A quick course in genetics part 1 by Elísabet Einarsdóttir [email protected] 7....

A quick course in geneticspart 1

byElísabet Einarsdóttir

[email protected]

7. Nov 2003

CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendelChromosome recombinationsGenetic & physical distancesUses for genetics & genomes

General outline

The basic structure of living organisms- the cell

More cells

Plant cell

Bacterial cell

Central dogma of information flow in genetics

DNA (dideoxynucleic acid)– the double helix

The structure of DNA

A gene

A segment of DNA that is the template for making a protein

Structure of a gene

regulatory region

Region that acts as a template forthe production of proteins

Chromosomes- the packing of DNA

Telomere regions

The structure of a chromosome

p1p2

p5

p3p4

q3

q5q4

q2q1

q6q7

p-arm of chromosome (short arm)

q-arm of chromosome (long arm)

Chromosome banding

E.g. linkage of a disease to 2q7.2

The human chromosome map

Chromosomal abnormalities

Turner syndrome – only one X chromosome

Downs syndrome – 3 copies of chr 21

Extracting genetic information from DNA- making an RNA copy of DNA

DNA to RNA to protein via the ribosome

The splicing of RNA

Ready-to-use mRNA

Unspliced RNA copy of DNA

DNA template

exon intron exon exon exon exonintron intron intron

Alternative splicing of RNA

Different functions of different splice variantsDifferent expression of different splice variantsDominant-negative variants

Amino acids

• Amino acids link together to form a long chain• R (side chain) – varies between amino acids • There are 20 different amino acids

Ribosomes translate 3-base sequences intoamino acid chains – the building blocks for proteins

RNA “copy of DNA”AAGCUGAGAUCAGUUCGGAUACCGUA

Note: T in DNA becomes U in RNA

amino acid chain

ribosome

In-frame: THE FAT CAT ATE THE BIG HAT1 bp deletion: THF ATC ATA TET HEB IGH AT1 bp added: THE FAT CCA TAT ETH EBI GHA T

The importance of being in-frame

3D structure of a protein

Mitosis - a cell divides to make twoidentical cells – part of normal growth

Meiosis – only during reproduction

Egg cells from mother

Sperm cellfrom father

An offspringHalf of the chr from mother, half from father

CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendel Chromosome recombinationsGenetic & physical distancesUses for genetics & genomes

Loci, alleles & markers

A locus is any point (or region) in the genome

A genetic marker is anything in the genome that is variableand can be used to compare individuals

If a locus is variable, distinct alleles (forms) of the locus(e.g. a gene or marker) can be defined and analyzed A genotype is the set of alleles an individualhas at a particular locus

A phenotype is a visible trait in an individual (e.g. blue eyes or the presence of a disease)

Gregor Mendel (1822-1884)- the austrian monk with a passion for peas

•The law of segregation

Each individual carries two copies (alleles) of every gene and only one of these is transmitted to each child

•The law of independent assortment

Alleles from unlinked loci are assorted independently

Mendel´s experiment with peas

Punnet´s square:½ Ss = smooth¼ SS = smooth¼ ss = Wrinkled

S: smooth genes: mutated smooth gene

• In each individual a trait is determined by two copies (alleles) of the same gene, one paternal and one maternal

• Only one of the two parental alleles is transmitted to each child but with equal probability

50% A 50% a

50% A 25%AA 25%Aa

50% a 25%Aa 25%aa

Mother Aa

Father Aa

Principles of Mendelian analysis-First law

Principles of Mendelian analysis- Second law

-The principle of independent segregation applies independently to gene pairs determining different traits

- Alleles from unlinked loci are assorted independently

50% A 50% a

50% B 25%AB 25%aB

50% b 25%Ab 25%ab

Aa

Bb

Alleles from unlinked loci segregate independently

Alleles from linked loci do not segregate independently

• A child always inherits one copy of each chromosome from each of the parents (meiosis, Mendel’s fist law)

• Any deviation from this can be pathogenic, e.g. Turner syndrome (only one X) and Downs syndrome (3 copies of chr 21)

• A girl has two X chromosomes (one from each parent), a boy one X and one Y chromosome (X from mother, Y from father) – implications for X-linked diseases

• Each chromosome is inherited independently of the other one, which copy of a parents chromosomes the child inherits is thus random (Mendel’s second law)

Some points to note

CellsDNA, genes & chromosomesRNA & transcriptionMeiosis & mitosisMendel Chromosome recombinationsGenetic & physical distancesUses for genetics & genomes

Recombination of parental chromosomes - a source of variation & essential for looking at

genetic distances & mapping disease

Recombination pattern in a family

Parental grandparentsMaternal grandparents

Father Mother

Child

• Recombinations happen only during meiosis (during the generation of egg- or spermcells).

• Recombinations occur in each generation, usuallyat least once per chromosome

• Recombinations are in theory random, but in principlethe likelyhood of recombinations at a particular point in the genome is quite variable

• Almost no recombination at the centrimere, higher frequency of recombinations closer to the telomeres

Some points on recombinations

Physical distance- Mb

• The lowest-resolution physical map is the chromosomal map, based on the banding patterns observed by microscopy of stained chromosomes.

• More detailed radiation hybrid maps are made by breaking the chromosomes into small pieces. If two markers map to the same small fragment they are likely to be close together.

• The highest-resolution physical map is the complete sequencing of each chromosome in the genome

Physical maps can be divided into three general types: chromosomal or cytogenetic maps, radiation hybrid maps, and sequence maps.

Physical maps at NCBI

Centimorgan (cM): a unit of chromosome length, equals the length of chromosome over which crossing-over occurs with 1 per cent frequency

A Ba b

A b

Recombination between locus A and locus BIf 1% of meiosis result in recombinant chromosomes=> 1cM between A and B

Genetic distance- cM

Genetic maps at NCBI

Uses for genetics

Mapping disease

Genetic tests for known diseases

Microbial genomics

Forensics

Paternity tests

Development of medicines - pharmacogenomics

Breeding of animals and plants

Phylogenic studies & evolution

http://www.ncbi.nlm.nih.gov/

Human Genome Project

Founding partners:U.S. Department of Energy National Institutes of Health (NIH) Wellcome Trust As well as groups in Japan, France, Germany, and China

Aims: To generate a high-quality reference DNA sequence for the human genome‘s 3 billion base pairs and to identify all human genes.

Also to sequence the genomes of model organisms to interpret human DNA, enhance computational resources to support future research and commercial applications, explore gene function through mouse-human comparisons, study human variation, and train future scientists in genomics.

•The human genome consists of 3 billion bases (A, C, T, and G).

•The function of 50% of known genes is unknown.

•The human genome sequence is almost (99.9%) exactly the same in all people.

• A human genome is 97% like a chimp genome, 75% of the mouse genome

•Over 40% of the predicted human proteins share similarity with fruit-fly or worm proteins.

•Chromosome 1 (the largest human chromosome) has the most genes (2968), and the Y chromosome has the fewest (231).

After the Human Genome Project

The future of genetics?

The human genome

is like a book where each letter has been read, but there are no chapters or page numbers so you don’t really know what it all means or what to make of it....

A quick course in genetics part 1 by Elísabet Einarsdóttir [email protected] 7....

Documents

Transcript of A quick course in genetics part 1 by Elísabet Einarsdóttir [email protected] 7....