ORIGINAL ARTICLE

A rapid method for isolation of genomic DNA from food-bornefungal pathogens

S. Umesha1 • H. M. Manukumar1 • Sri Raghava1

Received: 22 October 2015 /Accepted: 25 May 2016 / Published online: 6 June 2016

� The Author(s) 2016. This article is published with open access at Springerlink.com

Abstract Food contaminated with fungal pathogens can

cause extremely harmful effects to human even when

present in low concentrations. Researchers now pay more

attention towards rapid DNA extraction for the quick

screening, which is highly demanded in diverse research

field. Molecular description of many fungal species is

identified by different molecular characteristics. Hence, the

efficient isolation of genomic DNA and amplification using

PCR is a prerequisite for molecular characterization. Here,

we used an improved Sodium dodecyl sulfate-Cetyl-

trimethyl ammonium bromide-Chloroform-isoamyl alcohol

method by combining Sodium dodecyl sulfate with cetyl

methylammonium bromide without addition of proteinase

K, RNase K, and b-mercaptoethanol. To analyze the

quality of recovered DNA, this method was compared with

the other four routine methods. The present method has

been chosen in the study as a preferred method because of

easy adaptation to routine laboratories/food industries

considering its rapid, sensitivit,y and cost effectiveness

involved in the method.

Keywords CTAB � TPCI � MW � S-CCI � PCR � DNA

Introduction

In under-developed countries, one of the leading causes of

illness and death is due to food-borne pathogens, which

accounts approximately up to 1.8 million people annually

(Bisha and Brehm-Stecher 2010). To ensure food safety,

rapid detection of pathogenic organisms causing food-borne

illness is a basic requirement. Plating methods have been

replaced by more rapid and sensitive methods, such as

Fluorescence In-Situ Hybridization (FISH) (Chattopadhyay

et al. 2013), Enzyme Linked Immuno-Sorbent Assays

(ELISA) (Naravaneni and Jamil 2005), Polymerase Chain

Reaction (PCR) (Jaykus 2003), and Real-Time PCR (RT-

PCR) (Wolffs et al. 2004). However, the prerequisite for all

these methods is a high-quality DNA from the pathogen.

Various procedures are being used in these contests, but

these protocols are mainly suited for specific groups with

known morphologies and not for versatile fungal groups.

Therefore, DNA extraction is a very critical step, as it

eliminates unwanted interfere substances and ensures con-

sistency in the nucleic acid test results (Bolano et al. 2001).

It is a well-known fact that extraction of pure DNA from

fungi is very difficult. Reports exist that DNA extracted

from Neotyphodium lolii (Christensen et al. 1993) using

methods of Raeder and Broda (1985) and Byrd et al. (1990)

that was neither digested nor amplified by restriction

enzymes and Taq polymerase, respectively. This was

mainly due to cross contamination of fungal polysaccha-

rides or agar inoculum taken from the plates. Recently

commercial kits have been popularized (Dieguez et al.

2009), because DNA can be extracted easily within a day.

Since the available kit-based and other DNA extraction

methods are time consuming, and expensive. researchers

have also worked with different approaches to explore the

best manual method to extract fungal DNA, such as CTAB

(Petrisko et al. 2010) with organic solvents, lyticase, phe-

nol–chloroform, and isoamylic alcohol (Shin-ichi and

Takuma 2010) chelex (Hennequin et al. 1999) and the urea

chelex method (Mseddi et al. 2011) for some fungal

mycelia and most fungal spore samples remain undesirable.

& S. Umesha

umeshgroup@yahoo.co.in; pmumesh@gmail.com;

su@appbot.uni-mysore.ac.in

1 Department of Studies in Biotechnology, University of

Mysore, Manasagangotri, Mysore 570006, Karnataka, India

123

3 Biotech (2016) 6:123

DOI 10.1007/s13205-016-0436-4

In this present paper, Sodium dodecyl sulfate-Cetyl-

trimethyl ammonium bromide-Chloroform-isoamyl alcohol

(S-CCI) method was used for the isolation of food-borne

fungal genomic DNA. Sodium dodecyl sulfate (SDS) is a

strong anionic detergent, which disrupts non-covalent

bonds in the proteins and denature or losing its confirma-

tion. Cell membrane composed of proteins and lipids in

varying percentage. When external force/chemicals

applied, then membrane act against defence and become

destabilized this leads to breakdown of nuclear envelop and

expose of nuclear material to the outer environment. In

addition, removing the membrane barriers helps to release

the DNA from histones and other DNA-binding proteins by

denaturing them. The CTAB extraction method originally

developed by Doyle and Doyle in 1987, and later, it was

modified to remove polysaccharide, polyphenols, and other

secondary metabolites. The superfluous quantities of cel-

lular proteins were eliminated by triple extended treatment

with chloroform-isoamyl alcohol. In addition to the

removal of proteins, this treatment also helps to remove

different coloring substances. Importantly, CTAB is prob-

ably the only compound that can separate partial nucleic

acids from polyphenols. The polyphenolic compounds may

severely inhibit downstream DNA/RNA reactions. Chlo-

roform-isoamyl alcohol is a type of liquid detergent dis-

rupts the bonds that hold the cell membranes by dissolving

proteins, lipids, and then form complexes to precipitate out

of the solution.

The modified extraction protocol was designed based on

four factors, to maximize the DNA yield, minimize the

time, and avoid the use of expensive chemicals in extrac-

tion steps, and DNA should be amenable to several

downstream enzymatic applications, such as PCR ampli-

fication. Therefore, the objective of this study was to

compare existing extraction methods to our modified

S-CCI protocol for high-quality total DNA from fungi,

such as Aspergillus niger, Aspergillus flavus, Aspergillus

fumigates, Acremonium strictum, Bipolaris cyanodontis,

Colletotrichum gloeosporioides, Fusarium equiseti,

Fusarium oxysporum, Penicillium, and Trichoderma.

Materials and methods

Sample collection and Isolation of mycoflora

Different vegetarian and non-vegetarian food samples were

collected from different locations of Mysore region and

sterilized with 3 % sodium hypochlorite, 70 % ethanol, and

followed by repeated washings with sterile distilled water.

All samples were subjected to non-selective medium,

potato dextrose agar (PDA), and incubated at 25 ± 2 �Cfor 7 days. Then, fungal cultures were identified based on

morphological characteristics using standard book by

Mathur and Kongsdal, (2003) and pathogens were purified

by culturing onto new plates and individual cultures were

inoculated into potato dextrose broth (PDB) followed by

incubation for 10 days at 25 ± 2 �C. Grown mycelial mat

was freeze dried (at -20 �C), lyophilized (at -50 �C), andfurther DNA isolation and purification procedure were

carried out for these samples.

Reference strain

The reference Aspergillus brasiliensis (MTCC-1344) fun-

gal strain was kindly gifted by Ananda, A. P., Department

of Microbiology, Ganesh consultancy, and analytical ser-

vices, Mysore. Cultures acquired from Microbial Typing

Culture Collection, Chandigarh, India, used as positive

control for experimental study, and culture was revived and

grown as per protocol prescribed.

Genomic DNA extraction methods

CTAB-phenol–chloroform-isoamyl alcohol method

200 mg of lyophilized mycelial mat were grounded with

pestle and mortar using 500 lL of [CTAB-phenol–chloro-

form-isoamyl alcohol method (CTABPCI)] extraction

buffer (200-mM Tris–HCl (pH 8.0), 25-mM EDTA (pH

8.0), 250-M NaCl, 10 % CTAB) according to Li and Yao

(2005). Transferred to fresh tube and 3-lL proteinase K,

3-lL RNase were added then vortex and incubated for 1 h

at 37 �C. After incubation tubes were kept in a water bath

for 10 min at 65 �C. After one volume of phenol: chloro-

form: isoamyl alcohol (25:24:1) was added, solution was

thoroughly mixed for 5 min then centrifuged at 12,000 rpm

for 5 min. The aqueous clear phase was recovered and

mixed with one volume of chloroform: isoamyl alcohol

(24:1), centrifuged at 12,000 rpm for 5 min, and the

aqueous phase was recovered. Added one volume of ice-

cold isopropanol and stored overnight for precipitation of

DNA at -20 �C. DNA was recovered by centrifugation at

10,000 rpm for 5 min and DNA was precipitated with

absolute ethanol. The DNA was then rinsed twice with

1 ml of 70 % ethanol and resuspended in 200lL of

deionized water or 1X TE [200-mM Tris–HCl (pH 8.0),

20-mM EDTA (pH 8.0)] buffer for further use.

Tris-phenol–chloroform-isoamyl alcohol method

Lyophilized 200 mg of fungal cultures were transferred to

2-ml fresh tubes. 500 lL of TPCI (Tris-phenol–chloro-

form-isoamyl alcohol) extraction buffer (10 mM Tris–HCl,

pH 8.0, 100 mM NaCl, 25 mM EDTA, 0.5 % SDS), and 3

lL proteinase K was added, vortexed, and incubated for

123 Page 2 of 9 3 Biotech (2016) 6:123

123

1 h at 37 �C. Tubes were kept in a water bath for 10 min at

65 �C and centrifuged at 10,000 rpm for 10 min. Upper

liquid part was carefully transferred to a new tube and one

volume of phenol: chloroform: isoamyl alcohol (25:24:1)

mixed thoroughly for 5 min and centrifuged at 10,000 rpm

for 5 min. The aqueous phase was recovered, added 3-lLRNase, and incubated for 30 min. Mixed with one volume

of chloroform: isoamyl alcohol (24:1), and tubes were

centrifuged at 10,000 rpm for 5 min. Again, the aqueous

phase was recovered and one volume of ice-cold iso-

propanol was added and the tubes were stored overnight at

-20 �C. After centrifugation at 10,000 rpm for 5 min, the

pellet was recovered and DNA was precipitated with

absolute ethanol. The DNA was then washed twice with

1-ml 70 % ethanol and resuspended in 200 lL of deionized

water as per Silva et al. (2014).

Microwave method

The cultures were collected and grown as described above,

and the gDNA was purified by the microwave (MW)

method as reported previously by Bollet et al. (1995).

200 mg of fungal mat was rinsed with 1-ml TE buffer,

centrifuged, and lysed with 100-lL TE buffer and 50-lL10 % SDS. Incubated for 30 min at 65 �C and centrifuged

to remove the supernatant. The cell pellet was placed in a

microwave oven, heated two times for 1 min at 900 W.

The pellet was then resuspended in 200-lL TE buffer with

one volume of phenol: chloroform: isoamyl alcohol

(25:24:1) for 15 min. The aqueous phase was recovered by

centrifugation; the DNA was precipitated with 95 %

ethanol and centrifuged at 12,000 rpm for 20 min. Then,

the DNA was rinsed with 1-ml 70 % ethanol and resus-

pended in 200-lL deionized water as previously described.

Inexpensive method

Fungal cultures were collected and grown as described

above for inexpensive DNA extraction (IM) method as

reported previously by Prabha et al. (2012). 200 mg of

lyophilized mycelia mat were rinsed with 1-ml TE buffer,

vortexed for 10 s, tubes were kept at room temperature for

30 min. After centrifugation (10,000 rpm for 10 min),

supernatant was transferred to a new tube, then, the equal

volume of phenol: chloroform (24:1) was added, mixed

properly, and centrifuged at 13,000 rpm for 2 min. Finally,

supernatant was collected into separate tube, 300 lL of ice-

cold isopropanol was added and gently mixed in tubes

inversely. The reaction mixture was incubated at -20 �Cfor 30 min. DNA was recovered by centrifugation at

13,000 rpm for 5 min and pellet was washed with ice-cold

70 % ethanol and air dried for 15 min at room temperature.

Finally, pellet was resuspended in 100 lL of sterile water

and stored at -20 �C for further use.

SDS-CTAB-chloroform-isoamyl alcohol (modified method)

200 mg of lyophilized mycelial powder was taken and

transferred to 2-ml eppendorf tube. 500 lL of SDS-CTAB-

chloroform-isoamyl alcohol (S-CCI) extraction buffer

(250-mM Tris–HCl (pH 8.0), 20-mM EDTA (pH 8.0),

200-M NaCl, 10 % CTAB, 0.15 % SDS) was added and

vortexes and boiled for 10 min at 50 �C and centrifuged at

10,000 rpm for 10 min. Carefully, upper liquid part was

pipetted out and one volume of chloroform: isoamyl

alcohol (23:2) was added then mixed for 1 min and cen-

trifuged at 10,000 rpm for 5 min. The aqueous phase was

recovered and mixed with one volume of ice-cold iso-

propanol, and tube was turned upside down for 1 min to

precipitate DNA. Tubes were centrifuged at 10,000 rpm for

2 min to recover the pellet and washed with 500 lL of

absolute ethanol, then centrifuged at 10,000 rpm for 1 min.

DNA was air dried and resuspended in 200-lL deionized or

TE buffer for further use.

DNA quantification and quality determination

Extracted genomic DNA concentration and purity were

determined by NanoDrop spectrophotometer (Thermo

Fisher Scientific, USA). Concentration was recorded in

ng/lL, and purity of DNA is based on the ratio of the

optical density (OD) at the wavelength of 260 nm and

280 nm. The quality of the DNA yielded by each method

was determined by gel electrophoresis in a 0.7 % agarose

gel.

Restriction digestion

According to Devi et al. (2015) with slight modifications,

quality of the genomic DNA was validated using Eco RI

(Fermentas, Germany) restriction enzyme. The S-CCI

method extracted DNA was subjected for enzyme diges-

tion (one sample per triplicate) to check the suitability of

the DNA for downstream applications. Reaction volume

set for 20 lL contain 5 lL of 10X assay buffer [1X buffer

composition: 10-mM Tris–HCl pH 8.0; 5-mM

MgCl2;100-mM KCl; 0.02 % TritonX-100; 0.1-mg/mL

BSA], 1–2 lg of the DNA template with 20 U of the

enzyme, and reaction volume make up using 1X enzyme

buffer. Then, reaction carried out at 37 �C for 20–60 min

in water bath. Finally, reaction was stop by heat inacti-

vating the enzyme at 65 �C for 10 min and 5 lL of the

digested products were analyzed on 0.8 % agarose gel

along with 1 Kb DNA ladder.

3 Biotech (2016) 6:123 Page 3 of 9 123

123

Polymerase Chain Reaction

Polymerase Chain Reaction (PCR) assay was performed

using ITS rDNA primers. According to Gonzalez et al.

(2008), PCR amplification reaction was performed using

ITS1 F (TCCGTAGGTGAACCTGCGG) and ITS4 R

(TCCTCCGCTTATTGATATGC) primer set. Amplifica-

tion was carried out in 0.2-ml tube and reaction mixture

containing 2.5 lL of 80–100 ng of genomic DNA, 1 lL of

20 pmol of each primer, and 20 lL of Dream Taq Green

PCR master mix (Containing: 0.25 mM each dNTP, 2 mM

MgCl2 and Taq DNA polymerase) purchased from

(Thermo scientific, India). The PCR was performed in a

master gradient thermal cycler (LABNET, NJ, USA) using

the following conditions: initial denaturation at 94 �C for

5 min; 30 cycles of denaturation for 1 min at 94 �C,annealing for 1 min at 52 �C, initial extension for 1 min at

72 �C, and final extension of 10 min at 72 �C, followed by

cooling at 4 �C until the samples were recovered. The

amplified PCR amplicons was confirmed through gel

electrophoresis using 1 % agarose gel.

Results and discussion

Due to the presence of cell wall in fungi, it interferes and

hinders the efficiency of DNA extraction from the con-

ventional extraction methods (Maaroufi et al. 2004). After

several repetitions, we have optimized rapid and inexpen-

sive method to isolate of fungal DNA by slight modifica-

tions in the existing CTAB buffer constitution and steps

involved in DNA extraction (Rogers 1989). The yield and

purity of genomic DNA obtained from all four extraction

methods are depicted in Table 1. Different species of

microorganisms having its own varied membrane structural

organization with unique sets of protein to carry out the

specialized functions (Arachea et al. 2012). In the present

study, four different detergents-based protocol for disrup-

tion of membrane structure and removal of proteins (irre-

versibly from the cell) have been compared. The high DNA

yield was obtained in S-CCI protocol (645.45 lg/g sample

for Trichoderma) followed by CTABPCI, TPCI, MW, and

IM in descending order was represented in Table 1. It is

evident from the data that protocol IM recovered very less

yield compared to the other methods. In Fig. 1, the highest

yield of DNA extracted by different methods was depicted.

The purity of DNA from fungal pathogens using S-CCI

protocol was followed according to the Ki et al. (2007);

Desloire et al. (2006) and results depicted in Table 1. The

S-CCI extracted genomic DNA of fungal pathogens was

Table 1 Genomic DNA yield from different fungal pathogens using

different extraction methods

Sl.

no

Method Pathogens Yield (lgDNA/g

sample)

Purity

(A260/

A280)

1 CTABPCI Aspergillus niger 301.25 1.90

Aspergillus flavus 246.95 1.67

Bipolaris cyanodontis 210.52 1.92

Fusarium oxysporum 239.57 2.01

Penicillium 250.45 2.10

Trichoderma 280.00 1.96

Fusarium equiseti 219.95 1.87

Acremonium strictum 195.30 2.00

Colletotrichum

gloeosporioides

236.20 1.98

Aspergillus fumigatus 210.30 1.65

2 TPCI Aspergillus niger 108.85 1.75

Aspergillus flavus 33.97 1.94

Bipolaris cyanodontis 158.62 2.01

Fusarium oxysporum 97.27 1.84

Penicillium 151.00 1.99

Trichoderma 200.45 2.10

Fusarium equiseti 51.97 2.21

Acremonium strictum 167.52 2.10

Colletotrichum

gloeosporioides

172.13 1.69

Aspergillus fumigatus 171.85 1.85

3 MW Aspergillus niger 34.67 1.40

Aspergillus flavus 189.05 2.10

Bipolaris cyanodontis 110.25 1.78

Fusarium oxysporum 70.32 1.75

Penicillium 244.50 1.98

Trichoderma 189.67 2.10

Fusarium equiseti 185.67 1.89

Acremonium strictum 46.75 1.78

Colletotrichum

gloeosporioides

105.52 1.70

Aspergillus fumigatus 197.39 1.50

4 IM Aspergillus niger 113.21 1.84

Aspergillus flavus 211.32 1.98

Bipolaris cyanodontis 78.05 2.20

Fusarium oxysporum 127.60 2.01

Penicillium 184.72 1.45

Trichoderma 220.42 1.79

Fusarium equiseti 152.60 1.99

Acremonium strictum 67.75 2.00

Colletotrichum

gloeosporioides

211.00 1.89

Aspergillus fumigatus 235.47 1.98

123 Page 4 of 9 3 Biotech (2016) 6:123

123

run on 0.7 % agarose gel (Fig. 2), to compare the quality of

DNA. The CTAB method has been primarily developed for

extraction of DNA from plant tissues. This superior method

helps in removing unwanted carbohydrates associated

during plant DNA extraction (Goltapeh et al. 2007; Pet-

risko et al. 2008a, b). Muller et al. (1998) reported high-

speed cell disruption extraction produced a significantly

greater yield from fungi. Fredricks et al. (2005) used a

FDNA followed the same principle accordance with the

Muller, and it is comparable to our S-CCI protocol.

According to Liu et al. (2011), FPFD (Fast Purification of

Fungal DNA) method also promisingly explained satis-

factory recovery of fungal DNA from FPFD experimental

performance. FPFD method does not require organic

extraction, and this method meet the needs of the routine

screening of fungal pathogens. All methods except TPCI

and MW method highlighted cross contamination of pro-

tein in the sample were depicted in Table 1. Values of an

OD ratio factor of the purity of DNA; below 1.8 indicates

protein contamination while above 1.8 indicates contami-

nation of RNA (Samuel et al. 2003). The purity of DNA

was compared among different methods that were repre-

sented in Table 1. The purity of the all the DNA was fur-

ther confirmed by digesting the genomic DNA using

restriction enzyme Eco RI. Then, photograph was showing

the banding pattern of digested DNA along with genomic

DNA in Fig. 3, it is comparable to the Ajay et al. (2008).

Important features of this S-CCI protocol are: 1. The

method works well with all species of fungus to extract

genomic DNA. 2. Yields high quality of DNA from

mycelium without fragmentation of DNA. 3. Very simple,

cost effective, and requires less manpower. 4. Compared to

kit-based methods, this method is quite fast with less

extraction steps and chemicals required. According to

Khan and Yadav (2004), excessive or above 0.01 % of

SDS residues in the sample cause denaturation of the Taq

DNA polymerase or crass act or inhibit the PCR

Table 1 continued

Sl.

no

Method Pathogens Yield (lgDNA/g

sample)

Purity

(A260/

A280)

5 S-CCI Aspergillus niger 306.47 1.99

Aspergillus flavus 596.15 1.93

Bipolaris cyanodontis 314.80 2.01

Fusarium oxysporum 390.02 2.00

Penicillium 359.47 1.70

Trichoderma 645.45 1.83

Fusarium equiseti 354.92 2.01

Acremonium strictum 253.53 1.72

Colletotrichum

gloeosporioides

305.07 1.69

Aspergillus fumigatus 249.36 1.78

Different fungal cultures were used for extraction of DNA by

CTABPCI, TPCI, MW, and IM compared to modified S-CCI method

in this study. Yield and purity of established S-CCI method were

compared to other methods. Each values of yield and purity men-

tioned are average of triplicate assay carried out for all the fungal

pathogens used

Fig. 1 Yield of DNA in different DNA extraction methods. Different

fungal genomic DNA was prepared by CTABPCI, TPCI, MW, IM,

and modified S—CCI methods. Highest DNA yield was obtained by

the S-CCI method from Aspergillus niger, Trichoderma, Penicillium,

and Aspergillus fumigates compared to the other methods of DNA

extraction. Among different DNA extraction methods, the S-CCI

method showed maximum yield of DNA

Fig. 2 Genomic DNA profile of different fungi, extracted using

S-CCI method on 0.7 % agarose gel. Genomic DNA was extracted

from different fungi using S-CCI method and electrophoresed on

0.7 % agarose gel. S-CCI method showed clear DNA profile of all

fungal organism studied. Lane 1. Aspergillus niger, 2. Aspergillus

flavus, 3. Bipolaris cyanodontis, 4. Fusarium oxysporum, 5. Penicil-

lium, 6. Trichoderma, and 7. Fusarium equiseti

3 Biotech (2016) 6:123 Page 5 of 9 123

123

amplification; so, use of less percentage of SDS is must

required. Therefore, in our study, we have used 0.15 % of

SDS in the S-CCI method; hence, no cross acting on PCR

was observed. So, we recommend not more than 0.15 % of

SDS (higher may affect the PCR) to prepare the S-CCI

extraction buffer.

To check the quality of fungal genomic DNA, fungal

Internal Transcribed Spacer (ITS) specific universal pri-

mers ITS1F and ITS4R were used for amplification of the

fungal rDNA region. Figure 4, represents ITS primer

amplified PCR products of S-CCI extracted DNA of dif-

ferent fungi (morphological characteristics were depicted

in Fig. 5), which have been well resolved in 1 % agarose

gel and compared to 100-bp ladder. Confirmed that the

DNA sample are free of polyphenols and polysaccharides,

which are inhibitory agents hidden in the sample known to

inhibit restriction endonucleases (RE) and Taq DNA

polymerase according to Moyo et al. (2008). Restriction

enzyme digested samples in Fig. 3 also confirmed that

isolated DNA was amenable for downstream applications

was successfully explained in the paper is comparable to

the Ajay et al. (2008).

Fredricks et al. (2005) compared two important human

fungal pathogens (Aspergillus fumigatus and Candida

albicans) using six kit-based DNA extraction protocol.

Among them, MPY (Master Pure Yeast DNA purification

kit) and FDNA protocol produced a good result yielding

the high amount of fungal DNA. In comparison to kit-

based protocol and available existing DNA extraction

methods, S-CCI executionproved that it is more advanta-

geous, yielding more fungal DNA over kit-based MPY,

FDNA, and compared four methods in this study. Fredricks

method of DNA isolation has a major drawback of low

yield of DNA. To overcome this drawback, necessay link

was highlighted in the S-CCI method by altering chemical

Fig. 3 Gel electrophoresis of partial restriction digestion of the

genomic DNA extracted by the S-CCI method using restriction

enzyme Eco RI. Compared to CTABPCI, TPCI, MW, and IM DNA

extraction methods, S-CCI exhibited its downstream application

showing less contamination, while extracting DNA of fungal

pathogens. Lane 1. Aspergillus niger, 2. Aspergillus flavus, 3.

Bipolaris cyanodontis 4. Fusarium oxysporum, 5. Penicillium, 6.

Trichoderma 7. Fusarium equiseti, 8. Acremonium strictum, 9.

Colletotrichum gloeosporioides, and 10. Aspergillus fumigatus fol-

lowed by restriction digestion products (a–j), respectively, on 1 %

agarose gel. Lane M 1 kb DNA ladder

Fig. 4 Amplified PCR profile of different fungal ribosomal DNA

extracted from the S-CCI method. Among the different (CTABPCI,

TPCI, MW, and IM) methods, downstream application of PCR was

well-defined by the S-CCI method. The PCR was performed using

ITS1 and ITS4 primers and electrophoresed on 1 % agarose gel. Lane

1. Aspergillus niger, 2. Aspergillus flavus, 3. Bipolaris cyanodontis, 4.

Fusarium oxysporum, 5. Penicillium, 6. Trichoderma, 7. Fusarium

equiseti, 8. Acremonium strictum, 9. Colletotrichum gloeosporioides,

and 10. Aspergillus fumigatus

123 Page 6 of 9 3 Biotech (2016) 6:123

123

compositions and steps important for the recovery of fun-

gal DNA method was optimized in this paper.

Some of the species grow as unicellular that reproduce

by budding or binary fission in case of yeasts. However,

dimorphic fungi can grow in between a yeast phase and a

hyphal phase in response to environmental conditions.

Plants cell wall composed of glucans and exoskeleton of

arthropods made by chitin. But in the case of fungal cell,

celwall is composed of both chitin and glucans. The only

organisms combine both these structural molecules in their

cell wall. Except plants and oomycetes, cell walls of fungi

do not contain cellulose. Fungi are one of the most suc-

cessful species and are distributed worldwide. The cell wall

of a fungus is an intriguing component. It determines the

shape of the cell and also protects cell from harsh

environment.

The fungal kingdom is very diverse in nature, species

growing as unicellular, or hyphae with branches helps in

production of remarkable assortment of spores and other

reproductive structures. For every stage of fungal develop-

ment, the shape and close association between protein and

other polymers present integrity that present in the cell wall

Fig. 5 Morphological characterization of fungal pathogens under

compound microscope. Different fungal pathogens cultured on PDA

medium were subjected to morphological characterization under

compound microscope. a Aspergillus niger, b Aspergillus flavus,

c Bipolaris cyanodontis, d Fusarium oxysporum, e Penicillium,

f Trichoderma, g Fusarium equiseti, h Acremonium strictum,

i Colletotrichum gloeosporioides, and j Aspergillus fumigatus

3 Biotech (2016) 6:123 Page 7 of 9 123

123

of the fungus is play a very important role in the dependent

by givingmechanical strength, intern which performs a wide

range of fundamental roles during the communication of the

fungus with its environment (Gooday 1995).

We isolated different (Aspergillus niger, Aspergillus

flavus, Bipolaris cyanodontis, Fusarium oxysporum, Peni-

cillium, Trichoderma, Fusarium equiseti, Acremonium

strictum, Colletotrichum gloeosporioides, and Aspergillus

fumigates) fungal pathogens from food sources and sub-

jected to DNA extraction using different protocols by

comparing our fast DNA extraction method to show the

efficiency and for downstream applications of DNA. Crit-

ically, the fungal wall is a multifarious organization by

tranquil typically of chitin, 1,3-b- and 1,6-b-glucan, man-

nan, and proteins.

Primarily, monomers of b-1,4-linked N-acet-

ylglucosamine and b-1,3-linked glucose repeats associated

with formation of chitin and glucan polymers, respectively.

However, considering this point of view and look up the

structural association in fungal cell wall, there is abundant

quantities of branched 1,3- b -,1,6- b –glucan, and also

evidence of Klis et al. (2002), presence of extensive cross-

linking between chitin, glucan, and other wall components.

Furthermore, the highly dynamic structure of cell wall

involved in constant revolutionize during cell division,

spore germination, branching of hyphal structures, and

septum pattern in filamentous fungi. Maybe, these are

activities that depend on number of hydrolytic enzymes

intimately allied with the cell wall of the different fungal

species. Fungal genome contains multiple glucanase/glu-

canosyltransferase-encoding genes. One of the possible

results of gene disruption studies states that several of these

enzymes have roles during development of cell-wall

architecture in yeasts and filamentous fungi. Therefore, this

battery of enzymes most probably helps to facilitate the

complex blueprint of lysis, branching, and cross-linking

that involves the glucan layers of the fungal cell wall

(Adams 2004).

According to Chet and Inbar (1994), cell wall of the

most of fungal species hydrolases characterized have

chitinase or glucanase, and these enzymes also exhibit the

transglycosylase activity. Therefore, there is possible con-

tribution to breakage, re-forming, and re-distribution of

bonds between and within polymers leading to possible re-

molding of the cell wall during fungal cell-wall develop-

ment and morphogenesis.

Hence, the cell wall is an essential component to the cell

and provides one of major defencing target to study. Cur-

rently, little is known about the cell wall of different spe-

cies of filamentous fungi (Kils et al. 2002). For better

understanding of the fungal cell wall and of its adaptation

to various conditions, some more experimental validations

are required to understand the defencing property

adaptations to the external environment. The cell wall is a

highly dynamic structure and able to adapt to various

changes, either environmental (e.g., heat, pH, osmolarity,

and chemical compounds), developmental (e.g., mating,

growth, budding, branching, and sporulation), or genetic

(e.g., mutations in cell-wall-related genes) (Kollar et al.

1997; Bowman and Free 2006).

In this experimental study, S-CCI protocol is proved to

be the best compared to the existing DNA extraction pro-

tocol, because, technically, S-CCI is simple, work faster,

less prone to cross contamination, and inexpensive than

other methods. Samples were also amenable to PCR

amplification and can be used routinely to identify and

screening of fungal pathogens in both clinical and labora-

tory settings.

Acknowledgments The authors Manukumar, H.M., and Sri Raghava

greatly acknowledge the financial assistance from the Department of

Biotechnology (DBT), Department of Science and Technology, Govt.

of India, grant number BT/PR10338/PFN/20/922/2013, New Delhi,

India, for financial assistance.

Compliance with ethical standards

Conflict of interest We declare that we have no conflict of interest in

the article.

Open Access This article is distributed under the terms of the

Creative Commons Attribution 4.0 International License (http://

creativecommons.org/licenses/by/4.0/), which permits unrestricted

use, distribution, and reproduction in any medium, provided you give

appropriate credit to the original author(s) and the source, provide a

link to the Creative Commons license, and indicate if changes were

made.

References

Adams DJ (2004) Fungal cell wall chitinases and glucanases.

Microbiology 150(7):2029–2035

Ajay AK, Sharma K, Misra RS (2008) Rapid and efficient methods

for the extraction of fungal and oomycetes genomic DNA. Gene

Genome Genomic 2:57–59

Arachea BT, Sun Z, Potente N, Malik R, Isailovic D, Viola RE (2012)

Detergent selection for enhanced extraction of membrane

proteins. Prot Expres Purify 86(1):12–20

Bisha B, Brehm-Stecher BF (2010) Combination of adhesive-tape-

based sampling and fl uorescence in situ hybridization for rapid

detection of Salmonella on fresh produce. J Vis Exp 44:2308

Bolano A, Stinchi S, Preziosi R, Bistoni F (2001) Rapid methods to

extract DNA and RNA from Cryptococcus neoformans. FEMS

Yeast Res 1:221–224

Bollet C, Gevaudan MJ, De Lamballerie X, Zandotti C, De Micco P

(1995) A simple method for the isolation of chromosomal DNA

from gram positive or acid-fast bacteria. Nucleic Acids Res

19:19–25

Bowman SM, Free SJ (2006) The structure and synthesis of the fungal

cell wall. BioEssays 28(8):799–808

Byrd AD, Schardl CL, Songlin PJ, Mogen KL, Siegel MR (1990) The

tubulin gene of Epichloe typhina from perennial ryegrass

(Lolium perenne). Curr Genet 18:347–354

123 Page 8 of 9 3 Biotech (2016) 6:123

123

Chattopadhyay S, Kaur A, Jain S, Singh H (2013) Sensitive detection

of food-borne pathogen Salmonella by modified PAN fibers-

immunoassay. Bios Bioel 45:274–280

Chet I, Inbar J (1994) Biological control of fungal pathogens. Appl

Biochem Biotechnol 48:37–43

Christensen MJ, Leuchtmann A, Rowan DD, Tapper BA (1993)

Taxonomy of Acremonium endophytes of tall fescue (Festuca

arundinacea), meadow fescue (F. pratensis) and perennial rye-

grass (Lolium perenne). Mycolo Res 101:295–301

Desloire S, Valiente Moro C, Chauve C, Zenner L (2006) Comparison

of four methods of extracting DNA from D. gallinae (Acari:

Dermanyssidae). Vet Res 37:725–732

Devi SG, Fathima AA, Radha S, Arunraj R, Curtis WR, Ramya M

(2015) A Rapid and Economical Method for Efficient DNA

Extraction from Diverse Soils Suitable for Metagenomic Appli-

cations. PLoS One 10:7

Dieguez-Uribeondo J, Garcia MA, Cerenius L, Kozubı́kova E (2009)

Phylogenetic relationship among plant and animal parasites, and

saprotrophs in Aphanomyces (Oomycetes). Fungal Genet Biol

46:365–376

Fredricks DN, Smith C, Meier A (2005) Comparison of six DNA

extraction methods for recovery of fungal DNA as assessed by

quantitative PCR. J Microbiol 43(10):5122–5128

Goltapeh EM, Aggarwal R, Pakdaman BS, Renu R (2007) Molecular

characterization of Aspergillus species using amplicon length

polymorphism (ALP) and universal rice primers. J Agric Tech-

nol 3:29–37

Gonzalez-Mendoza D, Moreno AQ, Zapata Perez O (2008) An

improved method for the isolation of total RNA from Avicennia

germinans leaves. Z Naturforsch C A J Biosci 63:124–126

Gooday GW (1995) Cell walls. In the Growing Fungus, pp. 43–62.

Edited by N. A. R. Gow and G. M. Gadd. London: Chapman &

Hall

Hennequin H et al (1999) Identification of Fusarium species involved

in human infections by 28S rRNA gene sequencing. J Clin

Microbiol 37(11):3586–3589

Jaykus LA (2003) Challenges to developing real-time methods to

detect pathogens in foods. ASM News 69:341–347

Khan IU, Yadav JS (2004) Development of a single-tube, cell

lysisbased, genus-specific PCR method for rapid identification of

mycobacteria: optimization of cell lysis, PCR primers and

conditions, and restriction pattern analysis. J Clin Microbiol

42:453–457

Ki JS, Chang KB, Roh HJ, Lee BY, Yoon JY, Jang GY (2007) Direct

DNA isolation from solid biological sources without pretreat-

ments with proteinase-K and/or homogenization through auto-

mated DNA extraction. J Biosci Bioeng 103:242–246

Kils FM, Mol P, Hellingwerf K, Brul S (2002) Dynamics of cell wall

structure in Saccharomyces cerevisiae. FEMS Microbiol Rev

26:239–256

Klis FM, Mol P, Hellingwerf K, Brul S (2002) Dynamics of cell wall

structure in Saccharomyces cerevisiae. FEMS Microbiol Rev

26:239–256

Kollar R, Reinhold BB, Petrakova E, Yeh HJ, Ashwell G, Drgonova

J, Kapteyn JC, Kils FM, Cabib E (1997) Architecture of the yeast

cell wall. Beta(1?6)-glucan interconnects mannoprotein, beta

(1?)3-glucan, chitin. J Biol Chem 272:17762–17775

Li XL, Yao YJ (2005) Revision of the taxonomic position of the

Phoenix 9 Mushroom. Mycotaxon 91:61–73

Liu KH, Yeh YL, Shen WC (2011) Fast preparation of fungal DNA

for PCR screening. J Microbiol Meth 85(2):170–172

Maaroufi Y, Ahariz N, Husson M, Crokaert F (2004) Comparison of

different methods of isolation of DNA of commonly encountered

Candida species and its quantitation by using a real-time PCR-

based assay. J Clin Microbiol 42:3159–3163

Mathur SB, Kongsdal O (2003) Common laboratory seed health

testing methods for detecting fungi. International Seed Testing

Association. Mishra AK, Sharma K, Misra RS (2008) Rapid and

efficient method for the extraction of fungal and oomycetes

genomic DNA. Gene Genome Genomics 2(1):57–59

Moyo M, Amoo SO, Bairu MW, Finnie JF (2008) Optimizing DNA

isolation for medicinal plants. South Afr. J. Bot 74:771–775

Mseddi et al (2011) A rapid and easy method for the DNA extraction

from Cryptococcus neoformans. Biol Proc Online 13:5

Muller FM, Werner KE, Kasai M, Francesconi A, Chanock SJ, Walsh

TJ (1998) Rapid extraction of genomic DNA from medically

important yeasts and filamentous fungi by high-speed cell

disruption. J Clin Microbiol 36:1625–1629

Naravaneni R, Jamil K (2005) Rapid detection of food-borne

pathogens by using molecular techniques. J Med Microbiol

54:51–54

Petrisko JE, Pearl CA, Pilliod DS, Sheridan PP, Williams CF,

Peterson CR, Bury RB (2008a) Saprolegniaceae identified on

amphibian eggs throughout the Pacific Northwest, USA, by

internal transcribed spacer sequences and phylogenetic analysis.

Mycologia 100:171–180

Petrisko JE, Pearl CA, Pilliod DS, Sheridan PP, Williams CF,

Peterson CR, Bury RB (2008b) Saprolegniaceae identified on

amphibian eggs throughout the Pacific Northwest, USA, by

internal transcribed spacer sequences and phylogenetic analysis.

Mycologia 100:171–180

Prabha TR, Revathi K, Vinod MS, Shanthakumar SP, Bernard P

(2012) A simple method for total genomic DNA extraction from

water moulds. Curr Sci 104:345–347

Raeder U, Broda P (1985) Rapid preparation of DNA from lamentous

fungi. Lett Appl Micro 1:17–20

Rogers SO, Rehner S, Bledsoe C, Mueller GJ, Ammirati JF (1989)

Extraction of DNA from Basidiomycetes for ribosomal DNA

hybridizations. Cana J Bot 67:1235–1243

Samuel M, Lu M, Pachuk CJ, Satshchandran C (2003) A spectropho-

tometric method to quantify linear DNA. Anal Biochem

313:301–306

Shin-ichi F, Takuma H (2000) DNA fingerprinting patterns of

Candida species using Hinf1 endonuclease. Int J Syst Evol

Microbiol 50:1381–1389

Silva ECB, Pelinca MA, Acosta AC, Silva DMF, Gomes FM, Guerra

MM (2014) Comparative study of DNA extraction methodolo-

gies from goat sperm and its effects on polymerase chain

reaction analysis. Gene Mole Rese GMR 13(3):6070

Wolffs P, Knutsson R, Norling B, Radstrom P (2004) Rapid

quantification of Yersinia enterocolitica in pork samples by a

novel sample preparation method, flotation, prior to real-time

PCR. J Clin Microbiol 42:1042–1047

3 Biotech (2016) 6:123 Page 9 of 9 123

123