspase-8 protease domain and inhibit caspase-8 dimerization, cleavage, and the initiation of TRAIL-induced apoptosis in glioblastoma-derived cell lines and tumor-initiating cells.
sIGNIFICANCe: These results identify A20 E3 ligase as a therapeutic target whose inhibition can over-come TNF-related apoptosis-inducing ligand resistance in glioblastoma and thus have an impact on ongoing clinical trials of TNF-related apoptosis-inducing ligand-targeted combination cancer thera-pies. Cancer Discovery; 2(2); OF1–OF16. ©2012 AACR.
intRoductionThe TNF-related apoptosis-inducing ligand (TRAIL)
(1, 2) executes the innate and adaptive immune responses in the process of tumor immunosurveillance (3). The antican-cer activity of TRAIL is attributable to its ability to induce apoptosis through the binding of death receptors 4 and 5 (DR4, DR5) and the recruitment of intracellular apoptosis-initiating caspase-8 through Fas-associated death domain (FADD) for the assembly of a death-inducing signaling com-plex (DISC) (4). Recombinant TRAIL as well as agonistic DR4 and DR5 antibodies targeting this apoptotic pathway have been generated as potential therapies for the treatment of cancer (5). In clinical trials, however, investigators have proven that cancers are resistant to TRAIL pathway-targeted therapies (6–8), thus suggesting that cancers escape from TRAIL-mediated immunosurveillance and are resistant to TRAIL-targeted therapies.
The dimerization and cleavage of caspase-8 in the DISC are the critical upstream events in TNF family ligand-induced apoptosis (9–12), and ubiquitination of proteins in the DISC
abstRact
Authors’ Affiliations: 1Department of Pathology and Laboratory Medicine and Winship Cancer Institute, and 2Department of Neurosurgery, Emory University School of Medicine, Atlanta, Georgia; 3Abramson Family Cancer Research Institute, Department of Cancer Biology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania; 4Department of Molecular Biology and Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, Dallas, Texas Note: Supplementary data for this article are available at Cancer Discovery Online (http://www.cancerdiscovery.aacrjournals.org).Corresponding Author: Chunhai Hao, Department of Pathology and Laboratory Medicine, 1365-C Clifton Road NE, Atlanta, GA 30322. Phone: 404-778-4776; Fax: 404-778-5550; E-mail: [email protected]: 10.1158/2159-8290.CD-11-0172 ©2012 American Association for Cancer Research.
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF3 | CANCER DISCOVERY FEBRUARY 2012
from glioblastoma cell lines (Supplementary Fig. S2B). TRAIL stimulated caspase-8 ubiquitination in H460, consis-tent with a previous report (23), but not in glioblastoma cell lines (Supplementary Fig. S2C).
To our surprise, A20, RIP1, and TRAF2 were seen in the unstimulated controls in the resistant cell lines whereas only TRAF2 was seen in the sensitive cell lines (Fig. 1B), suggesting that these proteins might interact with DR5 and form a com-plex before treatment with TRAIL. To test this, we performed size exclusion analysis and immunoblotting (19) and identi-fied DR5, A20, RIP1, and TRAF2 in the approximately 669-kDa fractions from resistant lines but only DR5 and TRAF2 in sensitive lines (Fig. 1C; Supplementary Fig. S3A). These proteins remained in the high-molecular-weight fractions in the cells after TRAIL treatment. In contrast, caspase-8 iso-forms were eluted in the fractions corresponding to their monomeric molecular weights before treatment with TRAIL but quickly shifted to high-molecular-weight fractions under treatment with TRAIL. These results suggest the presence of a DR5-associated signaling complex that we named the preligand assembly complex under physiologic conditions. To confirm this, we isolated the preligand assembly complex from the pooled high- and low-molecular-weight fractions through immunoprecipitation using Flag-TRAIL and Flag antibody and detected DR5, A20 and RIP1 in the high- but not the low-molecular-weight fractions (Fig. 1D).
Because DR5 is a type I transmembrane protein, we con-ducted subcellular fractionation to determine whether DR5-associated preligand assembly complex is plasma membrane-bound. Immunoblotting detected DR5 mainly in the membrane fractions and RIP1, A20, and FADD in both the membrane and cytosolic fractions of TRAIL-resistant cells (Fig. 1E). The DR5-associated complex was then iso-lated through immunoprecipitation via the use of a DR5 antibody. Immunoblotting identified DR5, A20, RIP1, and TRAF2 in the membrane but not cytosolic fractions in the resistant but only DR5 and TRAF2 in the sensitive cells (Fig. 1F; Supplementary Fig. S3B). These data indicate that al-though RIP1, A20, and TRAF2 are present in the membrane and cytosolic fractions, the preligand assembly complex is formed as a membrane bound complex composed of DR5, A20, RIP1, and TRAF2 in resistant cells but only DR5 and TRAF2 in sensitive cells. TRAIL stimulates the recruitment of FADD and caspase-8 to the plasma membrane-bound preligand assembly complex for the assembly of a plasma membrane-bound DISC.
The A20 e3 Ligase Znf Domain Inhibits Caspase-8 Cleavage in the DIsC
To determine whether A20, TRAF2, and RIP1 inhibit caspase-8 cleavage, we conducted knockdown experiments by transfecting TRAIL-resistant cell lines with siRNA spe-cific to A20, RIP1, and TRAF2. Identical results were ob-tained with the use of 2 different siRNA sequences specific to each gene, indicating no off-target effects of the se-quences; thus, the data were presented with one of the siRNA sequences targeting each gene. The siRNA-trans-fected LN443 cells were treated with TRAIL. Significant apoptosis was observed in the cells transfected with A20
(25–27). A20 also contains a C-terminal Zinc finger (Znf) domain of an E3 ligase (28), but the function of the Znf E3 ligase has yet to be established.
Here, we show that the Znf domain of the A20 E3 ligase mediates RIP1 K63-linked polyubiquitination; this polyu-biquitin chain binds to the caspase-8 protease p18 domain, which blocks caspase-8 dimerization and cleavage and thus inhibits TRAIL-induced apoptosis in human glioblastoma. Glioblastoma is the most common brain cancer and has no curative treatment. Recent studies have identified tumor-initiating cells (29) and shown that the tumor-initiating cells retain the original tumor genomic features (30), possess self-renewal and tumorigenic capacity (31), and are responsible for the tumor resistance to treatments (32). In this study, we further establish that A20 E3 ligase-mediated RIP1 ubiq-uitination inhibits caspase-8-initiated and TRAIL-induced apoptosis in the tumor-initiating cells isolated from glioblas-tomas surgically removed from patients.
ResultsPreligand Assembly Complex Is Formed under Physiologic Conditions
In exploring the role of the ubiquitin enzymes A20, cIAP1/2, CUL3, and TRAF2 in glioblastoma, we first ana-lyzed the expression of these proteins in glioblastoma tissues. Immunoblotting revealed that A20 was highly expressed in the tumors as compared with normal brain tissue, whereas CUL3, cIAP2, and TRAF2 were expressed consistently in the normal brain and tumor tissues and cIAP1 was seen in some tumors (Fig. 1A). To examine whether these enzymes regulate TRAIL signaling in glioblastoma cells, we analyzed their expression in TRAIL-sensitive (LN18, LN71, T98G, U343MG) and resistant glioblastoma cell lines (LN443, U87MG, U118MG, U138MG). The TRAIL sensitivity of these cell lines was defined in our earlier study (33) and confirmed by colony formation assay (Supplementary Fig. S1A). A20 was highly expressed in the resistant cell lines but barely de-tected in the sensitive cell lines and normal human astrocytes (34); in contrast, CUL3, cIAP1, cIAP2, RIP1, and TRAF2 were consistently expressed in the resistant and sensitive cell lines (Supplementary Fig. S1B).
The DISC was then isolated from each cell line through immunoprecipitation after the cells were treated with mixed Flag-TRAIL and Flag antibody. For the unstimulated control, the cells were lysed first and treated with Flag-TRAIL and Flag antibody. Taking this approach, we have shown that DR5 but not DR4 is the functional receptor that is expressed and interacts with Flag-TRAIL in glioblastoma cells (33). Immunoblotting detected DR5, A20, TRAF2, and RIP1 in the DISC in the resistant lines but only DR5 and TRAF2 in the sensitive lines (Fig. 1B; Supplementary Fig. S2A). FADD and caspase-8 were recruited to the DISC in both resistant and sensitive cell lines; however, caspase-8 was cleaved only in the DISC isolated from the sensitive cells. In contrast, cIAP1 was not seen in the DISC from any of these cell lines, whereas cIAP2 was detected only in the DISC of sensitive cell lines. CUL3 was detected in the DISC of H460, a TRAIL-sensitive lung cancer line as reported (23), but not in the DISC isolated
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF4
A B
C
F
D
eFigure 1. TRAIL-induced formation from the preligand assembly complex to the DISC. A, normal brain and glioblastoma tissues were examined by immunoblotting using antibodies as indicated (left). The molecular weights are indicated to the right of the panels. Actin was used as a loading control. B, DR5-associated preligand assembly complex and DISC were isolated from LN443 and LN71 cells treated with mixed Flag-TRAIL and Flag antibody for 15 minutes and analyzed by immunoblotting with cell lysates as controls. C, size exclusion fractions from LN443 and LN71 cells untreated or treated with 100 ng/mL TRAIL for 15 min were analyzed by immunoblotting. The elution position of molecular weight markers in kDa are indicated at the top of the panels. D, the preligand assembly complex was isolated from the pooled high-molecular-weight fraction 42–50 and low-molecular-weight fraction 62–70 of LN443 cells and examined by immunoblotting. The input was included, showing the protein loading. e, subcellular cytosol (Cytos), membrane (Memb), and nuclear (Nucl) fractions from LN443 were examined by immunoblotting with antibodies to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), c-Jun, and epidermal growth factor receptor (EGFR) as loading controls, respectively, for cytosol, nuclear, and membrane fraction. F, subcellular cytosol and membrane fractions from LN443 and LN71 were subjected to immunoprecipitation using a DR5 antibody with IgG included as a negative control and examined by immunoblotting for the presence of the proteins as indicated (left).
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF5 | CANCER DISCOVERY FEBRUARY 2012
apoptosis. Furthermore, A20 siRNA transfection did not affect the sensitivity of LN443 cells to TNF-α, Fas ligand (FasL), or cisplatin (Supplementary Fig. S4B).
Immunoblotting confirmed A20 and TRAF2 knockdown in the transfectants and revealed the cleavage of caspase-8
and RIP1 but not TRAF2 siRNA, as shown by cell death (Fig. 2A), caspase-8 enzymatic activity (Fig. 2B), phase contrast microscopy (Fig. 2C), and Annexin V assay (Supplementary Fig. S4A). These assays showed that the transfection of A20 or RIP1 siRNA alone did not cause
Figure 2. A20 inhibits caspase-8 cleavage and TRAIL-induced apoptosis. A, TRAIL-resistant LN443 cells were transfected with A20, TRAF2, and scrambled siRNA; treated with TRAIL for 24 hours; and examined for cell death (points: means; bars: SE; n = 6; ***P < 0.001). B, the transfected cells were treated with 100 ng/mL TRAIL and examined by caspase-8 (Casp-8) enzymatic activity assay (points: means; bars: SE; n = 6; ***P 0.001; NS, no significance). C, apoptotic cell death was observed under phase contrast microscopy in A20 siRNA but not scrambled and TRAF2 siRNA-transfected cells. D, LN443 cells were transfected with siRNA, treated with 100 ng/mL TRAIL, and examined by immunoblotting for the knockdown of the proteins and the cleavage of caspase-8 and RIP1. Nontransfected TRAIL-sensitive U343MG cells were included as the control for caspase-8 and RIP1 cleavage. e, the DISC was isolated from the LN443 cells transfected with siRNA and, together with the cell lysates, examined by immunoblotting for caspase-8 cleavage. F, LN443 cells transfected with A20 and RIP1 siRNA were treated or untreated with 100 ng/mL TRAIL in the absence or presence of the caspase-8 inhibitor z-IEDT and examined by immunoblotting for caspase-8 cleavage.
A B
C D
e
F
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF6
domains inhibit caspase-8 cleavage, we generated inactive OTU (C103A) and Znf4 (C624A, C627A) A20 mutants (mt; Supplementary Fig. S5D). A20 wild-type and inactive OTU and Znf4 mt plasmids were introduced through lentiviral transduction into LN71, an A20-deficient TRAIL-sensitive cell line. Stable clones were established, the expression of A20 wild-type (wt) and mt proteins was verified by im-munoblotting, and the stable clones were selected for expressing wt and mt A20 proteins at levels similar to the en-dogenous A20 in the resistant LN443 cells (Supplementary Fig. S6A). The clones were treated with TRAIL and cell death (Fig. 3A), caspase-8 enzymatic activity (Fig. 3B), and annexin V staining (Supplementary Fig. S6B) demonstrated that the expression of A20 wt and OTU but not Znf4 mt inhibited TRAIL-induced apoptosis. Expression of A20 wt, OTU, or Znf4 mt alone did not cause apoptotic cell death (Supplementary Fig. S6C). The preligand assembly complex and DISC were isolated from the clones, and A20 wt and mt proteins were observed in the complexes. RIP1 was enriched in the TRAIL-resistant A20 wt- and OTU mt-expressing clones more than in the TRAIL-sensitive empty vector and Znf mt-expressing clones (Fig. 3C). The clones were treated
and RIP1 in the A20 siRNA-transfected but not the TRAF2 siRNA-transfected LN443 cells (Fig. 2D). Knockdown of A20 or RIP1 but not TRAF2 restored caspase-8 cleavage in other resistant cell lines (Supplementary Fig. S5A). The DISC was isolated and immunoblotting identified caspase-8 cleavage in the DISC in the A20 and RIP1 siRNA transfected LN443 cells (Fig. 2E). The caspase-8 cleavage was abolished by z-IEDT, a caspase-8 inhibitor (Fig. 2F). To determine the long-term effects of A20 knockdown, we introduced a short hairpin RNA (shRNA) specific to A20 through lentiviral transduction into LN443 cells. The A20 shRNA transduction alone did not inhibit the colony formation of the cells (Supplementary Fig. S5B). Noncleaved RIP1 was detected in the preligand assem-bly complex, whereas neither noncleaved nor cleaved RIP1 were observed in the DISC in the A20 shRNA-transduced cells (Supplementary Fig. S5C), suggesting that RIP1 is de-tached from the DISC in the absence of A20. These results in-dicate that both A20 and RIP1 are required for the inhibition of caspase-8 cleavage in the DISC.
A20 has an N-terminal OTU domain that acts as a de-ubiquitinating enzyme and a C-terminal Znf domain that acts as an E3 ligase (28). To test whether the OTU or Znf
A B
C D
Figure 3. A20 E3 ligase inhibits caspase-8 cleavage. A, LN71 stable clones expressing A20 wt, OTU, and Znf mt and empty vector were treated with 100 ng/mL TRAIL for 24 hours and examined for cell death (points: means; bars: SE; n = 6; ***P 0.001). B, LN71 stable clones were treated with 100 ng/mL TRAIL in the absence or presence of z-IEDT for caspase-8 (Casp-8) activity (points: means; bars: SE; n = 6; ***P 0.001). C, the preligand assembly complex (PLAC) and DISC were isolated from LN71 stable clones through immunoprecipitation using Flag-TRAIL and Flag antibody and examined by immunoblotting for the presence of the proteins as indicated (left). D, LN71 stable clones were treated with TRAIL for the times indicated (top) and examined by immunoblotting for A20 expression and cleavage of RIP1.
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF7 | CANCER DISCOVERY FEBRUARY 2012
compared with the preligand assembly complex (Fig. 4D), suggesting that TRAIL treatment enhances RIP1 polyubiqui-tination in the DISC. To verify this, we carried out a double immunoprecipitation and isolated RIP1 from the preligand assembly complex and DISC by using a RIP1 antibody. Again, ubiquitin-conjugated RIP1 was detected more strongly in the DISC than in the preligand assembly complex (Fig. 4E). Furthermore, immunoblotting using an antibody specific to the K63-linked polyubiquitin chain identified more poly-ubiquitin chain-conjugated RIP1 in the DISC than in the preligand assembly complex (Fig. 4F). To identify the A20 domains responsible for RIP1 K63-linked polyubiquitin, we isolated the preligand assembly complex and DISC from A20 wt-, OTU mt-, and Znf4 mt-expressing clones. K63-linked polyubiquitin chain-conjugated RIP1 was identified in the DISC of the A20 wt and OTU mt but not the Znf4 mt ex-pressing clones (Fig. 4G). These data suggest that TRAIL stimulates A20 Znf domain E3 ligase-mediated RIP1 ubiq-uitination through K63-linked polyubiquitin chains in glio-blastoma cells.
K63-Linked Polyubiquitin Chain Inhibits Caspase-8 Dimerization and Cleavage
We then examined whether ubiquitinated RIP1 binds to caspase-8 in resistant cells. Caspase-8 was isolated from untreated or TRAIL-treated LN443 cells with a caspase-8 antibody and greater molecular weight RIP1 species coim-munoprecipitated with caspase-8 in TRAIL-treated cells (Fig. 5A). The cells were then subjected to subcellular fraction-ation; caspase-8 was isolated from the membrane and cytosol fractions and immunoblotting detected enrichment of poly-ubiquitin species in the membrane fraction (Supplementary Fig. S8A). These data suggest that TRAIL stimulates the in-teraction of ubiquitinated RIP1 and caspase-8.
Caspase-8 consists of 2 death effector domains and a pro-tease domain composed of a p18 and p12 subunit. To de-termine whether ubiquitinated RIP1 binds to the caspase-8 protease domain and inhibits its cleavage, we performed a ubiquitin-binding assay using Fv-caspase-8 (35), in which the death effector domains were replaced with Fv, a derivative of the FK506 binding protein (Supplementary Fig. S8B). LN443 cells were subjected to subcellular fractionation after treat-ment with TRAIL. RIP1 was isolated from the cytosolic and membrane fractions and then incubated with recombinant Fv-caspase-8. Immunoblotting identified the binding of Fv-caspase-8 to the K63-linked polyubiquitin chain-conjugated RIP1 in the membrane fractions (Fig. 5B).
To further define caspase-8 as an ubiquitin binding pro-tein, we carried out a series of caspase-8 pull-down assays. Fv-caspase-8 was bound to protein G-beads through the in-cubation of Fv-caspase-8, caspase-8 antibody, and protein G-beads. The Fv-caspase-8-bound beads were incubated with recombinant monoubiquitin, M1-linked linear, and K48- and K63-linked polyubiquitin chains. Unbound ubiquitin pro-teins were washed off the beads and bound ubiquitin proteins were eluted. Fv-caspase-8 pulled-down K63-linked polyubiq-uitin chains (Fig. 5C). The experiment was repeated with the Fv-caspase-8 p18 catalytic site mt (35, 36); the results show that the caspase-8 p18 catalytic site is not required for the
with TRAIL and RIP1 cleavage was detected in the empty vector and Znf mt but not the A20 wt- or OTU mt-express-ing clones (Fig. 3D). Together, these gain-of-function stud-ies suggest that Znf4 is responsible for caspase-8 inhibition in the DISC.
A20 e3 Ligase Mediates RIP1 K63-Linked Polyubiquitination in the DIsC
The finding that both A20 Znf4 and RIP1 are required for caspase-8 inhibition suggests that A20 E3 ligase may inhibit caspase-8 through RIP1 ubiquitination. An in vitro ubiquitination assay has shown that A20 E3 ligase adds a K48-linked polyubiquitin chain to RIP1 (28); however, an in vivo assay has revealed that RIP1 is ubiquitinated through a K63-linked polyubiquitin chain (17). To evaluate the role of the A20 Znf domain, we repeated the in vitro ubiquitina-tion assay using the A20 OTU mt containing the Znf domain in the presence of the K48-linked polyubiquitin chain-spe-cific E2 enzyme UBCH5A and the K63-linked polyubiquitin chain-specific E2 enzyme UBC13 (28). Flag-RIP1 and His-Myc-A20 OTU mt proteins were added to an in vitro ubiqui-tination assay consisting of ATP, biotin-ubiquitin, E1, and UBCH5A or UBC13 (Supplementary Fig. S7A).
After the reaction, proteins were separated and immunob-lotted for avidin-bound biotin-polyubiquitin chains in the presence of UBCH5A or UBC13 (Fig. 4A). To confirm this in vivo, HEK293T cells were co-transfected with His-Myc-A20 OTU mt, Flag-RIP1, and HA-UB mts that contain only one ly-sine at K48 or K63 or have a single point mutation of R48 or R63 (Supplementary Fig. S7B; ref. 17). The transfected cells were lysed in 1% SDS denaturing buffer to dissociate proteins and then diluted 10 times in non–SDS-containing buffer. Flag-RIP1 was isolated through immunoprecipitation by the Flag antibody. Immunoblotting using the HA antibody iden-tified K48- and K63-linked polyubiquitin chain-conjugated Flag-RIP1 (Fig. 4B). These assays suggest that the Znf domain can mediate RIP1 ubiquitination through either the K48- or K63-linked polyubiquitin chain.
To determine whether RIP1 is ubiquitinated in glioblas-toma cells, we treated glioblastoma cell lines with MG132, a 26S proteasome inhibitor. The K48-linked polyubiquitin chain targets substrates to the 26S proteasome for degra-dation; however, MG132 treatment did not affect the lev-els of RIP1 protein in the absence or presence of TRAIL (Supplementary Fig. S7C), suggesting that it is less likely that RIP1 is ubiquitinated by a K48-linked polyubiquitin chain. To examine this further, U87MG cells were transfected with HA-UB mts, treated with TRAIL and lysed in a denaturing buffer. RIP1 was isolated through immunoprecipitation. Immunoblotting using an HA antibody detected more polyu-biquitin chain-conjugated RIP1 in the K63 and R48 mt than in the K48 and R63 ubiquitin mt transfected cells (Fig. 4C), suggesting that RIP1 is ubiquitinated by K63-linked polyu-biquitin chains in glioblastoma cells.
To determine the site of RIP1 ubiquitination, the preli-gand assembly complex and DISC were isolated from TRAIL-resistant cells. Immunoblotting identified DR5 and RIP1 in the preligand assembly complex and DISC. High-molecular-weight RIP1 species were enriched in the DISC
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF8
A B
C D e
F G
Figure 4. A20 E3 ligase mediates RIP1 K63-linked polyubiquitination. A, in vitro ubiquitination was performed in a reaction consisting of the components as indicated (top) with ubiquitinated RIP1 (RIP1-Ub) detected by an avidin antibody on immunoblotting. B, in vivo ubiquitination was performed by transfecting HEK293T cells with the vectors encoding Flag-RIP1, A20, and HA-UB mts and detecting RIP1-Ub by immunoblotting using Myc and HA antibody. C, in vivo ubiquitination in U87MG cells were conducted by transfecting the cells with the vectors encoding HA-UB and mts, treating the transfectants with 100 ng/mL TRAIL for 1.5 hours, isolating RIP1 under denaturing condition, and detecting RIP1-Ub by immunoblotting using antibodies to HA and RIP1. The number represents the quantification of the density. D, the preligand assembly complex (PLAC) and DISC were isolated from LN443 cells through immunoprecipitation by the use of Flag-TRAIL and Flag antibody. RIP1-Ub was detected by overexposure of immunoblotting using a RIP1 antibody. e, RIP1 was purified through immunoprecipitation under denaturing conditions from the PLAC and DISC as in (D) and RIP1-Ub was detected by immunoblotting by the use of an antibody for ubiquitin. F, RIP1 isolated from LN443 cells as in (E) was examined by immunoblotting by the use of antibodies specific to K63-linked polyubiquitin chain and RIP1. G, the PLAC and DISC were isolated from LN71 clones expressing A20 wt, OTU, and Znf mt through immunoprecipitation as in (F) and examined by immunoblotting with antibodies specific to K63-linked polyubiquitin chain and RIP1.
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF9 | CANCER DISCOVERY FEBRUARY 2012
A B
C D
e
Figure 5. K63-linked ubiquitin chain binds to caspase-8 and inhibits its cleavage. A, caspase-8 (Casp-8) was purified by the use of its antibody through immunoprecipitation from LN443 cells after treatment with 100 ng/mL TRAIL and examined by immunoblotting for ubiquitin-conjugated RIP1. B, in vivo Fv-caspase-8 binding assay was carried out in LN443 cells. The cell line was either treated or untreated with 100 ng/mL TRAIL for the times indicated (top) and then subjected to subcellular fractionation. RIP1 was isolated through immunoprecipitation and caspase-8 binding to the RIP1 K63-linked polyubiquitin chain was detected by immunoblotting. C, in vitro caspase-8 binding to ubiquitin was examined by Fv-caspase-8 (left) and caspase-8 protease p18 subunit pull down (right), in which Fv-caspase-8 and p18 subunit bound beads were incubated with the monoubiquitin, K63, K48-linked, and linear polyubiquitin protein. Unbound (U) were washed off the beads and bound (B) proteins were eluted and identified by immunoblotting. *Indicates a nonspecific (NS) band. D, nickel column pull-down assay was carried out by incubating a His-K63 polyubiquitin chain-labeled nickel column and Fv-caspase-8 in various concentrations as indicated (top). The column was washed and the caspase-8 and His-K63 polyubiquitin chain were eluted and examined by immunoblotting. e, in vitro caspase-8 cleavage assay was performed by incubating monoubiquitin (mono-Ub) and polyubiquitin (pUb) chains with Fv-caspase-8 for 2 hours, then adding Fv ligand AP20187 and detecting caspase-8 cleavage in the reactions by immunoblotting.
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF10
assembly complex is formed in glioblastoma tumor tissues and tumor-initiating cells.
To further evaluate RIP1 ubiquitination in CD133+ cells, we propagated the cells in neurosphere culture conditions, which maintains the original cancer genomic features (30). The preligand assembly complex and DISC were isolated from the CD133+ cells and DR5, RIP1, and A20 were de-tected in both the preligand assembly complex and DISC whereas FADD and caspase-8 were recruited to the DISC, where caspase-8 was not cleaved (Fig. 6F). K63-linked poly-ubiquitin chain-conjugated RIP1 was also identified in the DISC but not the preligand assembly complex (Fig. 6G). Taken together, these results validate the preligand assem-bly complex and DISC models, as established from studies of TRAIL-resistant cell lines, in glioblastoma tissues and de-rived tumor-initiating cells and suggest that glioblastomas in patients are most likely resistant to TRAIL treatment.
The A20 e3 Ligase Inhibits TRAIL-Induced Apoptosis in Tumor-Initiating Cells
To confirm that the CD133+ population represents tumor-initiating cells (32), we established the self-renewal ability by neurosphere formation, the differentiation ability by cell differentiation assay, and the tumorigenic ability by mouse brain xenograft formation (Supplementary Fig. S10A–C). Once identified as the tumor-initiating cells, CD133+ cells were treated with 100 ng/mL TRAIL for 24 hours. Approximately 20% cell death was detected in EH 091112 and 100113 cells, but no cell death was seen in EH 091217 and 091106 cells (Fig. 7A).
Next, we transfected A20 siRNA in CD133+ cells and confirmed A20 knockdown by immunoblotting (Fig. 7B). This showed that transfection of the A20 siRNA alone had no significant effects on cell survival (Fig. 7A) and self- renewal (Supplementary Fig. S11A). The A20 siRNA- transfected CD133+ cells were treated with 100 ng/mL TRAIL, and TRAIL-induced apoptosis was observed, marked by a significant increase in the enzymatic activities of caspase-8 (Fig. 7C) and caspase-3/-7 (Supplementary Fig. S11B). To confirm that the Znf domain of E3 li-gase inhibits caspase-8-initiated apoptosis, we examined the negative dominant effect of the inactive OTU and Znf4 mts on TRAIL-induced apoptosis in CD133+ cells. A20 wt, OTU mt, and Znf4 mt were introduced into CD133+ cells through lentiviral transduction. Expression of A20 Znf4 mt but not A20 wt or OTU mt enhanced TRAIL-induced apoptosis, as shown by cell death and cas-pase activity (Fig. 7D). Together, these results suggest that the Znf E3 ligase is responsible for caspase-8 inhibition and TRAIL resistance in the tumor-initiating cells of hu-man glioblastomas.
discussionRecent advances have generated novel cancer therapeu-
tics targeting the TRAIL apoptotic pathway; however, the results of clinical trials have suggested that cancers are resis-tant to these treatments. The results presented here reveal a molecular mechanism by which A20 E3 ligase-mediated
interaction of caspase-8 and K63-linked polyubiqui-tin chain (Supplementary Fig. S8C). To confirm this, we used a recombinant caspase-8 protease p18 subunit in a pull-down assay. The protease p18 subunit was bound to protein G-beads with a caspase-8 antibody and caspase-8 p18-labeled beads were incubated with monoubiquitin and polyubiquitin chains. The pull-down assay showed that the protease p18 subunit-labeled beads mainly pulled down K63-linked polyubiquitin chains. To determine whether the K63-linked polyubiquitin chain directly binds to Fv-caspase-8, we generated a nickel column bound with His-tagged K63-linked polyubiquitin chains. Fv-caspase-8 was added to the His-K63-linked polyubiquitin chain-labeled nickel column and the nickel column pull-down assay iden-tified the binding of Fv-caspase-8 to the His-K63-linked polyubiquitin chains (Fig. 5D).
To define the role of the K63-linked polyubiquitin chain in caspase-8 dimerization and cleavage, we used an in vi-tro Fv-caspase-8 dimerization and cleavage assay (35) in which Fv-caspase-8 is dimerized and cleaved by adding a synthetic Fv ligand, AP20187 (Supplementary Fig. S8D). Monoubiquitin and polyubiquitin chains were added to the Fv-caspase-8 cleavage assay. After the reaction, the proteins were separated and examined by immunoblotting with the use of caspase-8 and ubiquitin antibody. The results showed that the cleavage of Fv-caspase-8 in the presence of AP20187 was significantly inhibited by the K63-linked polyubiquitin chains and slightly inhibited by the linear polyubiquitin chain (Fig. 5E, Supplementary Fig. S8E). Taken together, these results suggest that binding of K63-linked polyubiq-uitin chain to the caspase-8 protease domain inhibits its dimerization and cleavage.
Preligand Assembly Complex and DIsC Are Present in Glioblastoma Tissues and Tumor-Initiating Cells
To validate whether A20-mediated ubiquitination of RIP1 occurs in vivo, we examined human glioblastoma tumor tissues surgically removed from patients (Supplementary Fig. S9A) and glioblastoma tumor-initiating cells en-riched by CD133 sorting as previously reported (29, 32) (Supplementary Fig. S9B). The CD133+ cells were used soon after isolation to avoid prolonged culturing effects. Immunoblotting showed that A20 and RIP1 were expressed in the CD133+ cells at levels similar to those seen in the matched parental tissues (Supplementary Fig. S9C), as re-cently reported (37). A size-exclusion assay detected DR5, RIP1, A20, and TRAF2 in the high-molecular-weight frac-tions of the tissues (Fig. 6A) and matched CD133+ cells (Fig. 6B).
Subcellular fractionation further revealed DR5, RIP1, A20, and TRAF2 enrichment in the membrane fractions of the tissues (Fig. 6C) and matched CD133+ cells (Fig. 6D). To further confirm this in the tumor initiating cells, we iso-lated the preligand assembly complex from the pooled high- and low-molecular-weight fractions of the CD133+ cells through immunoprecipitation using Flag-TRAIL and Flag antibody and detected A20 and RIP1 in the high- but not the low-molecular-weight fractions (Fig. 6E). These results suggest that a membrane-bound DR5-associated preligand
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF11 | CANCER DISCOVERY FEBRUARY 2012
Figure 6. The preligand assembly complex and DISC are identified in glioblastomas. A–D, glioblastoma tumor tissues and derived CD133+ cells (EH 091112) were subjected to size exclusion assay (A, B) and subcellular fractionation (C, D) and then examined by immunoblotting for the presence of the proteins as indicated (left). e, the preligand assembly complex was isolated with the use of Flag-TRAIL from the pooled high-molecular-weight fraction 42–50 and low-molecular-weight fraction 62–70 of CD133+ cells (EH 091112) and examined by immunoblotting. The input was included to show the protein loading. F–G, the preligand assembly complex and DISC were isolated from CD133+ cells (EH 091112, 091106) through immunoprecipitation by the use of Flag-TRAIL and Flag antibody and examined by immunoblotting for the presence of the proteins (F) and the RIP1 ubiquitination (G).
A C
B D
e F G
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF12
Figure 7. A20 protects the tumor-initiating cells from TRAIL-induced apoptosis. A–C, CD133+ cells (EH 091112, 100113, 091217, and 091106) were transfected or not transfected with A20 and scrambled (Scr) siRNA, treated or untreated with 100 ng/mL TRAIL, and examined for (A) cell death, (B) immunoblotting (IB), and (C) caspase-8 activity (Casp-8). D, EH 091112 cells were transfected with the lentiviral vectors encoding the A20 wt, OTU, and Znf4 mt; treated or untreated with 100 ng/mL TRAIL; and examined for cell death and caspase-8 activity Each of the experiments was repeated 6 times (points: means; bars: SE; n = 6; ***P 0.001). e, a 2-complex model of A20 E3 ligase-mediated inhibition of caspase-8 through RIP1 polyubiquitination. NT, nontransfected; PLAC, preligand assembly complex.
Ca
sp
-8
a
ctiv
ity
Ce
ll d
ea
th
(%
)C
ell d
ea
th
(%
)
Ca
sp
-8
a
ctiv
ity
Scrambled siRNA
Scrambled siRNA
A
Ca
sp
-8
a
ctiv
ity
Ce
ll d
ea
th
(%
)C
ell d
ea
th
(%
)
Ca
sp
-8
a
ctiv
ity
Scrambled siRNA
Scrambled siRNA
B
Ca
sp
-8
a
ctiv
ity
Ce
ll d
ea
th
(%
)C
ell d
ea
th
(%
)
Ca
sp
-8
a
ctiv
ity
Scrambled siRNA
Scrambled siRNA
C
Ca
sp
-8
a
ctiv
ity
Ce
ll d
ea
th
(%
)C
ell d
ea
th
(%
)
Ca
sp
-8
a
ctiv
ity
Scrambled siRNA
Scrambled siRNA
D
Ca
sp
-8
a
ctiv
ity
Ce
ll d
ea
th
(%
)C
ell d
ea
th
(%
)
Ca
sp
-8
a
ctiv
ity
Scrambled siRNA
Scrambled siRNA
e
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF13 | CANCER DISCOVERY FEBRUARY 2012
N-terminal OTU deubiquitinating enzyme and a C-terminal E3 ligase (28). An in vitro ubiquitination assay suggests that A20 E3 ligase mediates RIP1 K48-linked ubiquitination for its degradation and thus inhibits TNF-α–induced NF-κB sig-naling (28). In contrast, in vivo studies indicate that RIP1 is ubiquitinated through a K63-linked polyubiquitin (17) and that IKKg binds to either K63 or M1-linked polyubiq-uitin chains for NF-κB activation (18). Further studies have confirmed that the A20 can remove K63-linked polyubiqui-tin chain from RIP1, RIP2, and TRAF6 (25–27). However, A20 has been shown to inhibit TNF-α–induced apoptosis in mouse hepatocytes (24), IKKg-deficient Jurkat cells (43), and glioblastoma-derived CD133+ cells (37) through unknown mechanisms. We show here that the A20 E3 ligase is able to mediate RIP1 ubiquitination through K48- and K63-linked polyubiquitin chains in vitro and in vivo in the presence of a polyubiquitin chain-specific E2. In glioblastoma cells, how-ever, A20 E3 ligase mediates RIP1 ubiquitination through a K63-linked polyubiquitin chain that binds to the caspase-8 protease and inhibits TRAIL-induced apoptosis.
Somatic mutations in TNFAIP3, the gene encoding the A20 protein, have been identified in lymphomas (44, 45). The mutations are clustered in the A20 Znf6 and Znf7 domains and result in loss of A20 function. Reconstitution of wild-type TNFAIP3 in the TNFAIP3-mutated lymphoma cells induces cell death (44). However, it is unclear how the transfected TNFAIP3 triggers apoptosis in the lymphoma cells. These results suggest that TNFAIP3 may act as a tumor suppressor gene in lymphomas (46). In contrast to the lymphomas, genomic analysis of glioblastomas by The Cancer Genome Atlas (47) has failed to identify TNFAIP3 mutations. However, the REpository for Molecular BRAin Neoplasia DaTa (REMBRANDT), sponsored by the National Cancer Institute, indicates TNFAIP3 mRNA over-expression in human glioblastomas, keeping in line with our finding that A20 protein is highly expressed in these tumors and inhibits TRAIL-induced apoptosis in the tu-mor-initiating cells. It appears that A20 plays a different role in lymphocytic tumors as opposed to solid tumors, which is consistent with the original report that it restricts NF-κB signaling in lymphocytes but protects hepatocytes from apoptotic insult in mice (24). In conclusion, the data presented here suggest that A20 E3 ligase acts as an onco-gene that inhibits TRAIL-induced apoptosis. Targeting of the A20-mediated RIP1 ubiquitination process may there-fore lead to the development of combination therapies that can eliminate TRAIL resistance in tumor-initiating cells and enhance the therapeutic efficacy of TRAIL-targeted thera-pies in human glioblastomas.
Methodshuman Glioblastoma Tissues, CD1331 Cells, Cell Lines, and Normal human Astrocytes
The glioblastoma and normal brain tissues used in Figure 1 were kindly provided by the London (Ontario) Brain Tumor Tissue Bank (London Health Sciences Center, London, Ontario, Canada) and the normal brain tissues were sampled from epilepsy lobec-tomy specimen. The glioblastoma tissues used in Figures 6 and 7 were collected from Emory University Hospital in accordance with
RIP1 polyubiquitination inhibits caspase-8 dimerization and cleavage and TRAIL-induced apoptosis in glioblas-toma cells through two signaling complexes (Fig. 7E). A20 and RIP1 are both highly expressed in glioblastomas, in which they interact with the transmembrane DR5 and form a plasma membrane-bound preligand assembly complex under physiologic conditions. TRAIL treatment leads to the DR5-mediated recruitment of FADD and caspase-8 to the preligand assembly complex for the formation of the DISC, where the A20 E3 ligase mediates K63-linked RIP1 polyubiquitination. The K63-linked polyubiquitin chain of RIP1 binds to the caspase-8 protease domain, blocks caspase-8 dimerization and cleavage, and inhibits TRAIL-induced apoptosis in glioblastoma cells.
This 2-complex model is compatible with recent reports that ubiquitination regulates the TRAIL pathway. TRAIL-induced apoptosis requires caspase-8 polyubiquitination in that caspase-8 is a known substrate of the CUL3 E3 ligase and caspase-8 ubiquitination facilitates caspase-8 cleav-age in TRAIL-sensitive cell lines (23). As a complement to this model, our study establishes a molecular mechanism of TRAIL resistance. Here, we identify caspase-8 as an ubiquitin binding protein and show that a RIP1 K63-linked polyubiq-uitin chain binds to the caspase-8 protease domain to inhibit its dimerization and cleavage. The findings that A20 and RIP1 are highly expressed and present in both the preligand assembly complex and DISC in resistant cells are in line with the recent report that the content and status of proteins in a cell determine whether or not cell death or cell survival occurs under TRAIL treatment (38).
The results reported here establish a novel model that reconciles the disparity in earlier studies. A size exclusion as-say has identified TNFR1 in fractions corresponding to its monomeric molecular weight, leading to the notion that the TNFR1-associated complex I is formed after TNF-α stimula-tion to enact TNF-α–induced NF-κB signaling, whereas the cytoplasmic complex II is formed through the recruitment of FADD and caspase-8 after complex I is detached from TNFR1 to enact TNF-α–induced apoptosis (20). We report here a distinct, 2-complex TRAIL signaling model in which the preligand assembly complex is spontaneously formed under physiologic conditions. TRAIL treatment then stimulates the recruitment of FADD and caspase-8 to the preligand assembly complex for the formation of the DISC, leading to either cell death or survival depending on the composition and status of proteins in the complexes. A20 and RIP1 are associated with DR5 in the spontaneously formed preligand assembly complex in TRAIL-resistant cells, and TRAIL stimulates A20 E3 ligase-dependent RIP1 polyubiquitination and caspase-8 binding through a K63-linked polyubiquitin chain that in-hibits caspase-8 dimerization and cleavage to ultimately prevents initiation of TRAIL-induced apoptosis. Once apop-tosis is inhibited by A20-mediated RIP1 polyubiquitination, subsequent recruitment of IKKg (17), cellular FADD-like interleukin-1β-converting enzyme-inhibitory protein (c-FLIP), and phosphoprotein enriched in diabetes to the DISC leads to the activation of NF-κB (33, 39) and extracellular signal-regu-lated kinase 1/2 (40, 41) to promote cell growth (42).
The results presented here establish the role of A20 E3 li-gase in the inhibition of TRAIL-induced apoptosis. A20 has an
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF14
G-linked agarose overnight at 4°C. The beads were washed and eluted with 150 ng/μL of 33 Flag peptide (Sigma-Aldrich) (33). To isolate the preligand assembly complex, the cells were lysed first and then incubated with mixed Flag-TRAIL and Flag antibody as described previously. The preligand assembly complex, DISC, size exclusion samples, subcellular fractions and lysates from cell lines, CD133+ cells, and tissues were examined by immunoblotting as described (33) with the use of antibodies specific to CUL3 (BD Biosciences), DR5 (ProSi Inc.), TRAF2 (H249), ubiquitin (P4D1), myc (Santa Cruz Biotechnology, Inc.), RIP1, FADD (BD Biosciences), K63-linked polyubiquitin chain (Biomol International and Millipore), caspase-8 (MBL), DFF45 (StressGen), HA (Covance), and His tag (Novagen).
In Vitro and In Vivo UbiquitinationFlag-RIP1 and myc-A20 wt proteins were generated through TNT
Quick Coupled Transcription/Translation Systems (Promega). After reaction, a Flag-RIP1 was mixed with Flag antibody-labeled agarose beads and eluted using Flag peptide (Sigma-Aldrich) and concentrated through Amicon Ultra-0.5 Centrifugal Filters (Millipore). Myc-A20 wt protein was isolated through immunopre-cipitation using myc-agarose beads. In vitro ubiquitination was per-formed in a 20-μL reaction volume containing 2 μg of N-terminal biotinylated ubiquitin, 5 μg of ubiquitin, 200 ng of E1, 400 ng of UBC13 (Boston Biochem) or UBCH5A (Calbiochem), 2 μL of 10× reaction buffer, and 1× Mg-ATP (Boston Biochem). After a 1-hour incubation at 30°C, reactions were terminated by adding SDS loading buffer and examined by immunoblotting. For in vivo ubiquitination, U87MG cells were transfected with plasmids encod-ing HA-UB and mts for 24 hours and treated or untreated with 100 ng/mL TRAIL for 1.5 hours. Cell lysates were heated at 95°C for 10 minutes in 1% SDS to dissociate proteins and diluted ten times in non-SDS-containing buffer. RIP1 was isolated by RIP1 antibody (Santa Cruz Biotechnology, Inc.) through immunoprecipitation and examined by immunoblotting using HA (Covance) and RIP1 antibody (BD Biosciences).
Caspase-8 Binding, Dimerization, and Cleavage Assay
In vivo caspase-8 binding to ubiquitin was examined as follows: LN443 cells were treated or not with 100 ng/mL TRAIL for 1.5 and 3 hours and subjected to subcellular fractionation. RIP1 was isolated from the cytosol and membrane fraction under denaturing condi-tions, then incubated with Fv-caspase-8 for 1 hour and examined by immunoblotting using antibodies to caspase-8 and K63-linked polyubiquitin chain. In vitro caspase-8 binding to ubiquitin was examined in the following 2 experiments. In the first experiment, Fv-caspase-8-labeled or caspase-8 protease p18 domain-labeled agarose beads were incubated with recombinant ubiquitin (Boston Biochem) for 1 hour at 4°C in ubiquitin binding buffer (50 mM Tris, 150 mM NaCl, 0.2% Triton x-100, 1 mM EDTA, 0.5 mM DTT). After washes, the agarose beads were precipitated by centrifugation. In the second experiment, Fv-caspase-8 or caspase-8 protease p18 sub-unit was incubated with His-K63-linked polyubiquitin chain-bound Nickel agarose beads (QIAGEN). In both experiments, unbound proteins were washed off the beads with binding buffer, and bound proteins were eluted by 1% SDS-containing binding buffer and ex-amined by immunoblotting using ubiquitin and caspase-8 antibody. The caspase-8 dimerization and cleavage assay was performed as described (35, 36).
statistical AnalysisAll values are expressed as mean ± SD. Statistical significance was
assessed by unpaired Student t test, one-way ANOVA followed by Dunnett test, and 2-way ANOVA followed by Bonferroni test.
protocols approved by the Emory University Institutional Review Boards. CD133 cells were sorted from dissociated tumors using CD133 antibody-labeled magnetic microbeads (Miltenyi Biotec) on the basis of previous reports (32) and labeled with EH (Emory Hospital) and numbers. Glioblastoma cell lines (33) and normal human astrocytes were reported (34), and no authentication was done by the authors since.
Generation of A20 Wild-Type and Mutant Clones through Lentiviral Transduction
The pcDNA3.1/myc-his A20 wt, OTU, and Znf4 mt were gener-ated through site-directed mutagenesis (Genscript). Lentiviral vec-tor pLenti6.3/V5-DEST was inserted with A20 wt, OTU, and Znf4 mt and introduced into LN71 cells through lentiviral transduction in the presence of polybrene (2 μg/mL). The transfectants were grown in blasticidin-containing selection medium, and single-cell clones were expanded and examined by immunoblotting for the stable expression of the A20 protein.
RNA Interference, Cell Death, and Caspase Activity Assay
The siRNA specific to TNFAIP3 (CCGAGCTGTTCCACTTGTTAA; CAGATGTATGGCTAACCGGAA), RIP1, TRAF2, and scrambled siRNA (QIAGEN) were transfected using HiPerfect Transfection (QIAGEN) for 72 hours. The transfectants were treated or un-treated with TRAIL (PeproTech, Inc.) and examined by Cell Titer-Glo Luminescent Cell Viability assay for cell death and Caspase-Glo8 and Glo3/7 kits (Promega) for the caspase activities. Lentiviral scrambled shRNA (SHC002) and A20 shRNA (NM_006290.2-635s1c1:5'-CCGGCACTGGAAGAAATACACATATCTCGAGATATGTGTATTTCTTCCAGTGTTTTTG -3') were from Sigma Mission RNAi.
size-exclusion ChromatographyCell lines and CD133+ cells (108), treated or untreated with 100
ng/mL TRAIL for 5 minutes, were lysed in CHAPS-containing ly-sis buffer (14 mM CHAPS, 150 mM NaCl, and 20 mM Tris-Hcl; pH 7.4) plus complete protease inhibitors (Sigma-Aldrich) and 1 mM phenylmethylsulfonylfluoride. Lysates were filtered through a 0.45-micron filter and loaded onto superdex-200 HR16/60 column. Proteins were eluted at 1 mL/min. Fractions (1 mL) were analyzed by western blotting for DR5, RIP1, A20, TRAF2, and caspase-8. The ap-parent molecular weight was evaluated after column calibration with standard proteins (GE Healthcare): thyroglobulin (669 kDa), ferritin (440 kDa), adolase (158 kDa), Conalbumin (75 kDa), and ovalbumin (43 kDa).
subcellular FractionationSubcellular fractionation experiments were performed using the
ProteoExtract subcellular proteome extraction kit (Calbiochem) with 5 × 106 cells per sample. For RIP ubiquitination, the cytosol and membrane fractions were treated with 1% SDS and boiled for 10 minutes to separate proteins in the complexes and then diluted 10× to 0.1% SDS. RIP1 was immunoprecipitated with the use of 2 μg of RIP1 polyclonal antibody (Santa Cruz Biotechnology, Inc.) for 4 hours that was washed 5 times: 2 times for 10 minutes in lysis buffer plus 1M NaCl and 3 times for 10 minutes in lysis buffer.
Immunoprecipitation and ImmunoblottingTo isolate the DISC, 1 × 107 cells were incubated with mixed
500 ng/mL Flag-TRAIL and 1,500 ng/mL Flag antibody for 15 to 90 minutes at 37°C or 3 hours at 4°C for the detection of CUL3. After wash, the cells were lysed for 30 min on ice in DISC immuno-precipitation lysis buffer (30 mM Tris, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100). Cell lysates were incubated with protein
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Bellail et al.ReseARCh ARTICLe
www.aacrjournals.orgOF15 | CANCER DISCOVERY FEBRUARY 2012
TNFalpha-mediated cell death. Science 2004;305:1471–4. 17. Ea CK, Deng L, Xia ZP, Pineda G, Chen ZJ. Activation of IKK by
TNFalpha requires site-specific ubiquitination of RIP1 and polyubiquitin binding by NEMO. Mol Cell 2006;22:245–57.
18. Rahighi S, Ikeda F, Kawasaki M, Akutsu M, Suzuki N, Kato R, et al. Specific recognition of linear ubiquitin chains by NEMO is important for NF-kappaB activation. Cell 2009;136:1098–109.
19. Micheau O, Tschopp J. Induction of TNF receptor I-mediated apop-tosis via two sequential signaling complexes. Cell 2003;114:181–90.
20. Wang L, Du F, Wang X. TNF-alpha induces two distinct caspase-8 activation pathways. Cell 2008;133:693–703.
21. Bodmer JL, Holler N, Reynard S, Vinciguerra P, Schneider P, Juo P, et al. TRAIL receptor-2 signals apoptosis through FADD and caspase-8. Nat Cell Biol 2000;2:241–3.
22. Kischkel FC, Lawrence DA, Chuntharapai A, Schow P, Kim KJ, Ashkenazi A. Apo2L/TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5. Immunity 2000;12:611–20.
23. Jin Z, Li Y, Pitti R, Lawrence D, Pham VC, Lill JR, et al. Cullin3-based polyubiquitination and p62-dependent aggregation of caspase-8 mediate extrinsic apoptosis signaling. Cell 2009;137:721–35.
24. Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, et al. Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 2000;289:2350–4.
25. Shembade N, Ma A, Harhaj EW. Inhibition of NF-kappaB signaling by A20 through disruption of ubiquitin enzyme complexes. Science 2010;327:1135–9.
26. Boone DL, Turer EE, Lee EG, Ahmad RC, Wheeler MT, Tsui C, et al. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat Immunol 2004;5:1052–60.
27. Hitotsumatsu O, Ahmad RC, Tavares R, Wang M, Philpott D, Turer EE, et al. The ubiquitin-editing enzyme A20 restricts nucleotide-binding oligomerization domain containing 2-triggered signals. Immunity 2008;28:381–90.
28. Wertz IE, O’Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S, et al. De-ubiquitination and ubiquitin ligase domains of A20 downregu-late NF-kappaB signalling. Nature 2004;430:694–9.
29. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al. Identification of human brain tumour initiating cells. Nature 2004;432:396–401.
30. Lee J, Kotliarova S, Kotliarov Y, Li A, Su Q, Donin NM, et al. Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines. Cancer Cell 2006;9:391–403.
31. Piccirillo SG, Reynolds BA, Zanetti N, Lamorte G, Binda E, Broggi G, et al. Bone morphogenetic proteins inhibit the tumorigenic potential of human brain tumour-initiating cells. Nature 2006;444:761–5.
32. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, et al. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 2006;444:756–60.
33. Bellail AC, Tse MC, Song JH, Phuphanich S, Olson JJ, Sun SY, et al. DR5-mediated DISC controls caspase-8 cleavage and initiation of apoptosis in human glioblastomas. J Cell Mol Med 2010;14:1303–17.
34. Song JH, Bellail A, Tse MCL, Yang VW, Hao C. Human astrocytes are resistant to Fas ligand and tumor necrosis factor-related apoptosis-induced apoptosis. J Neurosci 2006;26:1–10.
35. Chang DW, Yang X. Activation of procaspases by FK506 binding protein-mediated oligomerization. Sci STKE 2003;2003:PL1.
36. Chang DW, Xing Z, Capacio VL, Peter ME, Yang X. Interdimer processing mechanism of procaspase-8 activation. EMBO J 2003;22:4132–42.
37. Hjelmeland AB, Wu Q, Wickman S, Eyler C, Heddleston J, Shi Q, et al. Targeting A20 decreases glioma stem cell survival and tumor growth. PLoS Biol 2010;8:e1000319.
38. Spencer SL, Gaudet S, Albeck JG, Burke JM, Sorger PK. Non-genetic origins of cell-to-cell variability in TRAIL-induced apoptosis. Nature 2009;459:428–32.
39. Lin Y, Devin A, Cook A, Keane MM, Kelliher M, Lipkowitz S, et al. The death domain kinase RIP is essential for TRAIL (Apo2L)-induced activation of IkappaB kinase and c-Jun N-terminal kinase. Mol Cell Biol 2000;20:6638–45.
Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.
AcknowledgmentsWe thank Dr. Keith Wilkinson for his constructive suggestions of
ubiquitination experiments and Zhaobin Zhang for his technical as-sistance in animal studies.
Grant supportThis work was supported in part by NIH grant CA129687 to
C. Hao. C. Hao was a Georgia Cancer Coalition Distinguished Scholar.
Received July 14, 2011; revised December 8, 2011; accepted December 12, 2011; published OnlineFirst January 24, 2012.
ReFeReNCes 1. Wiley SR, Schooley K, Smolak PJ, Din WS, Huang CP, Nicholl JK,
et al. Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity 1995;3:673–82.
2. Pitti RM, Marsters SA, Ruppert S, Donahue CJ, Moore A, Ashkenazi A. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J Biol Chem 1996;271:12687–90.
3. Vesely MD, Kershaw MH, Schreiber RD, Smyth MJ. Natural innate and adaptive immunity to cancer. Annu Rev Immunol 2011;29:235–71.
4. Johnstone RW, Frew AJ, Smyth MJ. The TRAIL apoptotic pathway in cancer onset, progression and therapy. Nat Rev Cancer 2008;8:782–98.
5. Bellail AC, Qi L, Mulligan P, Chhabra V, Hao C. TRAIL agonists on clinical trials for cancer therapy: the promises and the challenges. Rev Recent Clin Trials 2009;4:34–41.
6. Tolcher AW, Mita M, Meropol NJ, von Mehren M, Patnaik A, Padavic K, et al. Phase I pharmacokinetic and biologic correlative study of mapatumumab, a fully human monoclonal antibody with agonist activity to tumor necrosis factor-related apoptosis-inducing ligand receptor-1. J Clin Oncol 2007;25:1390–5.
7. Plummer R, Attard G, Pacey S, Li L, Razak A, Perrett R, et al. Phase 1 and pharmacokinetic study of lexatumumab in patients with advanced cancers. Clin Cancer Res 2007;13:6187–94.
8. Herbst RS, Eckhardt SG, Kurzrock R, Ebbinghaus S, O’Dwyer PJ, Gordon MS, et al. Phase I dose-escalation study of recombinant human Apo2L/TRAIL, a dual proapoptotic receptor agonist, in patients with advanced cancer. J Clin Oncol 2010;28:2839–46.
9. Boatright KM, Renatus M, Scott FL, Sperandio S, Shin H, Pedersen IM, et al. A unified model for apical caspase activation. Mol Cell 2003;11:529–41.
10. Donepudi M, Mac Sweeney A, Briand C, Grutter MG. Insights into the regulatory mechanism for caspase-8 activation. Mol Cell 2003;11:543–9.
11. Hughes MA, Harper N, Butterworth M, Cain K, Cohen GM, MacFarlane M. Reconstitution of the death-inducing signaling complex reveals a substrate switch that determines CD95-mediated death or survival. Mol Cell 2009;35:265–79.
12. Oberst A, Pop C, Tremblay AG, Blais V, Denault JB, Salvesen GS, et al. Inducible dimerization and inducible cleavage reveal a re-quirement for both processes in caspase-8 activation. J Biol Chem 2010;285:16632–42.
13. Skaug B, Jiang X, Chen ZJ. The role of ubiquitin in NF-kappaB regulatory pathways. Annu Rev Biochem 2009;78:769–96.
14. Bhoj VG, Chen ZJ. Ubiquitylation in innate and adaptive immunity. Nature 2009;458:430–7.
15. Ikeda F, Crosetto N, Dikic I. What determines the specificity and outcomes of ubiquitin signaling?. Cell 143:677–81.
16. Li L, Thomas RM, Suzuki H, De Brabander JK, Wang X, Harran PG. A small molecule Smac mimic potentiates TRAIL- and
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
A20 E3 Ligase Inhibits TRAIL-Induced Apoptosis ReseARCh ARTICLe
FEBRUARY 2012 CANCER DISCOVERY | OF16
44. Schmitz R, Hansmann ML, Bohle V, Martin-Subero JI, Hartmann S, Mechtersheimer G, et al. TNFAIP3 (A20) is a tumor suppressor gene in Hodgkin lymphoma and primary mediastinal B cell lymphoma. J Exp Med 2009;206:981–9.
45. Novak U, Rinaldi A, Kwee I, Nandula SV, Rancoita PM, Compagno M, et al. The NF-{kappa}B negative regulator TNFAIP3 (A20) is inactivated by somatic mutations and genomic deletions in marginal zone lymphomas. Blood 2009;113:4918–21.
46. Malynn BA, Ma A. A20 takes on tumors: tumor suppression by an ubiquitin-editing enzyme. J Exp Med 2009;206:977–80.
47. Cancer Genome Atlas Research Network. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 2008;455:1061–8.
40. Kataoka T, Tschopp J. N-terminal fragment of c-FLIP(L) processed by caspase 8 specifically interacts with TRAF2 and induces activation of the NF-kappaB signaling pathway. Mol Cell Biol 2004;24:2627–36.
41. Krueger J, Chou FL, Glading A, Schaefer E, Ginsberg MH. Phosphorylation of phosphoprotein enriched in astrocytes (PEA-15) regulates extracellular signal-regulated kinase-dependent transcrip-tion and cell proliferation. Mol Biol Cell 2005;16:3552–61.
42. Ehrhardt H, Fulda S, Schmid I, Hiscott J, Debatin KM, Jeremias I. TRAIL induced survival and proliferation in cancer cells resis-tant towards TRAIL-induced apoptosis mediated by NF-kappaB. Oncogene 2003;22:3842–52.
43. He KL, Ting AT. A20 inhibits tumor necrosis factor (TNF) alpha-induced apoptosis by disrupting recruitment of TRADD and RIP to the TNF re-ceptor 1 complex in Jurkat T cells. Mol Cell Biol 2002;22:6034–45.
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172
Published OnlineFirst January 24, 2012.Cancer Discovery Anita C. Bellail, Jeffrey J. Olson, Xiaolu Yang, et al. in GlioblastomaInhibits Caspase-8 Cleavage and TRAIL-Induced Apoptosis
Mediated Polyubiquitination of RIP1−A20 Ubiquitin Ligase
Updated version
10.1158/2159-8290.CD-11-0172doi:
Access the most recent version of this article at:
Material
Supplementary
1
http://cancerdiscovery.aacrjournals.org/content/suppl/2011/12/22/2159-8290.CD-11-0172.DCAccess the most recent supplemental material at:
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's
.http://cancerdiscovery.aacrjournals.org/content/early/2012/01/20/2159-8290.CD-11-0172To request permission to re-use all or part of this article, use this link
Cancer Research. on December 25, 2019. © 2012 American Association forcancerdiscovery.aacrjournals.org Downloaded from
Published OnlineFirst January 24, 2012; DOI: 10.1158/2159-8290.CD-11-0172