MOLECULAR AND CELLULAR BIOLOGY, Apr. 2008, p. 2815–2824 Vol. 28, No. 80270-7306/08/$08.00�0 doi:10.1128/MCB.01946-07Copyright © 2008, American Society for Microbiology. All Rights Reserved.

A Role for Interferon Regulatory Factor 4 in Receptor Editing�

Simanta Pathak, Shibin Ma, Long Trinh, and Runqing Lu*Department of Genetics, Cell Biology, and Anatomy, University of Nebraska Medical Center, Omaha, Nebraska 68198

Received 29 October 2007/Returned for modification 16 November 2007/Accepted 6 February 2008

Receptor editing is the primary means through which B cells revise antigen receptors and maintain centraltolerance. Previous studies have demonstrated that interferon regulatory factor 4 (IRF-4) and IRF-8 promoteimmunoglobulin light-chain rearrangement and transcription at the pre-B stage. Here, the roles of IRF-4 and-8 in receptor editing were analyzed. Our results show that secondary rearrangement was impaired in IRF-4but not IRF-8 mutant mice, suggesting that receptor editing is defective in the absence of IRF-4. The role ofIRF-4 in receptor editing was further examined in B-cell-receptor (BCR) transgenic mice. Our results showthat secondary rearrangement triggered by membrane-bound antigen was defective in the IRF-4-deficient mice.Our results further reveal that the defect in secondary rearrangement is more severe at the immunoglobulin� locus than at the � locus, indicating that IRF-4 is more critical for the � rearrangement. We provide evidencedemonstrating that the expression of IRF-4 in immature B cells is rapidly induced by self-antigen and that thereconstitution of IRF-4 expression in the IRF-4 mutant immature B cells promotes secondary rearrangement.Thus, our studies identify IRF-4 as a nuclear effector of a BCR signaling pathway that promotes secondaryrearrangement at the immature B-cell stage.

B-cell development in the bone marrow is characterized bysequential rearrangement of immunoglobulin (Ig) heavy- andlight-chain loci through a somatic DNA rearrangement eventcalled the V(D)J rearrangement. Although the total random-ness of V(D)J rearrangement is essential for the diversificationof the B-cell-receptor (BCR) repertoire, it also unavoidablybrings autoreactivity to the repertoire of newly generated im-mature B cells. Indeed, it has been estimated that 40 to 60% ofnewly synthesized B cells are autoreactive (29). Central toler-ance is the mechanism through which developing B cells arerendered nonreactive to self. Central tolerance consists of re-ceptor editing, anergy, and deletion (29). During receptor ed-iting, autoreactive B cells undergo prolonged V(D)J rear-rangement to replace the autoreactive heavy and/or light chain(9, 40). Anergy is a mechanism through which the autoreactiveB cells are rendered inactive and, thus, unable to harm the host(10). Clonal deletion is the process through which the autore-active B cells are depleted from the repertoire (12, 30). Recentstudies have indicated that clonal deletion operates as a defaultpathway to get rid of autoreactive B cells that cannot be res-cued by receptor editing (11, 14).

Receptor editing at the immature B-cell stage is induced bya self-reactive BCR, and it can also be induced by a BCR withan insufficient amount of tonic signaling (18). Receptor editingis a process through which self-reactive heavy or light chain isreplaced with a product of secondary V(D)J rearrangement(29). Secondary rearrangement occurs mainly at the Ig � and �loci. The murine � locus contains four functional J� elements:J�1, J�2, J�4, and J�5. During receptor editing, the primaryVJ� rearrangement can be replaced by secondary rearrange-ment between V� and a downstream J� element. Secondary

rearrangement can also occur between V� and a recombina-tion sequence (RS) located �25 kb downstream of the C� orbetween a site located in the J�-C� intron and the RS (7). TheRS rearrangement leads to functional inactivation of the whole� locus and the initiation of Ig � rearrangement (41).

Interferon regulatory factor 4 (IRF-4) and IRF-8 are im-mune system-specific transcription factors that have beenshown to play critical roles in innate and adaptive immunity(39). Previous studies have demonstrated that IRF-4 and -8function redundantly to control pre-B-cell development (21).B-cell development is blocked at the pre-B stage in mice lack-ing IRF-4 and -8; mutant pre-B cells are hyperproliferative anddefective in light-chain rearrangement and transcription (21).Recently, we have shown that IRF-4 and -8 induce the expres-sion of Ikaros and Aiolos to downregulate pre-BCR and inhibitpre-B-cell expansion (22). In addition, we and others have alsodemonstrated that IRF-4 and -8 induce chromatin modifica-tions at the � locus, thereby promoting � locus activation inpre-B-cell development (20, 23). Thus, the roles of IRF-4 and-8 in pre-B-cell development are twofold: one is to limit pre-B-cell expansion and the other is to promote pre-B-cell differ-entiation. The molecular mechanisms through which IRF-4and -8 control the activation of light-chain loci remain to bedetermined. However, previous studies have demonstratedthat IRF-4 and -8 interact with Ets family transcription factorsPU.1 and Spi-B to regulate the activity of the � 3� enhancerand � enhancers (3, 4). In addition, IRF-4 and -8 have beenfound to interact with E2A to regulate the activity of the � 3�enhancer (27, 28).

Although the involvement of IRF-4 and -8 in light-chainrearrangement and transcription has been established in pre-B-cell development, their role in receptor editing and second-ary rearrangement is still not clear. In this report, we examinedthe roles of IRF-4 and -8 in receptor editing. Our results showthat the ratio of �- and �-expressing B cells is perturbed inmice deficient for IRF-4, but not for IRF-8, suggesting aunique role for IRF-4 in secondary rearrangement. Using a

* Corresponding author. Mailing address: Department of Genetics,Cell Biology, and Anatomy, University of Nebraska Medical Center,Omaha, NE 68198. Phone: (402) 559-8307. Fax: (402) 559-7328. E-mail: Rlu@unmc.edu.

� Published ahead of print on 19 February 2008.

2815

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

BCR transgenic model, we show that the secondary rearrange-ment triggered by membrane-bound antigen is defective in theabsence of IRF-4. Moreover, we provide direct evidence dem-onstrating that the expression of IRF-4 in immature B cells israpidly induced by self-antigen to promote secondary rear-rangement at the light-chain loci.

MATERIALS AND METHODS

Mice. IRF-4 mutant mice have been previously described (24). Mice express-ing a transgenic BCR recognizing hen egg lysozyme (IgHEL) or a membrane-bound HEL antigen (mHEL) in the C57B6 background were purchased fromJackson Lab. IRF-4�/� mice were bred with IgHEL mice to generate miceexpressing one copy of the IgHEL transgene in an IRF-4-deficient background(IgHEL IRF-4�/�). IgHEL IRF-4�/� mice were bred with mHEL transgenic miceto generate IRF-4-deficient mice that are hemizygous for IgHEL and mHEL(IgHEL IRF-4�/� mHEL). The mice were maintained under specific-pathogen-free conditions. Experiments were performed according to guidelines from theNational Institutes of Health and with an approved IACUC protocol from theUniversity of Nebraska Medical Center. Mice 8 to 14 weeks of age were used forthis study.

FACS and cell sorting. Cells were preincubated with either 2% rat serum orFc-Block (2.4G2) and stained with optimal amounts of specific antibodies, eitherbiotinylated or directly fluorophore conjugated. Antibodies against B220 (RA3-6B2), IgMa (DS-1), IgD (11-26c), and pre-BCR (SL156) were purchased fromPharmingen; anti-� (H139-52.1) and anti-� (JC5-1) antibodies were obtainedfrom Southern Biotech. Fluorescence-activated cell sorter (FACS) analysis wasperformed with a FACSCalibur flow cytometer. To isolate immature B cells,bone marrow cells were stained with antibodies against B220 and � and weresorted by using a BD FACSAria flow cytometer.

Culture of pre-B cells. Pre-B cells were cultivated as described previously (23).Briefly, B220-positive (B220�) cells were isolated from mouse bone marrow byusing a MACS separation column (Miltenyi Biotech). Purified cells were overlaidon top of an irradiated S17 stromal-cell layer. The cells were cultivated inOpti-MEM (Gibco) medium containing 5% fetal bovine serum, 50 �M �-mer-captoethanol, 2 mM L-glutamine, 100 U penicillin-streptomycin, and 5 ng/mlinterleukin-7 (IL-7) (R&D). The pre-B cells were passaged every three days ontoa new S17 stromal layer. Cells with fewer than five passages were used for theexperiments.

Retroviral infection. The IRF-4-expressing retroviral vector has been de-scribed previously (23). To infect primary pre-B cells, retroviral vectors contain-ing the genes of interest were transfected into the ecotropic retroviral packagingcell line PLAT-E by using FuGene 6 (Roche). The cell-free supernatants werecollected at 24 and 48 h after transfection. The virus was concentrated bycentrifugation at 20,000 g for 1 h and was typically used the same day to infecttarget cells via spin infection. The infection was carried out in a 24-well plate at640 g for 1 h in the presence of 10 �g/ml of Polybrene. The infected cells wereanalyzed by FACS at different time points afterwards.

Real-time PCR analysis. The cells were lysed by using Trizol. Total RNA wasextracted and reverse transcribed with a single-strand cDNA synthesis kit(Amersham). Quantitative real-time PCR analysis was carried out in an ABI7500 real-time PCR system (Applied Biosystems) using Sybr green PCR corereagents (ABI). All samples were tested in triplicate, and average threshold cyclevalues were calculated and normalized to those for the housekeeping geneencoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH). PCR with eachprimer set was independently repeated three times, and the average values andstandard deviations of the results were calculated. The primers for the amplifi-cation of V� germ line transcripts have been described previously (8). Thesequences of other primers used in this study are as follows: Rag1 for, GGAGCAAGGTAGCTTAGCCAACATGGC, and rev, CCAGGCTTCTCTGGAACTACTGGAGACTG; Rag2 for, TGTCCCTGCAGATGGTAACAGTGGG,and rev, CGAAGAGGTGGGAGGTAGCAGCAGGAATCT; Kgl for, GAGGGGGTTAAGCTTTCGC, and rev, GCCTCCACCGAACGTCCA; �1gl for, CTTGAGAATAAAATGCATGCAAGG, and rev, TGATGGCGAAGACTTGGGCTGG; IRF-4 for, GTGGAAACACGCGGGCAAGC, and rev, GGCTCCTCTCGACCAATTCCTCA; IRF-8 for, AGAGGGAGACAAAGCTGAACCAGCC, and rev, CCACGCCCAGCTTGCATTTT; and GAPDH for, TGTGTCCGTCGTGGATCTGA, and rev, CCTGCTTCACCACCTTCTTGAT.

Intracellular Ki-67 staining and TUNEL analysis. Splenocytes were stainedwith antibodies against cell surface markers, fixed, and permeabilized in 70%ethanol. The level of expression of Ki-67 was determined by using a Ki-67staining kit (Pharmingen) according to the manufacturer’s protocol. The termi-

nal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling(TUNEL) assay was carried out with an APO-Direct kit (Pharmingen). B cellslabeled with dUTP in the absence of terminal transferase were used as thenegative control. The stained cells were analyzed by FACS.

In vivo BrdU incorporation assay. The in vivo bromodeoxyuridine (BrdU)-labeling assay was performed as described previously (1). Briefly, mice 8 to 12weeks old were injected intraperitoneally with BrdU (Sigma-Aldrich) every 12 hfor 3 days. A 200-�l amount of phosphate-buffered saline containing 0.6 mgBrdU was used for each injection. Three mice were used for each time point.Bone marrow and splenocytes were collected three days after the first injectionand stained with antibodies against B220 and IgMa. The stained cells were fixed,permeabilized, and stained with anti-BrdU antibody (Pharmingen). The percent-age of BrdU-positive B cells was determined by FACS analysis.

RS and �1 rearrangement analysis. B cells were isolated from the bonemarrow and spleens of control and mutant mice via either B220-based positiveselection with affinity columns (Miltenyi Biotec) or sorting with a BD FACSAriacell sorter. Genomic DNA was extracted from purified B cells after proteinase Ktreatment. The RS and �1 rearrangement assay results were analyzed as previ-ously described (2, 33). Briefly, the isolated genomic DNAs were serially dilutedand used as templates for semiquantitative PCR analysis. The primer sequencesfor RS rearrangement were as follows: Vkcon, GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC, and RS, CTGCCCACACGACTCCTTCAGGCAGACG; and CD19 for, AGGTAAGAAAGAGGAGGAAG, and rev, TTGTGGATTTGGAAGAGTGC. The PCR cycling conditions for amplifying the RSrearrangement product were 94°C for 45 s, 65°C for 1 min, and 72°C for 1 minfor a total of 35 cycles. The primer sequences for �1 rearrangement were asfollows: �1/2 for, AGAAGCTTGTGACTCAGGAATCTGCA, and J�1 rev, CAGGATCCTAGGACAGTCAGTTTGGT. The cycling conditions were 35 cyclesof 94°C for 45 s, 61°C for 1 min, and 72°C for 1 min. Amplified products wereresolved on a 3% agarose gel. The expression level of the CD19 gene wasmeasured and used as a loading reference.

RESULTS

The � and � ratio is perturbed in the IRF-4-deficient mice.Our previous studies have shown that IRF-4 and IRF-8 pro-mote light-chain rearrangement and transcription in pre-B-celldevelopment (23). Here, we sought to determine if IRF-4 andIRF-8 are also essential for receptor editing. �-expressing Bcells are often viewed as products of receptor editing andsecondary rearrangement. Therefore, as an initial approach toaddressing this question, we analyzed the percentages of �-ex-pressing IgM� B cells in the bone marrow and spleens ofwild-type control, IRF-4 mutant, and IRF-8 mutant mice (Fig.1A). Our results show that the percentages of �-expressing Bcells were significantly decreased in the bone marrow andspleens of IRF-4�/� mice. In the bone marrow, the percentageof �-expressing B cells was 9% in control mice (IRF-4�/�) butonly 4% in IRF-4�/� mice; in the spleen, the percentage of�-expressing B cells was also down, from 6% in the controlmice to 3% in the IRF-4�/� mice. The percentages of �-ex-pressing B cells were comparable for IRF-4�/� and IRF-4�/�

mice, suggesting that there is no haploinsufficiency effect ofIRF-4 on the � and � ratio. The percentage of �-expressing Bcells in IRF-8�/� mice was comparable to the percentage inthe control mice, suggesting that a lack of IRF-8 does not affectthe ratio of �- and �-expressing B cells. The absolute numbersof B220� and �-expressing B cells in the spleens of control,IRF-4 mutant, and IRF-8 mutant mice were also enumerated(Fig. 1B and C). Although the total number of B220� B cellswas slightly increased in IRF-4�/� mice, the number of �-ex-pressing B cells among them was only about 50% of the num-ber in the control mice. In contrast, the number of �-expressingB cells increased slightly in the IRF-8�/� mice.

The distorted ratio of � and � in IRF-4�/� mice suggests a

2816 PATHAK ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

possible defect in secondary rearrangement. In order to con-firm this finding, we measured products of secondary rear-rangement, namely RS and � rearrangement, in IRF-4�/� andcontrol mice. Since receptor editing in the bone marrow occursat the pre-B and immature B stages, we isolated both pre-Band immature B cells from the bone marrow of IRF-4�/� andIRF-4�/� mice. As shown in Fig. 1D, the products of RS and�1 rearrangement were significantly reduced in the IRF-4�/�

mice, indicating a defect in secondary rearrangement. Inter-

estingly, the � rearrangement appears to be more adverselyaffected than the RS rearrangement. Taken together, our re-sults indicate that secondary rearrangement was defective inthe IRF-4�/� mice, resulting in the distorted ratio of �- and�-expressing B cells.

Defective generation of edited B cells in IRF-4-deficientIgHEL transgenic mice encountering a membrane-bound self-antigen. It has been demonstrated that IgHEL B cells undergodeletion in the presence of the multivalent membrane-bound

FIG. 1. The � and � ratio was perturbed in the IRF-4-deficient mice. Cells were isolated from bone marrow and spleens of wild-type(IRF-4�/�), IRF-4�/�, IRF-4�/�, and IRF-8�/� mice. (A) The isolated cells were stained with antibodies against B220, IgM, and � light chain andanalyzed by FACS. The IgM� B cells were selectively gated, and the numbers represent percentages of IgM� B cells expressing � in either thebone marrow (B.M.) or spleen. The data shown are representative of the results of at least three independent experiments. (B and C) The absolutenumbers of B220� B cells and �-expressing B cells in the spleen were enumerated. The numbers are the averages and standard deviations of theresults for a total of five mice in each group. (D) Secondary rearrangement is defective in IRF-4�/� mice. Bone marrow pre-B and immature Bcells (B220low CD43low/�) were isolated via sorting from IRF-4�/� and IRF-4�/� mice. Reverse transcription-PCR analysis with serially dilutedtemplates was performed to determine RS and � rearrangement. The CD19 genomic sequence was amplified as the loading reference.

VOL. 28, 2008 IRF-4 PROMOTES SECONDARY REARRANGEMENT 2817

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

antigen HEL (12). More recently, the IgHEL B cells have alsobeen shown to undergo receptor editing in the presence ofmembrane-bound HEL (14). In order to confirm the role ofIRF-4 in receptor editing, we bred IgHEL transgenic mice withIRF-4�/� mice to generate mice expressing IgHEL B cells in anIRF-4-deficient background (IgHEL IRF-4�/�). IgHEL IRF-

4�/� mice were further bred with mice expressing the mem-brane HEL antigen to generate mice expressing IgHEL andmembrane HEL antigen in an IRF-4-null background (IgHEL

IRF-4�/� mHEL). Mice that were heterozygous mutants forIRF-4 (IRF-4�/�) were also generated and used as controls.

The B-cell development in the bone marrow and spleens of

FIG. 2. Defective generation of edited B cells in IgHEL IRF-4�/� mice encountering a membrane-bound self-antigen. (A and B) Cells wereisolated from bone marrow and spleens of IgHEL IRF-4�/�, IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL, and IgHEL IRF-4�/� mHEL mice at 8 to 10weeks of age. Cells were stained with indicated antibodies and analyzed by FACS. The numbers indicate the percentage of cells that fall into eachquadrant. (C) The splenic B cells were isolated from IgHEL IRF-4�/� mHEL and IgHEL IRF-4�/� mHEL mice 14 to 15 weeks of age. The cellswere stained with antibodies against IgMa, �, and � and analyzed by FACS. The results shown are representative of at least three independentexperiments.

2818 PATHAK ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

IgHEL IRF-4�/�, IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL,and IgHEL IRF-4�/� mHEL mice was examined (Fig. 2A andB). The absolute numbers of IgHEL B cells in the bone marrowand spleen were also counted (Table 1). The binding specificityof IgHEL B cells was confirmed by staining the cells with bio-tinylated HEL. The transgenic heavy chain is of the Ig Ma

allotype (IgMa) and can be detected by staining the cells withan anti-IgMa antibody. Previous studies have shown that in thepresence of the membrane-bound HEL antigen, IgHEL B cellsin the bone marrow of IgHEL IRF-4�/� mHEL mice down-regulate the surface expression of IgMa and undergo develop-mental arrest, resulting in an expansion of immature B cellswith low levels of B220, IgMa, and HEL (B220low IgMalow

HELlow) (5, 12). Consistent with those findings, the expressionof IgMa on immature B cells was downregulated in IgHEL

IRF-4�/� mHEL and IgHEL IRF-4�/� mHEL mice (Fig. 2A).Moreover, compared to that in IgHEL IRF-4�/� or IgHEL IRF-4�/� mice, the B220low IgMalow HELlow immature B-cell pop-ulation also significantly increased in the IgHEL IRF-4�/�

mHEL and IgHEL IRF-4�/� mHEL mice (Fig. 2A and Table1). Interestingly, the number of B220low IgMalow HELlow Bcells in the IgHEL IRF-4�/� mHEL mice was significantlyhigher than that in IgHEL IRF-4�/� mHEL mice, suggestingthat the lack of IRF-4 expression may exacerbate the develop-mental arrest caused by the membrane-bound self-antigen(Fig. 2A).

It has been demonstrated that in the presence of membrane-bound antigen, the majority of splenic IgHEL B cells weredeleted, with the exception of those that had replaced thetransgenic light chain with an endogenously rearranged lightchain, thereby losing the reactivity to HEL (12). Indeed, com-pared to the number in IgHEL IRF-4�/� mice, the total numberof B cells was dramatically reduced in the spleens of IgHEL

IRF-4�/� mHEL mice (Fig. 2B and Table 1). Consistent withthe results of previous reports, the majority of splenic B cells inIgHEL IRF-4�/� mHEL mice did not recognize HEL (Fig. 2B).However, the majority of the splenic B cells still expressedIgMa, indicating that the failure to bind to HEL is due to areplacement of transgenic light chain with an endogenous lightchain as a result of receptor editing. Strikingly, about 50% ofthe splenic B cells in IgHEL IRF-4�/� mHEL mice still recog-nized HEL, albeit with a low affinity (Fig. 2B). The editedsplenic B cells (IgMa� HEL�) in the IgHEL IRF-4�/� mHEL

mice were mature B cells expressing a high level of B220(B220hi), whereas the splenic B cells in IgHEL IRF-4�/� mHELmice were B220low, suggesting that, phenotypically, these cellswere still immature B cells. In addition, the total number ofsplenic B cells in IgHEL IRF-4�/� mHEL mice was approxi-mately one-third of that found in IgHEL IRF-4�/� mHEL mice(Table 1).

To determine if the edited B cells could be generated inolder IRF-4-deficient mice, splenic B cells in IgHEL IRF-4�/�

mice of 14 to 15 weeks of age were analyzed (Fig. 2C). Inter-estingly, in addition to the B220low HEL� population, we wereable to detect a population of B220hi HEL-edited B cells in theIgHEL IRF-4�/� mHEL mice. However, the edited populationwas present at approximately one-fifth of the number found inthe IgHEL IRF-4�/� mHEL control mice (Fig. 2C). Theseresults suggest that the edited B cells may be generated at aslower rate in the IRF-4-deficient background. We furtheranalyzed the expression of � light chain in the edited B cells.Our results show that about 8% of the splenic B cells in IgHEL

IRF-4�/� mHEL mice expressed � light chain, whereas thesplenic B cells in the IgHEL IRF-4�/� mHEL mice expressedalmost exclusively � light chain (Fig. 2C). Taken together,these results suggest that edited B cells are generated at a slowrate in IRF4-deficient mice.

Secondary rearrangement activity is defective in the IgHEL

IRF-4�/� mHEL mice. The slow generation of the edited Bcells in IgHEL IRF-4�/� mHEL mice could be a result ofimpaired receptor editing in the absence of IRF-4. To examinethis possibility, we decided to measure secondary rearrange-ment activity in B cells isolated from the bone marrow andspleens of IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL, and IgHEL

IRF-4�/� mHEL mice. Products of RS and � rearrangement inthe isolated bone marrow and splenic B cells were examined byPCR. We isolated DNA from mice at 8 weeks as well as 14weeks of age in order to determine the possible effect of age onreceptor editing. RS and �1 rearrangement could not be de-tected in DNA isolated from the bone marrow and spleens ofIgHEL IRF-4�/� mice at 8 weeks of age, indicating that sec-ondary rearrangement activity was very low in those mice (Fig.3). However, in the presence of membrane-bound antigen, RSand �1 rearrangement could be readily detected in B cellsisolated from the bone marrow and spleens of IgHEL IRF-4�/�

mHEL mice, indicating that the secondary rearrangement ac-tivity was significantly increased as a result of receptor editing.Compared to the results for IgHEL IRF4�/� mHEL mice, theproduct of RS rearrangement was diminished, whereas �1 re-arrangement could not be detected in the IgHEL IRF-4�/�

mHEL mice at 8 weeks of age, suggesting that the secondaryrearrangement activity was impaired in the IRF-4-deficientmice (Fig. 3). The secondary rearrangement activity remainedimpaired in IgHEL IRF-4�/� mHEL mice at 14 weeks of age.However, the differences in RS rearrangement between IgHEL

IRF-4�/� mHEL and IgHEL IRF-4�/� mHEL mice were lessdramatic than those seen in the younger mice, suggesting thatthe defect in secondary rearrangement, particularly RS dele-tion, could be partially compensated in the older IgHEL IRF-4�/� mHEL mice. In summary, our results show that second-ary rearrangement was impaired in the IgHEL IRF-4�/� mHELmice.

TABLE 1. B-cell populations in the bone marrow and spleena

Phenotype ofmice

No. of B cells (105) in:

Bone marrow Spleen

HEL� HEL� HEL� HEL�

IgHEL IRF-4�/� 13.2 4.2 8.3 2.6 125.7 13.5 8.8 1.0IgHEL IRF-4�/� 10.9 5.4 12.1 6.0 107.3 10.1 9.2 0.9IgHEL IRF-4�/� 15.5 6.5 10.1 4.2 71.9 19.8 12.4 3.4IgHEL IRF-4�/�

mHEL38.1 7.3 10.1 1.9 1.9 0.5 23.3 6.1

IgHEL IRF-4�/�

mHEL37.3 10.4 14.6 4.1 2.3 0.7 19.1 5.8

IgHEL IRF-4�/�

mHEL59.2 14.6 14.8 3.6 3.2 1.5 4.3 2.0

a The HEL� and HEL� B cells were counted separately. The numbers are themeans standard deviations of the results for a total of 6 mice in each group.

VOL. 28, 2008 IRF-4 PROMOTES SECONDARY REARRANGEMENT 2819

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

Impaired secondary rearrangement in IRF-4-deficient miceis not caused by defects in cell proliferation or apoptosis.V(D)J rearrangement activity is cell cycle dependent, and ittakes place at the G0/G1 stage of the cell cycle (6). Our recentstudies have demonstrated that IRF-4 induces the expressionof Ikaros and Aiolos to inhibit pre-B-cell expansion (22).Therefore, it is possible that in the absence of IRF-4, immatureB cells may exhibit a higher proliferation index which wouldindirectly inhibit secondary rearrangement activity. To deter-mine the cell cycle status of the cells, we measured the levels ofexpression of Ki-67, an intracellular protein found only incycling cells. The majority of the B220low IgMa� immature Bcells in the bone marrow of IgHEL IRF-4�/� and IgHEL IRF-4�/� mice stained negative for Ki-67, indicating that the ma-jority of these cells were quiescent (Fig. 4A). In contrast, ap-proximately 50% of the B220low IgMa� cells (pro-/pre-B) stillexpressed Ki-67, indicating that they were cycling. In the pres-ence of membrane-bound antigen, 7% of IgMa� B cells ex-pressed Ki-67 in both the IgHEL IRF-4�/� mHEL and IgHEL

IRF-4�/� mHEL mice, indicating that the defect in secondaryrearrangement in IgHEL IRF-4�/� mHEL mice was not due toan increased proliferation index.

An increase in apoptosis in IRF-4-deficient B cells can alsoindirectly affect secondary rearrangement and reduce the num-ber of the edited B cells in the IgHEL IRF-4�/� mHEL mice(19). To determine if there is a defect in apoptosis, a TUNELassay was conducted to measure the percentages of B cellsundergoing apoptosis (Fig. 4B). The HEL� and HEL-negative(HEL�) B cells were analyzed separately in the spleen. Thepercentage of TUNEL-positive B cells was higher in the IgHEL

IRF-4�/� mHEL and IgHEL IRF-4�/� mHEL mice than in theIgHEL IRF-4�/� and IgHEL IRF-4�/� mice, suggesting that Bcells may undergo apoptosis at an increased rate in the pres-ence of self-antigen (Fig. 4B). The results of the TUNELanalysis also reveal that in IgHEL IRF-4�/� mHEL and IgHEL

IRF-4�/� mHEL mice, similar percentages of immature Bcells undergoing receptor editing were apoptotic, indicating

that a lack of IRF-4 did not lead to significantly enhancedapoptosis in the antigen-activated immature B cells (Fig. 4B).Similarly, the percentage of apoptotic B cells was similar forthe edited splenic B cells (B220� HEL�) in IgHEL IRF-4�/�

mHEL and IgHEL IRF-4�/� mHEL mice. However, comparedto the results for IgHEL IRF4�/� mHEL mice, the percentageof apoptotic cells was moderately increased among the popu-lation of HEL� splenic B cells in the IgHEL IRF-4�/� mHELmice (P � 0.05).

An increase in B-cell apoptosis can lead to an increase in theB-cell turnover rate. To further examine the status of B-cellapoptosis, the turnover rate of B cells in the IRF-4-proficientand -deficient mice was examined after three days of labelingwith BrdU (Fig. 4C). Our results show that in the bone mar-row, the percentage of BrdU-labeled IgM� B cells was com-parable for IgHEL IRF-4�/� mHEL and IgHEL IRF-4�/�

mHEL mice. However, in the spleen, 38% of B cells in IgHEL

IRF-4�/� mHEL mice were labeled with BrdU compared to25% in IgHEL IRF-4�/� mHEL mice, indicating an enhancedB-cell turnover rate in the spleens of IgHEL IRF-4�/� mHELmice. Nevertheless, since B cells undergoing receptor editingin the bone marrow showed comparable turnover rates andexhibited similar levels of apoptosis in the IRF-4-proficientand -deficient backgrounds, apoptosis is not likely to have beena major contributor to the defective secondary rearrangementobserved in the IgHEL IRF-4�/� mHEL mice.

Expression of IRF-4 is rapidly induced when immature Bcells encounter self-antigen to promote secondary rearrange-ment at the � and the � loci. Our results show that secondaryrearrangement activity was defective in the IgHEL IRF-4�/�

mHEL mice. We sought to determine the molecular mecha-nism by which IRF-4 regulates secondary rearrangement. Tothis end, we isolated and compared the gene expression pro-files of bone marrow B cells undergoing receptor editing(B220low IgMa�) in the IgHEL IRF-4�/� mHEL and IgHEL

IRF-4�/� mHEL mice. It has been shown that immature Bcells undergoing receptor editing maintain the expression ofRag1 and Rag2. Indeed, compared to their levels in the im-mature B cells isolated from IgHEL IRF-4�/� mice, the expres-sion levels of Rag1 and Rag2 were significantly elevated in Bcells isolated from both IgHEL IRF-4�/� mHEL and IgHEL

IRF-4�/� mHEL mice (Fig. 5A). These results also indicatethat the defect in secondary rearrangement in the IgHEL IRF-4�/� mHEL mice was not due to deregulated Rag1 and Rag2expression.

The expression of light-chain germ line transcripts has beenassociated with the activation of the light-chain loci (36). Todetermine if there is a defect in the activation of light-chainloci in the absence of IRF-4, the expression levels of � and �1germ line transcripts were analyzed (Fig. 5A). Our results showthat � germ line transcript in B cells isolated from IgHEL

IRF-4�/� mHEL mice was expressed at a level that was ap-proximately twofold higher than the level in IgHEL IRF-4�/�

mHEL mice, whereas �1 germ line transcript expression wasapproximately fivefold higher than that in IgHEL IRF-4�/�

mHEL mice (Fig. 5A). These results suggest that there was adefect in the activation of light-chain loci in the IgHEL IRF-4�/� mHEL mice. We further measured the germ line tran-scripts of four major V� families: hf24, Gn33, 12-38, and 21-3.Consistent with the expression patterns of � and �1 germ line

FIG. 3. Secondary rearrangement activity was defective in theIgHEL IRF-4�/� mHEL mice. Cells were isolated from the bone mar-row and spleens of IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL, andIgHEL IRF-4�/� mHEL mice and were subjected to positive selectionto purify B220� B cells. Genomic DNA was extracted from the B220�

cells and analyzed by PCR to detect RS and �1 rearrangement. Miceof 8 or 14 weeks of age were used and analyzed separately. Templateswere serially diluted to allow semiquantitative analysis. A fragment ofthe CD19 gene was amplified and used as an internal loading refer-ence. The results shown are representative of three independent ex-periments.

2820 PATHAK ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

transcripts, three of the four V� germ line transcripts were alsoexpressed at significantly lower levels in the IRF-4-deficientmice (Fig. 5A). Taken together, our results indicate that therewas a defect in the activation of the light-chain loci in theIRF-4-deficient mice.

The levels of expression of IRF-4 and IRF-8 in isolatedimmature B cells were also examined (Fig. 5A). Our resultsshow that IRF-4 was expressed at a level that was about five-fold higher in the IgHEL IRF-4�/� mHEL mice than in theIgHEL IRF-4�/� mice, suggesting that the expression of IRF-4may be induced by antigen in the immature B cells. In contrast,the expression of IRF-8 was slightly decreased in immature Bcells isolated from the IgHEL IRF-4�/� mHEL and IgHEL IRF-4�/� mHEL mice (Fig. 5A).

In order to determine if the expression of IRF-4 is inducedby self-antigen at the immature B-cell stage, immature B cellswere isolated via sorting from the bone marrow of IgHEL IRF-4�/� mice and activated in vitro by treatment with HEL anti-

gen. Our results show that the expression of IRF-4 was rapidlyinduced in the presence of HEL antigen; the induction couldbe detected as early as 2 h after the addition of HEL (Fig. 5B).In contrast, the expression of IRF-8 was not induced by HEL.These results indicate that the expression of IRF-4 is rapidlyinduced by antigen in immature B cells.

We further sought to determine if reconstituting the expres-sion of IRF-4 in IgHEL IRF-4�/� immature B cells wouldpromote secondary rearrangement in the presence of self-an-tigen. To this end, B220� B cells were isolated from the bonemarrow of IgHEL IRF-4�/� mice and cultivated in the presenceof IL-7. Retroviral infection was performed to reconstituteIRF-4 expression. The infected cells were treated with HEL forfour days and isolated via sorting to extract genomic DNA.Compared to that in the control infected cells, secondary re-arrangement activity was dramatically increased in the pres-ence of IRF-4, as evidenced by elevated RS and �1 rearrange-ment (Fig. 5C). The results of Western blot analysis indicate

FIG. 4. Impairment of secondary rearrangement activity in IRF-4-deficient mice was not caused by defects in cell proliferation or apoptosis.(A) Cells were isolated from the bone marrow of IgHEL IRF-4�/�, IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL, and IgHEL IRF-4�/� mHEL mice,stained with antibodies against B220 and IgMa, fixed, and permeabilized in 70% ethanol. The permeabilized cells were stained with anti-Ki-67antibody and analyzed by FACS. IgM� and IgM� cells were gated separately, and the numbers represent percentages of TUNEL-positive B cells.(B) Cells were isolated from the bone marrow (B.M.) and spleens of IgHEL IRF-4�/�, IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL, and IgHEL

IRF-4�/� mHEL mice, stained with biotinylated HEL and anti-B220 antibody, fixed, and permeabilized. The percentages of TUNEL-positive cellswere determined by FACS. The numbers are the means and standard deviations of the results for a total of three mice in each group. The dataare representative of the results of three independent experiments. *, P value of �0.05 in comparison to the results for IgHEL IRF-4�/� mHELmice. (C) In vivo BrdU-labeling assay. Mice of 8 to 12 weeks of age were injected intraperitoneally with BrdU every 12 h for 3 days. Bone marrowand splenocytes were collected and stained with antibodies against B220, IgMa, and BrdU antibodies. Three mice were used for each time point.The percentages of BrdU-positive bone marrow (gated on IgMa� B cells) and splenic (gated on B220� cells) B cells were determined by FACSanalysis. The numbers are the averages and standard deviations of the results for each group. *, P value of �0.05 in comparison to the results forIgHEL IRF-4�/� mHEL mice.

VOL. 28, 2008 IRF-4 PROMOTES SECONDARY REARRANGEMENT 2821

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

that in the infected IgHEL IRF-4�/� immature B cells, IRF-4was expressed at a level that was comparable to that in theIgHEL IRF-4�/� immature B cells (Fig. 5D). Taken together,our results suggest that the expression of IRF-4 is induced byantigen in immature B cells to promote secondary rearrange-ment.

DISCUSSION

A series of recent studies have demonstrated critical func-tions for IRF-4 at several stages of B-cell development. It hasbeen shown that IRF-4 is an essential transcriptional regulatorfor pre-B-cell development, germinal center reaction, class-switch recombination, and plasma-cell differentiation (17, 21,22, 35, 38). The results of our studies presented here provideevidence that IRF-4 is also important for receptor editing atthe immature B-cell stage, suggesting that IRF-4 is critical forthe induction of B-cell tolerance. Our results show that sec-ondary rearrangement was defective in the IRF-4-deficientwild-type mice, as well as in the IgHEL transgenic mice, in thepresence of membrane-bound antigen. Our studies further re-veal that the impairment of secondary rearrangement in theIRF-4-deficient mice was the result of a defect in the activationof light-chain loci. The � and � germ line transcripts in theIgHEL IRF-4�/� mHEL mice were expressed at lower levels

than in the IgHEL IRF-4�/� mHEL mice, indicating a defect inthe activation of � and � loci in the absence of IRF-4. Ig � and� loci are sequentially activated during B-cell development: �rearrangement almost always occurs prior to � rearrangement(25, 32, 34). � rearrangement is induced by a self-reactive BCRand, thus, is often viewed as a product of receptor editing andsecondary rearrangement. Interestingly, in the absence ofIRF-4, the expression of � germ line transcript appeared to bemore adversely affected than that of the �, suggesting thatIRF-4 is more critical for the activation of the � locus. Con-sistent with this view, our results show that the defect in sec-ondary arrangement was more severe at the � locus than at the� locus in the IgHEL IRF-4�/� mHEL mice; edited splenic Bcells consisted of both �- and �-expressing cells in the IgHEL

IRF-4�/� mHEL mice but contained almost exclusively �-ex-pressing cells in the IRF-4-deficient background. Taken to-gether, our results suggest that the differential dependence onIRF-4 for their activation could be the molecular basis for thesequential activation of � and � loci in B-cell development.

Previously, we have shown that IRF-4 and IRF-8 functionredundantly to promote � locus activation in pre-B-cell devel-opment (23). However, the defects in RS and � rearrange-ments in IgHEL IRF-4�/� mHEL mice suggest that IRF-4, butnot IRF-8, played a dominant role in secondary rearrange-ment. Consistent with this view, we show that IRF-4 expres-

FIG. 5. IRF-4 expression in immature B cells is rapidly induced by self-antigen to promote secondary rearrangement at the � and � loci.(A) Bone marrow immature B cells (B220low ��) were isolated via sorting from IgHEL IRF-4�/�, IgHEL IRF-4�/� mHEL, and IgHEL IRF-4�/�

mHEL mice. Real-time PCR was performed to measure the expression of the indicated genes. kGL, � germ line transcript; l1GL, �1 germ linetranscript. *, P � 0.05; **, P � 0.01. P values are in comparison to the results for the IgHEL IRF-4�/� mHEL mice. (B) Immature B cells wereisolated via sorting from the bone marrow of IgHEL IRF-4�/� mice. The sorted cells were treated with HEL at 400 ng/ml and lysed at different timepoints for RNA extraction. The levels of expression of IRF-4 and IRF-8 were measured by real-time PCR. The numbers are the averages andstandard deviations of the results for each group. (C) B220� B cells were isolated from the bone marrow of IgHEL IRF-4�/� mice and expandedin culture in the presence of IL-7 (5 ng/ml). The cells were infected with retrovirus expressing either control or IRF-4. IL-7 was removed from themedium 36 h later, and the cells were incubated with HEL for three more days. The infected cells (green fluorescent protein positive) were isolatedvia sorting and were subjected to DNA extraction. PCR analysis was performed to measure RS and �1 rearrangement. The expression of CD19was used as a loading reference. (D) The expression of IRF-4 was measured by Western blot analysis in the infected cells and the cultured IgHEL

IRF-4�/� immature B cells. Actin was used as a loading control. Data are representative of the results of three independent experiments.

2822 PATHAK ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

sion, but not IRF-8 expression, is induced in immature B cellsundergoing receptor editing in vivo. Moreover, the expressionof IRF-4, but not IRF-8, is rapidly induced when immature Bcells encounter self-antigen. However, our finding that second-ary rearrangement, though impaired, could still be detected inthe IgHEL IRF-4�/� mHEL mice also indicates that B cells arestill able to revise the antigen receptor in the absence of IRF-4.Furthermore, our results show that the defects in secondaryrearrangement, particularly RS rearrangement, could be par-tially compensated in the older IgHEL IRF-4�/� mHEL mice.One possible explanation for these observations is that second-ary rearrangement is less efficient in the absence of IRF-4, and,thus, may require a longer time for successful rearrangementof the endogenous light-chain gene. Consistent with this idea,our results show that, compared to that in IgHEL IRF-4�/�

mHEL mice, the population of B cells undergoing editing wassignificantly enlarged in the bone marrow of IgHEL IRF-4�/�

mHEL mice. Collectively, our results support a scenario inwhich IRF-8 may play a role in maintaining the basal activity ofthe light-chain loci, particularly at the � locus, whereas theelevated expression of IRF-4 in the presence of self-antigenleads to further activation of the � and the � loci, therebypromoting efficient secondary rearrangement. Our finding thatreconstituting IRF-4 expression in the IRF-4-deficient imma-ture B cells promotes secondary rearrangement is also consis-tent with this view.

Receptor editing can be influenced by changes in cell sur-vival and apoptosis status. It has been shown that enhancedsurvival prolongs the life span of immature B cells, therebypromoting receptor editing, whereas reduced cell survival mayindirectly inhibit receptor editing (19). Thus, reduced survivalof the immature B cells in the absence of IRF-4 would besufficient to suppress secondary rearrangement. However, ourresults do not reveal a significant difference in B-cell apoptosisin the bone marrow of IRF-4-proficient and -deficient mice, asthe percentages of TUNEL-positive immature B cells, as wellas the turnover rate of the immature B cells, were similar inIRF-4-proficient and -deficient mice. In addition, our findingthat IgHEL IRF-4�/� mHEL mice had a much larger immatureB-cell pool than IgHEL IRF-4�/� mHEL mice also does notsupport the notion that immature B cells undergo elevatedapoptosis in the IRF-4-deficient mice. However, our findingsdo reveal that the splenic B cells in the IgHEL IRF-4�/� mHELmice underwent elevated apoptosis compared to that of theircounterparts in the IgHEL IRF-4�/� mHEL mice. Since signif-icant numbers of splenic B cells still recognized HEL in IgHEL

IRF-4�/� mHEL mice, the increased numbers of the apoptoticsplenic B cells could be a result of enhanced deletion due toinefficient receptor editing in the IRF-4-deficient mice. An-other possible explanation for these data could be that IRF-4,though not essential for the survival of immature B cells, maybe an important survival factor for the peripheral B cells.Therefore, it is possible that inefficient receptor editing and theenhanced apoptosis may both have contributed to the slowgeneration of the edited splenic B cells in the IgHEL IRF-4�/�

mHEL mice.BCR signaling triggered by self-antigen at the immature

B-cell stage not only induces the expression of Rag1 and Rag2but could also lead to further activation of the light-chain locito promote efficient secondary rearrangement (31). It has been

demonstrated that the BCR-induced expression of Rag1 andRag2 at the immature B-cell stage is dependent on transcrip-tion factor NF-�B (42). The NF-�B family of transcriptionfactors has also been implicated in the demethylation of thelight-chain � locus and, thus, may play a role in � locus acti-vation (15). Previous studies have demonstrated that transcrip-tion factor E2A is critical for light-chain rearrangement at thepre-B stage and for receptor editing at the immature B-cellstage (16, 33). It has also been demonstrated that IRF-4 canrecruit E2A to the Ig � 3� enhancer in pre-B cells (20, 27).Therefore, it is possible that elevated IRF-4 in the immature Bcells can interact with and recruit E2A to the Ig � locus topromote receptor editing. In contrast, the activation of the Ig� locus by IRF-4 is most likely mediated by interaction with theEts family transcription factors PU.1 and Spi-B (3, 4); it hasbeen shown that �, but not �, transcription is severely impairedin the PU.1 and Spi-B double-deficient pre-B cells, indicatingthat the interaction between IRF-4 and PU.1/Spi-B is criticalfor �, but not �, locus activation (37). The expression of IRF-4is induced at the pre-B stage to promote light-chain rearrange-ment and transcription (23, 26). Although the results of ourstudies favor the scenario where elevated IRF-4 in the auto-reactive immature B cells promotes/maintains the activation oflight-chain loci for efficient receptor editing, we cannot rule outthe possibility that the defective activation of light-chain loci inthe IRF-4-deficient autoreactive immature B cells is partiallycaused by the lack of IRF4 at the pre-B stage of their devel-opment.

Receptor editing is initiated when immature B cells encoun-ter self-antigen. The importance of BCR signaling in receptorediting has been illustrated by findings that mutations of thecomponents of the BCR signaling pathway lead to defects insecondary rearrangement (2, 13). The results of our studiespresented here identify IRF-4 as a potential nuclear effector ofa BCR-initiated signaling pathway that promotes secondaryrearrangement at the immature B-cell stage.

ACKNOWLEDGMENTS

This work was supported by grant AI 67891 (R.L.) from the NationalInstitutes of Health and Cancer Center grant P30CA036727.

We thank Karen Gould for critical reading of the manuscript andthe UNMC flow cytometry core facility for help with cell analysis andcell sorting.

REFERENCES

1. Allman, D., R. C. Lindsley, W. DeMuth, K. Rudd, S. A. Shinton, and R. R.Hardy. 2001. Resolution of three nonproliferative immature splenic B cellsubsets reveals multiple selection points during peripheral B cell maturation.J. Immunol. 167:6834–6840.

2. Bai, L., Y. Chen, Y. He, X. Dai, X. Lin, R. Wen, and D. Wang. 2007.Phospholipase C�2 contributes to light-chain gene activation and receptorediting. Mol. Cell. Biol. 27:5957–5967.

3. Brass, A. L., E. Kehrli, C. F. Eisenbeis, U. Storb, and H. Singh. 1996. Pip, alymphoid-restricted IRF, contains a regulatory domain that is important forautoinhibition and ternary complex formation with the Ets factor PU.1.Genes Dev. 10:2335–2347.

4. Brass, A. L., A. Q. Zhu, and H. Singh. 1999. Assembly requirements ofPU.1-Pip (IRF-4) activator complexes: inhibiting function in vivo using fuseddimers. EMBO J. 18:977–991.

5. Cornall, R. J., A. M. Cheng, T. Pawson, and C. C. Goodnow. 2000. Role ofSyk in B-cell development and antigen-receptor signaling. Proc. Natl. Acad.Sci. USA 97:1713–1718.

6. Desiderio, S., W. C. Lin, and Z. Li. 1996. The cell cycle and V(D)J. recom-bination. Curr. Top. Microbiol. Immunol. 217:45–59.

7. Durdik, J., M. W. Moore, and E. Selsing. 1984. Novel kappa light-chain generearrangements in mouse lambda light chain-producing B lymphocytes. Na-ture 307:749–752.

VOL. 28, 2008 IRF-4 PROMOTES SECONDARY REARRANGEMENT 2823

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.

8. Fitzsimmons, S. P., R. M. Bernstein, E. E. Max, J. A. Skok, and M. A.Shapiro. 2007. Dynamic changes in accessibility, nuclear positioning, recom-bination, and transcription at the Ig� locus. J. Immunol. 179:5264–5273.

9. Gay, D., T. Saunders, S. Camper, and M. Weigert. 1993. Receptor editing: anapproach by autoreactive B cells to escape tolerance. J. Exp. Med. 177:999–1008.

10. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A.Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, K. Raphael,et al. 1988. Altered immunoglobulin expression and functional silencing ofself-reactive B lymphocytes in transgenic mice. Nature 334:676–682.

11. Halverson, R., R. M. Torres, and R. Pelanda. 2004. Receptor editing is themain mechanism of B cell tolerance toward membrane antigens. Nat. Im-munol. 5:645–650.

12. Hartley, S. B., J. Crosbie, R. Brink, A. B. Kantor, A. Basten, and C. C.Goodnow. 1991. Elimination from peripheral lymphoid tissues of self-reac-tive B lymphocytes recognizing membrane-bound antigens. Nature 353:765–769.

13. Hayashi, K., T. Nojima, R. Goitsuka, and D. Kitamura. 2004. Impairedreceptor editing in the primary B cell repertoire of BASH-deficient mice.J. Immunol. 173:5980–5988.

14. Hippen, K. L., B. R. Schram, L. E. Tze, K. A. Pape, M. K. Jenkins, and T. W.Behrens. 2005. In vivo assessment of the relative contributions of deletion,anergy, and editing to B cell self-tolerance. J. Immunol. 175:909–916.

15. Inlay, M., and Y. Xu. 2003. Epigenetic regulation of antigen receptor rear-rangement. Clin. Immunol. 109:29–36.

16. Inlay, M. A., H. Tian, T. Lin, and Y. Xu. 2004. Important roles for E proteinbinding sites within the immunoglobulin kappa chain intronic enhancer inactivating Vkappa Jkappa rearrangement. J. Exp. Med. 200:1205–1211.

17. Klein, U., S. Casola, G. Cattoretti, Q. Shen, M. Lia, T. Mo, T. Ludwig, K.Rajewsky, and R. Dalla-Favera. 2006. Transcription factor IRF4 controlsplasma cell differentiation and class-switch recombination. Nat. Immunol.7:773–782.

18. Kouskoff, V., G. Lacaud, K. Pape, M. Retter, and D. Nemazee. 2000. B cellreceptor expression level determines the fate of developing B lymphocytes:receptor editing versus selection. Proc. Natl. Acad. Sci. USA 97:7435–7439.

19. Lang, J., B. Arnold, G. Hammerling, A. W. Harris, S. Korsmeyer, D. Russell,A. Strasser, and D. Nemazee. 1997. Enforced Bcl-2 expression inhibits an-tigen-mediated clonal elimination of peripheral B cells in an antigen dose-dependent manner and promotes receptor editing in autoreactive, immatureB cells. J. Exp. Med. 186:1513–1522.

20. Lazorchak, A. S., M. S. Schlissel, and Y. Zhuang. 2006. E2A and IRF-4/Pippromote chromatin modification and transcription of the immunoglobulin �locus in pre-B cells. Mol. Cell. Biol. 26:810–821.

21. Lu, R., K. L. Medina, D. W. Lancki, and H. Singh. 2003. IRF-4,8 orchestratethe pre-B-to-B transition in lymphocyte development. Genes Dev. 17:1703–1708.

22. Ma, S., S. Pathak, L. Trinh, and R. Lu. 2008. Interferon regulatory factors4 and 8 induce the expression of Ikaros and Aiolos to downregulate pre-B-cell receptor and promote cell-cycle withdrawal in pre-B-cell development.Blood 111:1396–1403.

23. Ma, S., A. Turetsky, L. Trinh, and R. Lu. 2006. IFN regulatory factor 4 and8 promote Ig light chain kappa locus activation in pre-B cell development.J. Immunol. 177:7898–7904.

24. Mittrucker, H. W., T. Matsuyama, A. Grossman, T. M. Kundig, J. Potter, A.Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi, and T. W. Mak. 1997.

Requirement for the transcription factor LSIRF/IRF4 for mature B and Tlymphocyte function. Science 275:540–543.

25. Moore, M. W., J. Durdik, D. M. Persiani, and E. Selsing. 1985. Deletions ofkappa chain constant region genes in mouse lambda chain-producing B cellsinvolve intrachromosomal DNA recombinations similar to V-J. joining. Proc.Natl. Acad. Sci. USA 82:6211–6215.

26. Muljo, S. A., and M. S. Schlissel. 2003. A small molecule Abl kinase inhibitorinduces differentiation of Abelson virus-transformed pre-B cell lines. Nat.Immunol. 4:31–37.

27. Nagulapalli, S., and M. L. Atchison. 1998. Transcription factor Pip canenhance DNA binding by E47, leading to transcriptional synergy involvingmultiple protein domains. Mol. Cell. Biol. 18:4639–4650.

28. Nagulapalli, S., A. Goheer, L. Pitt, L. P. McIntosh, and M. L. Atchison. 2002.Mechanism of E47-Pip interaction on DNA resulting in transcriptional syn-ergy and activation of immunoglobulin germ line sterile transcripts. Mol.Cell. Biol. 22:7337–7350.

29. Nemazee, D. 2006. Receptor editing in lymphocyte development and centraltolerance. Nat. Rev. Immunol. 6:728–740.

30. Nemazee, D. A., and K. Burki. 1989. Clonal deletion of B lymphocytes in atransgenic mouse bearing anti-MHC class I antibody genes. Nature 337:562–566.

31. Pelanda, R., and R. M. Torres. 2006. Receptor editing for better or forworse. Curr. Opin. Immunol. 18:184–190.

32. Persiani, D. M., J. Durdik, and E. Selsing. 1987. Active lambda and kappaantibody gene rearrangement in Abelson murine leukemia virus-trans-formed pre-B cell lines. J. Exp. Med. 165:1655–1674.

33. Quong, M. W., A. Martensson, A. W. Langerak, R. R. Rivera, D. Nemazee,and C. Murre. 2004. Receptor editing and marginal zone B cell developmentare regulated by the helix-loop-helix protein, E2A. J. Exp. Med. 199:1101–1112.

34. Retter, M. W., and D. Nemazee. 1998. Receptor editing occurs frequentlyduring normal B cell development. J. Exp. Med. 188:1231–1238.

35. Saito, M., J. Gao, K. Basso, Y. Kitagawa, P. M. Smith, G. Bhagat, A. Pernis,L. Pasqualucci, and R. Dalla-Favera. 2007. A signaling pathway mediatingdownregulation of BCL6 in germinal center B cells is blocked by BCL6 genealterations in B cell lymphoma. Cancer Cell 12:280–292.

36. Schlissel, M. S., and D. Baltimore. 1989. Activation of immunoglobulinkappa gene rearrangement correlates with induction of germline kappa genetranscription. Cell 58:1001–1007.

37. Schweitzer, B. L., and R. P. DeKoter. 2004. Analysis of gene expression andIg transcription in PU.1/Spi-B-deficient progenitor B cell lines. J. Immunol.172:144–154.

38. Sciammas, R., A. L. Shaffer, J. H. Schatz, H. Zhao, L. M. Staudt, and H.Singh. 2006. Graded expression of interferon regulatory factor-4 coordinatesisotype switching with plasma cell differentiation. Immunity 25:225–236.

39. Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. IRF familyof transcription factors as regulators of host defense. Annu. Rev. Immunol.19:623–655.

40. Tiegs, S. L., D. M. Russell, and D. Nemazee. 1993. Receptor editing inself-reactive bone marrow B cells. J. Exp. Med. 177:1009–1020.

41. Vela, J. L., and D. Nemazee. 2007. Role of RS/kappaDE in B cell receptorediting. Adv. Exp. Med. Biol. 596:169–172.

42. Verkoczy, L., D. Ait-Azzouzene, P. Skog, A. Martensson, J. Lang, B. Duong,and D. Nemazee. 2005. A role for nuclear factor kappa B/rel transcriptionfactors in the regulation of the recombinase activator genes. Immunity 22:519–531.

2824 PATHAK ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 19

Nov

embe

r 20

21 b

y 59

.9.5

2.21

2.