A Single Band Does Not Always Represent Single Bacterial Strains In

8/3/2019 A Single Band Does Not Always Represent Single Bacterial Strains In

1/4

Biotechnology Letters 23: 12051208, 2001.

2001 Kluwer Academic Publishers. Printed in the Netherlands.1205

A single band does not always represent single bacterial strains indenaturing gradient gel electrophoresis analysis

Hiroyuki Sekiguchi1,2

, Noriko Tomioka1

, Tadaatsu Nakahara2

& Hiroo Uchiyama1,

1National Institute for Environmental Studies, 16-2 Onogawa, Ibaraki 305-8506, Japan2Institute of Applied Biochemistry, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8577, JapanAuthor for correspondence (Fax: 81-298-50-2576; E-mail: [email protected])

Received 23 April 2001; Revisions requested 2 May 2001; Revisions received 21 May 2001; Accepted 22 May 2001

Key words: bias, DGGE, microbial community, PCR, 16S rDNA

Abstract

DNA in a denaturing gradient gel electrophoresis (DGGE) band that could not be sequenced after recovery from

the gel was cloned into a TA cloning vector and a library was constructed and then 13 clones randomly picked up

from the library was sequenced. Although the excised DNA from the DGGE gel showed a single band, the library

consisted of several different sequences phylogenetically. This phenomenon was also observed in several other

DGGE bands. Therefore, this suggests that a single DGGE band does not always represent a single bacterial strain

and a new bias for quantitative analyses based on band intensities has been identified.

Introduction

The structure of the bacterial community in the en-

vironment has been investigated by culture-dependent

methods for many years. However, since it is difficult

to culture most bacteria in samples from the environ-ment (Jannasch & Jones 1959, Amann et al. 1995),

evaluation of changes in the structure of bacterial com-

munities using only culturing methods is inadequate.

Recently, analyses of the structure of bacterial com-

munities that do not depend on cultivation techniques

have been carried out (Amann et al. 1995, Head et al.

1998). As one of the culture-independent methods, de-

naturing gradient gel electrophoresis (DGGE) analysis

of the 16S rRNA gene segment has been widely used

to identify complex microbial communities and to de-

termine the phylogenetic affiliation of the community

members (Ferris et al. 1996, Watanabe et al. 2000).

DGGE was originally developed to detect specific

mutations within genomic genes due to one base mis-

match (Myers et al. 1985). Since Muyzer et al. (1993)

applied this method to environmental microorganisms,

analyses of microbial communities using DGGE have

become increasingly popular. DGGE allows the simul-

taneous analysis of multiple samples and the compar-

ison of microbial communities based on temporal and

geographicaldifferences. Furthermore, the method en-

ables sequence data to be obtained on the DNA of

dominant species from individual bands. Although

this tool has many advantages, as mentioned above,

a few biases derived from PCR and heterogeneity ofcopy number of 16S rDNA among bacterial species

have been reported (Muyzer 1998, Lionel et al. 2000).

In this paper, we have identified a new bias associ-

ated with the co-migration of phylogenetically hetero-

geneous bands in a DGGE gel and have attempted to

alleviate this shortcoming in the method.

Materials and methods

DNA source, extraction, amplification, and

purification

Water sample collected from a river was filtered us-

ing a 0.2 m pore size filter (25 mm diam. Type

JG, Millipore, New Bedford, MA) to trap bacter-

ial cells. Total DNA was extracted from the bacter-

ial cells on the filter using Fast DNA kit (BIO101,

Vista, CA). For DGGE analysis, the V3 region of


2/4

1206

Fig. 1. DGGE analysis showing the profiles of original PCR ampli-

con (A), purified DNA until a single band was observed by repeating

DGGE 3 times after excision of the band from the original profile

(B), and migrations of inserted region in the clones (113). Excised

DGGE band is indicated by an arrow.

16S rDNA was amplified by using 357F-GC (5 -C-

GCCCGCCGCGCGCGGCGGGCGGGGCGGGGGC

ACGGGGGGCCTACGGGAGGCAGCAG-3) and

518R (5-GTATTACCGCGGCTGCTGG-3) as PCR

primers (Muyzer et al. 1993), and a temperature pro-

gram was implemented with touch down program

(Muyzer et al. 1993). The amplicon was applied

to a 2% agarose gel and DNA in a band was ex-

cised and purified using a DEAE-cellulose membrane

(DE81, Whatman International Ltd., Maidstone, UK),

and applied to DGGE. For the control experiment,

Arthrobacter atrocyaneus ATCC13752T was used as

standard strain. After cultivation in YG medium, thecells were collected by centrifugation at 4 C, and

DNA extraction and purification at the following steps

were performed in the same way as described above.

Denaturing gradient gel electrophoresis (DGGE)

DGGE was performed using a D-Code system (Bio-

Rad Laboratories, Inc., Hercules, CA). Acrylamide

gel (8%) was prepared and run with 0.5 TAE buffer

(1 TAE = 0.04 M Tris base, 0.02 M sodium acetate,

and 10 mM EDTA; pH adjusted to 7.4). DGGE gel

consisted of a 2070% gradient of urea and formamide

in the direction of electrophoresis as denaturant, a

condition common in many studies. The 100% denat-

urant consisted of 40% (v/v) formamide and 7 M urea.

DGGE was conducted at a constant voltage of 100 V

at 60 C for 4 h. The gel was stained with SYBR Gold

(Molecular Probes, Eugene, OR) and photographed.

Sequencing of DGGE band

The band in the DGGE gel was carefully excised

with a razor blade under UV illumination, and then

placed in 100 l TE buffer. DNA was extracted from

the gel piece by overnight incubation at 4 C, and

then 0.5 l supernatant was used as template DNA

in the re-amplification by PCR using 357F-GC and

518R primers. The resulting amplicon was run again

on DGGE gel to verify its position with the original

band. This operation was repeated until the band ap-

peared to be single. Thereafter, PCR using GC-2 (5 -

GAAGTCATCATGACCGTTCTGGCACGGGGGGC

CTA-3, Watanabe et al. 1998) and 518R primers was

performed to obtain a sufficient amount of template

DNA for sequencing. Thereafter, the amplicon was

purified with Wizard PCR preps (Promega, Madison,

WI) and sequenced directly by using BigDye termina-

tor cycle sequencing kit (Applied biosystems, Foster

City, CA). When the resultant sequencing failed dueto the presence of many ambiguous peaks, DNA in the

band was cloned by using TA-cloning kit (Invitrogen,

Carlsbad, CA), and a clone library was constructed.

Phylogenetic analysis

A phylogenetic tree was constructed by the neighbor-

joining method (Saito & Nei 1987) with the

CLUSTAL X software packages (Thompson et al.

1994, Jeanmougin et al. 1998).

Results and discussion

In our previous study on bacterial community struc-

ture by DGGE, unreadable sequences from repeatedly

purified bands were often observed. To address this

problem, we constructed a clone library of an un-

readable band DNA and sequenced 13 clones picked

randomly from the library. As shown in Figure 1, al-

though the excised DNA gave a single band (Band B),

the migrations of the inserted region of the clones on

DGGE were not the same, and the clone library con-

sisted of several different sequences phylogenetically.

Especially for the clones no. 25, 9, 11, 12, and 13,the migrations were almost identical. As for the clones

no. 1, 68, and 10, the migrations apparently differed

from those of band B, and also phylogenetically. These

results suggested that, although the repeatedly purified

band appeared as a single band, it may include a small

amount of heterogeneous DNA on DGGE.


3/4

1207

Fig. 2. Phylogenetic tree showing the relationship of the sequences obtained from the excised band clone library (A) and control experiment

using Arthrobacter atrocyaneus (B). Shading in tree A indicates phylogenetically independent groups estimated based on the variation of

shading in tree B. The scale bar represents the percentage of divergence.

The heterogeneity of the excised single band may

be ascribed to mis-incorporationor mis-reading during

the PCR and sequencing steps. To determine whether

the clone library was artificially heterogeneous due

to these steps, we performed a control experiment

and verified the error rate by using the V3 region of

16S rDNA ofArthrobacter atrocyaneus ATCC13752T

which had the same region as that described above.

Amplified V3 region of 16S rDNA of A. atrocya-

neus was applied to DGGE three times as described

in Materials and methods, and then a clone library

was constructed and sequenced. Consequently, among

11 clones, the sequences from nine clones were com-

pletely the same as those of the reference sequence

of A. atrocyaneus recorded in GenBank, and for two

clones, only one base pair was mismatched in each

clone (their phylogenetic tree is shown in Figure 2B).

These results suggested that since mis-incorporation

or mis-reading rates were very low they could not

account for the diversity of the clones shown in Fig-

ure 2A. Based on Figures 2A and 2B, it was consid-

ered that there would be at least seven groups in thisclone library (no. 26; no. 11; no. 10; no. 12, 13; no. 7;

no. 1; no. 9; no. 8)

The heterogeneity was also ascribed to the pres-

ence of faint bands, which were located very to or

overlapped the target band. However, with the current

DGGE method, it is difficult to rule out this possibil-

ity and a higher resolution DGGE method would need

to be developed. These results suggested that a sin-

gle DGGE band does not represent a single bacterial

strain and that the band which migrated to the same

position in different lanes may consist of different

bacteria. Therefore, we considered that a quantitative

analysis of each band based on the intensity should be

performed carefully due to the bias identified in this

study, in addition to the other biases already reported.

Until now, cloning analysis of 16S rDNA and fluores-

cence in situ hybridization, in addition to DGGE, had

also been used to study microbial communities. There-

fore, it will be important to evaluate the characteristics

of respective techniques and cross-check the results

obtained by these approaches to analyze the genuine

microbial community structure.

References

Amann RI, Ludwig W, Schleifer K-H (1995) Phylogenetic identifi-

cation and in situ detection of individual microbial cells without

cultivation. Microbiol. Rev. 59: 143169.

Ferris MJ, Muyzer G, Ward DM (1996) Denaturing gradient gel

electorophoresis profiles of 16S rRNA-defined populations in-

habiting a hot spring microbial mat community. Appl. Environ.

Microbiol. 62: 340346.

Head IM, Saunders JR, Pickup RW (1998) Microbial evolution,

diversity, and ecology: a decade of ribosomal RNA analysis of

uncultivated microorganisms. Microb. Ecol. 35: 121.


4/4

1208

Jannasch HW, Jones GE (1959) Bacterial populations in sea wa-

ter as determined by different methods of enumeration. Limnol.

Oceanogr. 4: 128139.

Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ

(1998) Multiple sequence alignment with Clustal X. Trends

Biochem. Sci. 23: 403405.

Lionel R, Franck P, Sylvie N (2000) Monitoring complex bacterial

communities using culture-independent molecular techniques:

application to soil environment. Res. Microbiol. 151: 167177.Muyzer G (1998) Structure, function and dynamics of microbial

communities: the molecular biological approach. In: Carvalho

GR, ed. Advances in Molecular Ecology. Amsterdam: IOS Press,

pp. 157187.

Muyzer G, de Waal EC, Uitterlinden AG (1993) Profiling of

complex microbial populations by denaturing gradient gel elec-

trophoresis analysis of polymerase chain reaction-amplified

genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:

695700.

Myers RM, Fischer SG, Lerman LS, Maniatis T (1985) Nearly

all single base substitutions in DNA fragments joined to a GC-

clump can be detected by denaturing gradient gel electrophore-

sis. Nucl. Acids Res. 13: 31313145.

Saito N, Nei M (1987) The neighbor-joining method: a new method

for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406

425.

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:

improving the sensitivity of progressive multiple sequence align-

ment through sequence weighting, positions-specific gap penal-

ties and weight matrix choice. Nucl. Acids Res. 22: 46734680.Watanabe K, Teramoto M, Futamata H, Harayama S (1998) Mole-

cular detection, isolation, and physiological characterization of

functionally dominant phenol-degrading bacteria in activated

sludge. Appl. Environ. Microbiol. 64: 43964402.

Watanabe K, Watanabe K, Kodama Y, Syutsubo K, Harayama S

(2000) Molecular characterization of bacterial populations in

petroleum-contaminated groundwater discharged from under-

ground crude oil storage cavities. Appl. Environ. Microbiol. 66:

48034809.

A Single Band Does Not Always Represent Single Bacterial Strains In

Documents

Transcript of A Single Band Does Not Always Represent Single Bacterial Strains In