A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray...

37
A robust and sensitive microarray system microarray system for profiling of miRNAs Life Sciences - Genomics Stephanie Fulmer-Smentek RNA Applications R&D RNA Applications R&D Group Manager Agilent miRNA profiling solution August 28, 2007

Transcript of A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray...

Page 1: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

A robust and sensitive microarray systemmicroarray system

for profiling of miRNAs

Life Sciences - Genomics

Stephanie Fulmer-Smentek

RNA Applications R&DRNA Applications R&DGroup Manager

Agilent miRNA profiling solution

August 28, 2007

Page 2: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Overview

microRNA biology

Agilent miRNA platform

S P i t t h l- SurePrint technology- miRNA protocol workflow- Probe and Array Design- Data Extraction and Quality Control

Performance Data

- Dynamic Range & sensitivity- Dynamic Range & sensitivity- Specificity- Data linearity

R d ibilit- Reproducibility- Comparison to qRT-PCR

Agilent miRNA products

Agilent miRNA profiling solution

August 28, 2007

Page 3: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

miRNA Biology

Agilent miRNA profiling solution

August 28, 2007

Page 4: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

microRNAs (miRNA)Long precursor (pri-miRNA)

Proteins• Key regulators of cell development

• ~22nts single-stranded RNAs

Hairpin miRNA precursorpre-miRNA (~70nts)

Proteins

• Regulate mRNA translation

• Found in animals, plants, & viruses ( total > 5000)

• >700 identified in humans (Sanger miRBase 10 0)

Mature miRNA(~22nts, single-stranded)

Proteins

• >700 identified in humans (Sanger miRBase 10.0)

• May regulate >30% of human genes

• Tissue-specific expression patterns

Combinatorial Regulation

Proteins

• Different cancers have distinct miRNA expressions

• Diagnostic and prognostic potential being explored

Translation inhibitionProteins

Agilent miRNA profiling solution

August 28, 2007

No Protein Production Figures not drawn to scale

Page 5: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

S ll i

Challenges in miRNA Profiling• Small size

• High sequence homology

• Presence of larger RNAs with highly homologous sequences• Presence of larger RNAs with highly homologous sequences

• Expressed with large dynamic range

• Growing & changing databaseGrowing & changing database

miRNA Sequence #NThsa-let-7a ugagguaguagguuguauaguu 22hsa-let-7a ugagguaguagguuguauaguu 22hsa-let-7b ugagguaguagguugugugguu 22hsa-let-7c ugagguaguagguuguaugguu 22hsa-let-7d agagguaguagguugcauagu 21

21

hsa-let-7b ugagguaguagguugugugguu 22hsa-let-7c ugagguaguagguuguaugguu 22hsa-let-7d agagguaguagguugcauaguu 22

hsa-let-7e ugagguaggagguuguauagu 21hsa-let-7f ugagguaguagauuguauaguu 22hsa-let-7g ugagguaguaguuuguacagu 21h l t 7i 21

Sanger miRBase 10.0

hsa-let-7e ugagguaggagguuguauaguu 22hsa-let-7f ugagguaguagauuguauaguu 22hsa-let-7g ugagguaguaguuuguacaguu 22

Agilent miRNA profiling solution

August 28, 2007

hsa-let-7i ugagguaguaguuugugcugu 21 miRBase 10.0hsa-let-7i ugagguaguaguuugugcuguu 22

Page 6: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Agilent’s miRNA platformplatform

Agilent miRNA profiling solution

August 28, 2007

Page 7: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Agilent miRNA Platform HighlightsLow sample input 100 ngLow sample input - 100 ng

Total RNA used for labeling – NO small RNA isolation requiredq

Efficient, direct labeling method linked to specialized miRNA probe design methods

Simple protocol – results in < 2 days

High sequence and size specificity

Multiplex format – 8 arrays per slide

Multiple probe sequences and probe replicates per miRNA

One-color analysis

Enabled by Agilent SurePrint inkjet technology

Agilent miRNA profiling solution

August 28, 2007

y g j gy

Page 8: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Agilent SurePrint Inkjet Printing

Benefits:

• Features are physically isolated from each other -- NO issue of light leakingother NO issue of light leaking

• Synthesis efficiency greater than 99.5% for 60-mer oligonucleotides: increased signal-to-noise because probe fidelity is critical for o se because p obe de y s c ca obinding interactions

• Our feature size and printing technology allow us to have perfect registration from layer to p g ylayer (no blurry edges)

• Our feature size allows us to get sufficient pixels per feature after scanning to perform

Back toPerformance

Back toBenchmarks

p p g ppixel level statistics that can eliminate outlier pixel populations and help estimate confidence in the measurement

Agilent miRNA profiling solution

August 28, 2007

Page 9: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

miRNA Protocol workflowTotal RNA (100ng)Total RNA (100ng)

Dephosphorylated RNA

Phosphatase treatment, 30 min, 37ºC

* OHOH

OHP

CyAdd DMSO

Heat, iceAssemble labeling reaction, 16ºC 2hr

OH

CCy

P P

Cy

Time to results <2 days with

Labeled RNA

Desalt with spin column

Desalted Labeled RNA

* OHCP P

yyminimal

hands-on time

Assemble hybridization mixture

Heat ice

* Speed vac, ~1hr, 45ºC

* Sample can be t d f t 80oC

Heat, ice

Hybridize 20 hours, 55ºC, 20RPM

Wash, scan

Agilent miRNA profiling solution

August 28, 2007

miRNA Profile stored frozen at -80oC, if necessary

Page 10: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Probe Design Strategy

Utilize the Cincorporated during labeling for additional G-C base

Start design with full-length miRNA-probe sequence, additional G C base

pair on 3’end of miRNA to increase stability

p q ,attached to a stilt sequence.

Sequentially shorten target-probe base pairing from 5’ end

Incorporate hairpin structure on probes to increase sizeof miRNA during

preliminary Tm balancing by calculation.

increase size specificity and probe:target stability.

Final Step: Select Tm-balanced probes for each miRNA empirically using microarray data

Agilent miRNA profiling solution

August 28, 2007

Select Tm balanced probes for each miRNA empirically using microarray data.

Page 11: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Array DesignH iRNA Mi 1 0Human miRNA Microarray, v1.0:

Content from Sanger miRBase release 9.1

Probes for 470 human and 64 human viral miRNAs

Each miRNA has ≥ 2 different probe sequences, each replicated multiple times on the microarray: at least 20 features/miRNA

Eight identical, separately hybridizable, arrays per slide

Where possible*, probes have been empirically Tm balanced.

Multiple probe sequences and replicates allow for robust miRNA level data summarization

Agilent miRNA profiling solution

August 28, 2007

* When miRNA has been present in tested samples

Page 12: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Human miRNA microarray

Agilent miRNA profiling solution

August 28, 2007

Page 13: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Scanning and Data Extraction -XDRA t t d Xt d d D i R S iAutomated eXtended Dynamic Range Scanning

Automatically scans twice, with high sensitivityand low sensitivity

High Low

Feature Extraction

Automatically combines 2 scan dataand generates each array’s QC reportand text output

Extraction 9.5.3

Agilent miRNA profiling solution

August 28, 2007

8 sets of text outputs and QC Reports

Page 14: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Regular Data txt

Feature Extraction Data Processing – 2 text files

Background SubtractionFeature FindingCookie Cutter

Pixel Rejection Outlier flagging

Regular Data .txt File

inte

nsity

abundance

gNumPix gBGNumPix gMeanSig gBGMeanSiggMedianSig gBGMedianSiggPixSDev gBGPixSDev

gIsSaturatedgIsFeatNonUnifOL gIsBGNonUnifOL gIsFeatPopnOL gIsBGPopnOL

gBGSubSignal

l

gPixSDev gBGPixSDev

GeneView Data .txt File: Total Gene

Signal Calculation

File:simplified format5 columns

l lAgilent miRNA profiling solution

August 28, 2007

gene level summary

Page 15: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Calculation of miRNA TotalGeneSignal in Feature ExtractionExtraction•Multiple probe sequences/miRNA•Multiple replicates/probe sequence

Step 1 –Reject Outlier FeaturesStep 2 –Average non-outlier feature

Probe AProbe B

replicates/probe sequence

X OutlierStep 3 –Multiply that average by the total # pixels representing that

d l i l b “ i h ”Step 4 – Sum TotalProbeSignals for all probes for each miRNA

sequence and multiply by “weight”

+ + + + + + + + )( / 9[ ] *10*(#pixels/feature)*W=TotalProbeSignal (Probe A)

*10*(#pixels/feature)*W=TotalProbeSignal (Probe B)+ + + + + + + )( / 8[ ]

TotalProbeSignal (Probe A)+TotalProbeSignal (Probe B)=TotalGeneSignalNote: The “weight” factor scales the total signals back to a similar scale as intensity

Agilent miRNA profiling solution

August 28, 2007

Note: The weight factor scales the total signals back to a similar scale as intensity values, to better fit with downstream analysis

Page 16: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Metrics and tools for assessment of miRNA profiling data qualityprofiling data quality

2 methods for in-process quality control of miRNA microarray experiments:

• QC report generated with each microarray run• QC metric chart, plots key miRNA specific metrics across

all microarrays in a given Feature Extraction run

QC metrics can be customized by the user using the free QC metric toolthe free QC metric tool

Agilent miRNA profiling solution

August 28, 2007

Page 17: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Sample Microarray QC Report

Header

Net Signal Statistics

Grid Placement

Outlier Statistics

Histogram of BackgroundBackground Subtracted

Signal Outlier

Distribution

Agilent miRNA profiling solution

August 28, 2007

Page 18: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Signal Spatial Distribution

Intra-array Reproducibility

miRNA specific QC

Metrics

Agilent miRNA profiling solution

August 28, 2007

Page 19: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

QC Run Chart

miRNA specific pmetrics presented

for an entire feature extraction run

Agilent miRNA profiling solution

August 28, 2007

extraction run

Page 20: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Performance Data

Agilent miRNA profiling solution

August 28, 2007

Page 21: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

1000000

Linear Dynamic Range of miRNA measurements

100000

1000000

67 Equal-molar synthetic miRNAs were labeled and hybridized at 0 01 amol to

10000

igna

l

hybridized at 0.01 amol to 1 fmol /miRNA per microarray.

1000

Tota

lGen

eS

10

100T

11 10 100 1000 10000 100000 1000000

1 fmol = 1000 amol1 amol = 1000 zmol

Agilent miRNA profiling solution

August 28, 2007

RNA Amount (zmol)

Page 22: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Before Empirical Tm-balancing: (Wang, Ach, & Curry, RNA, 13, 1-9)

Specificity of hybridizationp g

40hrHyb

miRNA miRNA miRNA miRNA miRNA miRNA miRNA miRNA7a 7b 7c 7d 7e 7f 7g 7i

Probes 7a 100 10 51 3 1 5 2 0Probes 7b 0 100 1 0 0 0 7 0Probes 7c 6 70 100 1 0 0 3 0Hyb Probes 7c 6 70 100 1 0 0 3 0Probes 7d 1 2 1 100 39 0 3 0Probes 7e 4 1 1 2 100 0 1 0Probes 7f 62 3 5 1 0 100 1 0Probes 7g 1 0 0 0 0 0 100 1

After Empirical Tm-balancing: (unpublished)

Probes 7i 0 1 0 0 0 0 4 100

40hr

miRNA miRNA miRNA miRNA miRNA miRNA miRNA miRNA7a 7b 7c 7d 7e 7f 7g 7i

Probes 7a 100 2 32 0 0 0 0 0Probes 7b 0 100 3 0 0 0 0 0Probes 7c 0 21 100 0 0 0 0 0

HybProbes 7c 0 21 100 0 0 0 0 0Probes 7d 2 0 1 100 0 0 0 0Probes 7e 2 0 0 0 100 0 0 0Probes 7f 30 0 4 0 0 100 0 0Probes 7g 0 0 0 0 0 0 100 1Probes 7i 0 0 0 0 0 0 0 100

Agilent miRNA profiling solution

August 28, 2007

Probes 7i 0 0 0 0 0 0 0 100

Page 23: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

E i i ll T b l d P b

Effect of Hybridization Time on SpecificityEmpirically Tm-balanced Probes: (unpublished)

miRNA miRNA miRNA miRNA miRNA miRNA miRNA miRNA7a 7b 7c 7d 7e 7f 7g 7i

Probes 7a 100 2 32 0 0 0 0 0

40hrHyb

Probes 7b 0 100 3 0 0 0 0 0Probes 7c 0 21 100 0 0 0 0 0Probes 7d 2 0 1 100 0 0 0 0Probes 7e 2 0 0 0 100 0 0 0Probes 7f 30 0 4 0 0 100 0 0Probes 7f 30 0 4 0 0 100 0 0Probes 7g 0 0 0 0 0 0 100 1Probes 7i 0 0 0 0 0 0 0 100

miRNA miRNA miRNA miRNA miRNA miRNA miRNA miRNA7a 7b 7c 7d 7e 7f 7g 7i

20hrHyb

7a 7b 7c 7d 7e 7f 7g 7iProbes 7a 100 4 39 0 0 1 0 0Probes 7b 0 100 5 0 0 0 0 0Probes 7c 1 30 100 0 0 0 0 0Probes 7d 2 0 1 100 0 0 0 0Probes 7e 2 0 0 0 100 0 0 0y Probes 7e 2 0 0 0 100 0 0 0Probes 7f 37 1 6 0 0 100 0 0Probes 7g 0 0 0 0 0 0 100 1Probes 7i 0 0 0 0 0 0 0 100

Agilent miRNA profiling solution

August 28, 2007

Page 24: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Complex sample titration study

Brain and Placenta total RNA samples, pure and in two different mixtures (25:75 and 75:25)( )

Each sample was processed in 4 replicates using standard conditions, by 4 different users

TotalGeneSignals for the miRNAs were loaded into GeneSpring GX for analysis

No “per-chip” normalization was applied

Signal response as a function of %Brain sample was g p panalyzed for selected miRNAs.

Agilent miRNA profiling solution

August 28, 2007

Page 25: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Selection of genes for titration test

Select miRNA’s significantly different (P<0.01) between 100% Brain and 75%Brain:25% Placenta (no fold change cut-off)Placenta (no fold change cut off)

Agilent miRNA profiling solution

August 28, 2007

Page 26: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Linearity of Signal Response

Up-regulated in Brain

Down-regulated in Brain

Agilent miRNA profiling solution

August 28, 2007

Page 27: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Confirmation of small fold changes across the titration range hsa-mir-9*; FC=0 88 fortitration range hsa-mir-9 ; FC=0.88 for

75%Brain/100% Brainai

n)m

ple/

Bra

ted

sam

o (s

elec

Rat

io

Agilent miRNA profiling solution

August 28, 2007

Page 28: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Reproducibility- Intra-user

Intra-slide

Inter slideAgilent miRNA profiling solution

August 28, 2007

Inter-slide

Page 29: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Reproducibility- Inter-user

Agilent miRNA profiling solution

August 28, 2007

Page 30: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Comparison of miRNA Microarray Results to qRT-PCR

y = 37 109 – 0 942xne S

igna

l) miR-34a

12

qRT PCR

12

gnal

) miR-15a

y = 37.109 0.942xR = -0.987

n To

tal G

en

11

12

11

al G

ene

Sig

(log 2

(Mea

n9

10

38 152 1 02910

(Mea

n To

ta

qPCR (Mean Ct)

Arr

ay

26 27 28 29 30

9

y = 38.152 – 1.029xR = -0.988

26 27 289

Arr

ay (l

og2( qPCR (Mean Ct)

Tissues = Placenta, Brain, Breast, Liver, Heart, Testes, Ovary,

Agilent miRNA profiling solution

August 28, 2007

26 27 28qPCR (Mean Ct)A Thymus, Skeletal Muscle

Page 31: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Comparison of miRNA Microarray Results to qRT-PCR, cont. h i 296)qRT PCR, cont. hsa-mir-296

ene

Sign

al)

Sign

al) hsa-mir-1557

y = 18.078 – 0.388xR = -0.381

an T

otal

Ge

10

otal

Gen

e S

6

y (lo

g 2(M

ea8

34 359 0 937g 2(M

ean

To 5

30 32 34A

rray

qPCR (Mean Ct)6 y = 34.359 – 0.937x

R = -0.985

Arr

ay (l

og

26 28 30

Tissues = Placenta, Brain, Breast, Liver, Heart, Testes, Ovary, Thymus, Skeletal Muscle

Agilent miRNA profiling solution

August 28, 2007

26 28 30qPCR (Mean Ct)

Thymus, Skeletal Muscle

Page 32: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Microarray Correlation to qRT-PCR for 38 miRNA testedtested

16

18

12

14

8

10

*Three miRNAs had poor correlations:

4

6

*

Three miRNAs had poor correlations:• hsa-miR-494: sequence change from

Sanger 9.1 to 10.0• hsa-miR-631: Low signals for both methods

0

2

-1 99 98 97 96 95 94 93 92 91 0 9 re

• hsa-mir-296: (now hsa-miR-296-5p), next slide

Agilent miRNA profiling solution

August 28, 2007

-1-0.

99-0.

98-0.

97-0.

96-0.

95-0.

94-0.

93-0.

92-0.

91 -0.9

More

Page 33: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Titration of hsa-miRNA-296 suggests consistent probe performance

100000

1000000probe performance

67 Equal-molar synthetic miRNAs were labeled and hybridized at 0 01 amol to

10000

100000

gnal

hybridized at 0.01 amol to 1 fmol /miRNA per microarray.

1000

talG

eneS

ig

10

100Tot

1

10

1 10 100 1000 10000 100000 1000000

1 fmol = 1000 amol1 amol = 1000 zmol

Agilent miRNA profiling solution

August 28, 2007

1 10 100 1000 10000 100000 1000000RNA Amount (zmol)

Page 34: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Differential Expression Comparison between miRNA microarrays and qRT-PCR

Placenta/Testes Skeletal Muscle/Breast

tes)

)

ast))

miRNA microarrays and qRT PCR

0

4

0

2

acen

ta/T

es

2(Sk

M/B

rea

-4 -2

s (L

og2(

Pla

rray

s (L

og2

Y = 0.100 – 0.934xY = 0.380 – 0.845x

qPCR (Mean deltaCt, Placenta-Testes) qPCR (Mean deltaCt, SkM-Breast)-4 0 4 8

-82 40-2

-4Arr

ays

Ar Y 0.100 0.934x

R = -0.944R = -0.979

• Log2 expression ratios of the 38 miRNAs in two different tissue pairs were determined for both qPCR and array measurements.

• Results are shown here are for placenta/testes and skeletal muscle/breast ratios

Agilent miRNA profiling solution

August 28, 2007

• Results are shown here are for placenta/testes and skeletal muscle/breast ratios.

Page 35: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

Summary of performance data

Five orders of magnitude of linear dynamic range

Detection of miRNAs in amounts as low as 10 zmol ( 6000Detection of miRNAs in amounts as low as 10 zmol (~6000 molecules)

Highly specific hybridization with low levels of cross-Highly specific hybridization with low levels of cross-hybridization with as few as one mismatch

Accurate and consistent detection of small fold changesAccurate and consistent detection of small fold changes

Reproducible data across multiple users

Good correlation with RT PCRGood correlation with RT-PCR

Agilent miRNA profiling solution

August 28, 2007

Page 36: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

miRNA products from Agilent TechnologiesMicroarray Platform:Microarray Platform:

-Human miRNA microarray kit (version 1.0)

-miRNA labeling reagent and hybridization kitg g y

Coming soon: Mouse, Rat and updated Human microarray kits2100 Bioanalyzer:

Total RNA Assays (for RNA integrity)

-RNA 6000 Nano Kit

RNA 6000 Pico Kit-RNA 6000 Pico Kit

Small RNA Kit (for analysis of small RNAs)

Stratagene’s qPCR:St atage e s q C-High-Specificity miRNA QRT-PCR Detection Kit

-miRNA Specific Forward Primers

Agilent miRNA profiling solution

August 28, 2007

Page 37: A Robust and Sensitive Microarray System for Profiling of ......A robust and sensitive microarray systemmicroarray system for profiling of miRNAs Life Sciences - Genomics Stephanie

For more information…

Technical Background:

Wang Ach & Curry RNA 13 1 9 (2007)Wang, Ach, & Curry, RNA, 13, 1-9 (2007).

Product Information:Product Information:

http://www.opengenomics.com

http://www.opengenomics.com/miRNAOverview.aspx

Agilent miRNA profiling solution

August 28, 2007