International Journal for Parasitology 42 (2012) 429–435

Contents lists available at SciVerse ScienceDirect

International Journal for Parasitology

journal homepage: www.elsevier .com/locate / i jpara

Rapid Communication

A novel recombinant Leishmania donovani p45, a partial coding regionof methionine aminopeptidase, generates protective immunity by inducinga Th1 stimulatory response against experimental visceral leishmaniasis q

Reema Gupta a, Pramod K. Kushawaha a, Chandra Dev Pati Tripathi a, Shyam Sundar b, Anuradha Dube a,⇑a Division of Parasitology, Central Drug Research Institute, Lucknow 226001, Indiab Department of Medicine, Institute of Medical Sciences, Benaras Hindu University, Varanasi, India

a r t i c l e i n f o

Article history:Received 2 December 2011Received in revised form 8 February 2012Accepted 9 February 2012Available online 27 March 2012

Keywords:Leishmania donovaniRecombinant p45Methionine aminopeptidaseImmunogenicityT-cell responseCured Leishmania hamstersCured Leishmania patients and endemic contactsProphylactic potential

0020-7519/$36.00 � 2012 Australian Society for Parahttp://dx.doi.org/10.1016/j.ijpara.2012.02.013

q Note: Nucleotide sequence data reported in this pthe GenBank database under Accession No. EU723851⇑ Corresponding author. Tel.: +91 0522 261241

2623938/2623405.E-mail addresses: anuradha_dube@rediffmail.co

.com (A. Dube).

a b s t r a c t

The development of a vaccine against visceral leishmaniasis (VL) conferring long-lasting immunityremains a challenge. Identification and proteomic characterization of parasite proteins led to thedetection of p45, a member of the methionine aminopeptidase family. To our knowledge the presentstudy is the first known report that describes the molecular and immunological characterization ofp45. Recombinant Leishmania donovani p45 (rLdp45) induced cellular responses in cured hamsters andgenerated Th1-type cytokines from peripheral blood mononuclear cells of cured/endemic VL patients.Immunization with rLdp45 exerted considerable prophylactic efficacy (�85%) supported by an increasein mRNA expression of iNOS, IFN-c, TNF-a and IL-12 and decrease in TGF-b and IL-4, indicating its poten-tial as a vaccine candidate against VL.

� 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Globally, approximately 500,000 new cases of visceralleishmaniasis (VL), a likely fatal disease in the disadvantaged andcaused by Leishmania donovani infection, are reported annually(www.who.int/leishmaniasis/en/). As with other intracellularpathogens, cellular immune responses are critical for protectionagainst leishmaniasis. The lack of good chemotherapeutic optionsimposes a pressing need for the development of an effective vac-cine against VL which should be dependent on the generation ofa T helper type-1 (Th1) immune response. As recovery from leish-maniasis is usually accompanied by solid immunity against rein-fection, it is believed that the development of a vaccine againstleishmaniasis is feasible. The determination of cytokine profilesin peripheral blood mononuclear cells (PBMCs) from leishmaniasispatients, as well as the identification of defined antigens thatinduce and elicit cell mediated immune responses, is importantin our understanding of the nature of immune responsivenessduring infection, as well as the potential identification of vaccine

sitology Inc. Published by Elsevier

aper have been deposited in.

1 18x4398; fax: +91 0522

m, anuradha_dube@hotmail

molecules. In our laboratory, while performing activity based frac-tionation assays and proteomic characterization, p45 (a member ofthe methionine aminopeptidase (MAP) family) was reported to bepresent in the subfraction of soluble L. donovani lysate (SLD) in themolecular weight range of 89.9–97.1 kDa (Kumari et al., 2008a,b).There has been only one known report regarding this protein,wherein it has been reported to induce a proliferative responsein leishmanial parasite-specific T-cell lines derived from a VL ende-mic Brazilian donor (Probst et al., 2001). In the present study wegenerated recombinant L. donovani p45 (rLdp45) and tested itsimmunogenicity and protective efficacy in golden hamsters(Mesocricetus auratus) as this experimental model shows similarclinico-pathological features to progressive human VL, includingincreased visceral burden, progressive cachexia, hepatosplenomeg-aly, pancytopenia, hypergammaglobulinemia and ultimately death(Melby et al., 2001).

In order to generate recombinant p45, an open reading frame of p45(1086 bp) was amplified by PCR using L. donovani genomic DNA as a tem-plate and the forward primer 50GGATCCGATGAAGAAGAGGAGGA-CACC30, and reverse primer 50GAATTCCTACTTCGCCGCCTTCTTCTC30

with BamHI and EcoRI restriction sites underlined. The design of thegene-specific primers was based on a Leishmania major-p45 gene se-quence (GenBank Accession No. AF099106). The amplified PCR product(Fig. 1A) was inserted in-frame with a 6xHis tag into the BamHI/EcoRI site

Ltd. All rights reserved.

430 R. Gupta et al. / International Journal for Parasitology 42 (2012) 429–435

of the vector pET-28a (Novagen, USA) and the insert was sequenced. Thepositive transformants were sequenced by South Campus, Delhi Univer-sity (New Delhi, India) and submitted to the National Centre for Biotech-nology Information (http://www.ncbi.nlm.nih.gov/nuccore/190335776;Accession No. EU723851). Sequence analysis indicated that p45 is amember of the MAP family and the amplified sequence is a partial codingregion of the native protein. The L. donovani enzyme is approximately99% identical to Leishmania infantum, 97% to L. major, and 96% Leishmaniamexicana. MAP is an essential enzyme that is involved in protein matura-tion and plays a key role in the removal of the initiating methionine res-idue from nascent polypeptide chains. For purification of the over-expressed protein, a single colony of Escherichia coli C41(DE3) cells har-boring the expression construct was inoculated into 5 ml of Luria-Broth(LB) medium with kanamycin (30 lg/ml) and allowed to grow overnightat 37 �C with shaking. The overnight culture was diluted 1:100 with LBand grown at 37 �C until the O.D.600 reached 0.6. Expression was inducedby adding 1 mM of isopropyl-b-D-thio-galactoside (IPTG) and growthcontinued for an additional 4 h. The induced culture was centrifugedand the pellet was resuspended in 4 ml of lysis buffer (20 mM phosphatebuffer, 300 mM NaCl, 10 mM imidazole, pH 8.0) containing 3 mM ofphenylmethylsulphonyl fluoride (Sigma, USA) and 1% Triton X-100, incu-bated for 30 min with 1 mg/ml of lysozyme (Sigma), and sonicated on icefor 10� 30 s bursts (with 30 s intervals between each burst) for 10 min.The lysate was centrifuged at 15,000g for 30 min and loaded on a 2 mlcolumn of Ni–NTA resin previously equilibrated with lysis buffer. The col-umn was washed with a step gradient of imidazole from 10 to 50 mM inlysis buffer and the rLdp45 was eluted with 250 mM of imidazole. Theeluted fractions were analyzed for purity by 12% SDS–PAGE, stained withcoomassie brilliant blue R-250 (Sigma) and the concentration estimatedby the Bradford method using BSA as standard.

In order to raise antibody against rLdp45, rabbits were firstimmunized s.c with 50 lg of purified recombinant protein in FCAfollowed by three booster doses (at 15 day intervals) of recombi-nant protein mixed with Freund’s incomplete adjuvant. The studywith rabbits was approved by the Central Drug Research Institute’s(India) Animal Ethics Committee (Protocol No. 150/09/Para/IAEC)and the animals were housed in a climatically controlled room un-der proper care and maintenance. For immunoblots, whole cell ly-sates of uninduced E. coli cells harbouring plasmid pET28a + p45,induced pET28a + p45, purified recombinant p45 and SLD wereseparated by SDS–PAGE and blotted on polyvinylidene difluoridemembranes. After overnight blocking in 5% BSA, the membranewas incubated with antiserum to recombinant protein at a dilution

Fig. 1. Cloning and expression of p45, a partial coding region of the methionine aminoamplification through PCR using gene-specific primers and then cloned into a pET-28a veL. donovani p45 protein (rLdp45). M: 100 bp ladder; Lane 1: PCR of 1086 bp; Lane 2: PCR wMolecular weight marker; Lane 1: uninduced whole cell lysate of Escherichia coli C41 cellsrLdp45; Lane 4: soluble L. donovani lysate. (C) Reactivity of human sera to rLdp45.leishmaniasis (VL) patient’s sera (n = 5); Lane 2: reactivity of rLdp45 with pooled norma

of 1:5000 for 120 min at room temperature. The membrane wasthen probed with horseradish peroxidase (HRP)-conjugated goatanti-rabbit IgG (Banglore Genei, India). Finally, the blot was devel-oped by using diaminobenzidine, imidazole and H2O2 reagents(Fig. 1B). The raised antibody was also used to detect the reactivitywith human patients’ sera (Fig. 1C). The study was approved by theEthics Committee of the Kala-azar Medical Research Centre, Muz-affarpur, India (Protocol # EC-KAMRC/Vaccine/VL/2007-01) withprior consent of the human subjects. Pooled sera of five infectedVL patients and five normal healthy subjects diluted in blockingbuffer were used as the source of primary antibody. After incuba-tion for 90 min, biotin conjugated mouse anti-human IgG (BDPharmingen, USA) was used as a secondary antibody at a dilutionof 1:1000 for 2 h incubation followed by binding with HRP-conju-gated streptavidin (1:1000 dilution). The blot was developed as de-scribed above.

The lymphocyte transformation test (LTT) is a well establishedin vitro method for investigating antigen-specific cellular immuneresponses. Further, to assess the Th1/Th2 stimulatory potential,the cytokine production was also evaluated. In the absence of cyto-kine reagents for hamsters, a nitric oxide (NO) assay was used toindirectly estimate the IFN-c response, as NO is up-regulated byIFN-c. Characterization of the cellular immune response was firstperformed in cured Leishmania-infected hamsters following theprotocol of Garg et al. (2005) who demonstrated the developmentof a good T cell response when cells from these animals are stim-ulated with different fractions of Leishmania antigen. As it has beenreported that some T cell epitopes that are protective in the murinehost do not elicit an immune response in humans, it was consid-ered important to evaluate this protein for its cellular immune re-sponses in humans. The cellular response of rLdp45 protein wastherefore assessed in both cured hamsters as well as curedpatients.

Golden hamsters (4–6-week-old), were used for experimentswith prior approval of Central Drug Research Institute’s Animal Eth-ics Committee (Protocol No. 154/10/Para/IAEC). All animal care andexperimental use of animals conformed with the Committee for thePurpose of Control and Supervision on Experiments on Animalsguidelines for a laboratory animal facility and every effort was madeto minimize both the number of animals used and their suffering.The L. donovani clinical strain 2001 was cultured in vitro as de-scribed elsewhere (Garg et al., 2005) and was also maintained inhamsters through serial passage, i.e. from amastigote to amastigote.

peptidase gene. Genomic DNA from Leishmania donovani was used as template forctor for over-expression of the recombinant protein. (A) Specific PCR of recombinantithout template. (B) Western blotting with anti-serum to rLdp45 raised in rabbit. M:harbouring 28a + p45 construct; Lane 2: induced whole cell lysate; Lane 3: purified

M: Molecular weight marker; Lane 1: reactivity of rLdp45 with pooled viscerall human sera (n = 5).

R. Gupta et al. / International Journal for Parasitology 42 (2012) 429–435 431

Hamsters infected with L. donovani were treated with 40 mg/kg ofmiltefosine orally for 5 days and verified for cure 30 days later, bysplenic biopsy as described previously (Kushawaha et al., 2011).Mononuclear cells were separated from lymph nodes (inguinaland mesenteric) of individual cured (30–40 days post treatment),infected (day 30 p.i.) and normal hamsters, plated at a density of105 cells/well. The cells were stimulated for 3 days for lipopolysac-charide (LPS) and 5 days for rLdp45 and SLD, at a concentration of10 lg/ml. LPS stimulated and unstimulated cells served as controls.The presence of NO was assessed in the culture supernatants ofcured hamster peritoneal macrophages (Garg et al., 2005) afterexposure to supernatants of stimulated lymphocytes. After 24 h100 ll of supernatant was collected and mixed with an equal vol-ume of Griess reagent (Sigma, USA), and the absorbance determinedat 540 nm. SLD was prepared according to the method describedpreviously (Gupta et al., 2007). A one-way ANOVA statistical testwas used to assess the significance of the differences among variousgroups and a P value of <0.05 was considered significant. SignificantNO production was twofold greater for rLdp45 (32.52 ± 2.86 lM)compared with SLD (13.94 ± 2.12 lM) (P < 0.001).

PBMCs were isolated from heparinized venous blood collectedfrom all study subjects by Ficoll Hypaque density gradient centri-fugation (Histopaque 1077-Sigma, USA) (Kumari et al., 2008a). Serawas separated from the peripheral blood of the donors and storedfrozen at �20 �C until use. The groups for human samples were asfollows:

(i). Seven treated cured patients (four males and three females,aged 5–40 years) from hyper-endemic areas of Bihar, India.All the patients had received a complete course of amphoter-icin B and had recovered from VL. Samples were collectedfrom 2 months to 1 year after the completion of treatment.Diagnosis was established in all cases by demonstration ofparasites in splenic aspirates and found negative at the timeof study.

(ii). Five endemic household contacts (two males and threefemales, aged-15–45 years) who belonged to the family ofinfected/cured patients that neither showed clinical symp-toms nor received any treatment for Kala-azar.

(iii). Five infected patients (three males and two females, aged5–40 years) showing clinical symptoms of Kala-azar andverified by the presence of parasites in the splenic aspirate.

(iv). Five normal healthy donors (three males and two females,aged 25–30 years) from non-endemic areas, without anyhistory of leishmaniasis, served as a negative control.

PBMC suspensions (1� 106 cells/ml) from both patients and ham-sters were cultured in 96-well flat bottomed tissue culture plates. Thisassay was carried out in accordance with the protocol described else-where (Garg et al., 2005) with some modifications. Approximately100 ll of phytohaemagglutinin (PHA) for the patient PBMCs, and Con-cavalin A (Con A) for the hamster lymphocytes, as well as rLdp45 andSLD (10 lg/ml each) were added to triplicate wells. Wells withoutstimulants served as blank controls. Eighteen hours prior to termina-tion of the experiment, 50 ll of XTT (2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) (Roche diagnostics,UK) was added to 100 ll of supernatant from each well and the absor-bance determined at 480 nm using 650 nm as the reference wave-length. Upon stimulation with rLdp45, the cellular responses oflymph node cells from cured hamsters/patients were compared withthose of normal cells as well as infected groups that served as controls.rLdp45 showed a significantly higher proliferative response in cured/normal hamsters (mean O.D. 2.81 ± 0.06 and 0.959 ± 0.053) than in-fected controls (mean O.D. 0.7214 ± 0.035) which was statistically sig-nificant (P < 0.001). The proliferative responses in PBMCs fromendemic and cured patients were relatively higher for PHA with mean

O.D. values (2.59 ± 0.438 and 2.98 ± 0.479, respectively) comparedwith the unstimulated control. rLdp45 showed optimum lymphopro-liferative response in cured (2.77 ± 0.17) as well as endemic contacts(2.27 ± 0.36) which was approximately two times greater than the re-sults for SLD (1.32 ± 0.34 and 1.17 ± 0.22) (Fig. 2A). Thus, the individ-uals in whom the parasitic burden was controlled successfully,either following treatment in the case of patients or due to adequateimmunity as in endemic contacts, exhibited good T cell reactivity torLdp45. In fact, the proliferative responses of these two groups wereobserved to be comparable in our study.

Although lymphocyte proliferation has been widely used toanalyze T cell function, it is established that the CD4+ populationis heterogeneous with regard to the secreted cytokine profile, indi-cating that cytokines should be measured to determine whether animmune response is protective or deleterious. IL-4 and IL-10 areconsidered to promote intracellular infection by disabling Th1-type responses and/or deactivating parasitized tissue macrophageswhereas IL-12, which is produced primarily by phagocytic cells inresponse to infection with intracellular pathogens, can promotethe development of Th1 cells (Heinzel et al., 1993). Once secreted,IL-12 is a strong stimulator of IFN-c production by T and naturalkiller (NK) cells (Holaday et al., 1993; Carvalho et al., 1994). There-fore, for the estimation of cytokines (IFN-c, IL-12, and IL-10) in pa-tients by using commercial ELISA kits (BD Pharmingen, USA), theculture of PBMCs (1 � 106 cells/ml) was set up in 96-well cultureplates and 10 lg/ml of rLdp45 as well as SLD was added in tripli-cate wells. Based on the standard curves generated using recombi-nant cytokines provided in the kit, the results were expressed aspicograms of cytokine/ml. The lower detection limits for cytokineswere: 4.7 pg/ml for IFN-c, 7.8 pg/ml for IL-12p40 and 7.0 pg/ml forIL-10. Each individual donor studied elicited different responses.Significant stimulation (P < 0.01) of IFN-c and IL-12p40 responseswas noticed against rLdp45 in all of the cured/endemic patients.The median level of IFN-c and IL-12p40 in cured patients was856.94 pg/ml (ranging from 515.1 to 1235.1) and 1097.89 pg/ml(ranging from 555.42 to 1769.23), respectively, and in endemiccontacts it was 721.91 pg/ml (ranging from 258.01 to 921.8) and821.58 pg/ml (ranging from 435.79 to 1280.36), respectively(Fig. 2C and D). Upon stimulation with SLD, the levels of IFN-c incured as well as endemic contacts was very similar and recordedas 333.13 and 325 pg/ml. This is lower in comparison with thatof rLdp45 stimulation. Similarly, the IL-12p40 level in cured(396.7 pg/ml) as well as endemic contacts (396.8 pg/ml) inresponse to SLD was inferior to rLdp45 stimulation. In addition,no detectable amount of IFN-c and IL-12p40 was observed inlymphocytes of L. donovani-infected patients and healthy individu-als against rLdp45. IL-10 cytokine levels in response to rLdp45(Fig. 2B) was relatively low in cured (28.07 pg/ml ranging from13.68 to 57.46) as well as in endemic contacts (28.51 pg/ml rang-ing from 12.27 to 43.23) which, however, was found to be in-creased in all the infected patients (163.1–178.8 pg/ml)compared with cured/endemic as well as healthy (2.6–9.2 pg/ml)individuals (data not shown). In contrast, the IL-10 level, in re-sponse to SLD stimulation, was increased to approximately349.6 pg/ml (ranging from 190–550 pg/ml) in all five infected pa-tients. On the other hand the level of the cytokine was lower inboth the cured (95.9 pg/ml) as well as endemic (54.77 pg/ml) sub-jects but higher compared with rLdp45 stimulation. Thus, PBMCsof cured/endemic contacts generated a mixed Th1/Th2 cytokineprofile against SLD wherein high levels of IL-10 and very low levelsof IFN-c and IL-12p40 were detected, while stimulation withrLdp45 shifted the response exclusively to the Th1 type with theproduction of high amounts of IFN-c and IL-12. The level of IL-10, a Th1 deactivating cytokine, was found to be suppressed incured patients as well as in endemic contacts and with a relativelylow level (compared with SLD) in active cases. These findings indi-

Fig. 2. In vitro cellular responses in peripheral blood mononuclear cells (PBMCs) of cured patients. (A) Lymphocyte transformation test (LTT) response in endemic (END.),infected (PAT.) and cured (CUR.) patients’ PBMCs against phyohaemaglutinin (PHA), soluble Leishmani donovani lysate (SLD) and rLdp45 at 10 lg/ml each. Proliferation wasrepresented as a mean O.D. of stimulated culture – mean O.D. of unstimulated control. Each bar represents the pooled data (mean ± S.D. value) of six individuals and the datarepresent the means of triplicate wells ± the S.D. Cytokine production of IL-10 (B), IFN-c (C) and IL-12 (D) in stimulated PBMCs from cured visceral leishmaniasis (VL) patients(n = 7) and endemic controls (n = 5) in response to SLD and rLdp45 antigens. Each data point represents one individual (n.d. = not detected). Values are given as concentrationsof respective cytokines in pg/ml. Cytokine production was tested in triplicate in two independent experiments and the results were comparable. The mean concentration ofcytokine for each group is indicated by the horizontal bars. Significance values indicate the difference between the SLD and rLdp45 stimulations (⁄P < 0.05; ⁄⁄P < 0.01 and⁄⁄⁄P < 0.001).

432 R. Gupta et al. / International Journal for Parasitology 42 (2012) 429–435

cate a clear-cut and specific up-regulation of Th1 stimulatory re-sponses in cured patients with parallel down-regulation of Th2stimulatory responses. The presence of a positive immune re-sponse in endemic contacts suggests that the frequency of subclin-ical infection in an endemic area such as Bihar is high, as has beenreported in other areas of the world (Costa et al., 1999; Sassi et al.,1999; Tripathi et al., 2006).

Based on its immunostimulatory properties, p45 was furtherevaluated for its immunoprophylactic potential in hamsters. Forimmunization studies, four groups of hamsters (12–15 per group),were used, wherein groups 1–3 served as controls as described be-low and group 4 served as the main experimental group: group 1,unvaccinated and unchallenged (normal control); group 2, unvacci-nated and challenged (infected control); group 3, Bacillus CalmetteGuerin (BCG) alone; and group 4, vaccinated with rLdp45 + BCG(vaccinated group). The hamsters of group 4 were immunized intra-dermally (i.d) on the back with rLdp45 (50 lg/50 ll per animal) to-gether with an equal volume of BCG (100 ll per animal) inemulsified form and group 3 was given BCG only. Fifteen days latera booster dose of half of the amount of rLdp45 together with BCGwas given i.d to all the hamsters of group 4 and only BCG to group3. Groups 2–4 were challenged intracardially with 107 metacyclicpromastigotes of L. donovani 21 days later. BCG was used here asadjuvant (Khalil et al., 2000; Misra et al., 2001) since it has been re-ported that it activates macrophages inducing NO (MacMickinget al., 1997; Nozaki et al., 1997) and elicits long-lasting cellularand humoral immune responses (Warren et al., 1986).

On days 45, 60, 90 and 120 post challenge (p.c.), 3–4 animalsfrom each group were sacrificed and the weights of the body, liver

and spleen were recorded. Blood was collected for sera and lymphnodes were removed for various immunological assays. Dabsmears of liver and spleen were prepared and examined micro-scopically to estimate parasite burden which was calculated asthe number of amastigotes per 1000 nuclei (Singh et al., 2009).Animals of all groups were given proper care and observed for theirsurvival period. The vaccinated hamsters gained substantialweight, similar to normal ones compared with control animals,when observed simultaneously for the same time period, i.e. ondays 45, 60, 90, 120 and 180 p.c. A substantial reduction in parasiteload (P < 0.001; �85%) was observed in spleen, liver and bone mar-row of rLdp45 + BCG vaccinated animals on day 90 p.c. which waswell supported by their survival rate (8–10 months p.i.) comparedwith the hamsters immunized with BCG alone as well as the unim-munized ones (2–3 months) wherein progressive increases in par-asite load were observed (Fig. 3A–C).

Successful vaccination of humans and animals is often relatedto antigen induced delayed type hypersensitivity (DTH) responsesin vivo which are characterized by activation and recruitment pre-dominantly of T-cells and macrophages at the site of i.d injection ina previously sensitized host (Khabiri et al., 2006, 2007). DTH wasperformed by injecting 50 lg/50 ll of SLD in PBS i.d into one hindfootpad and PBS alone into the other one of the vaccinated andunvaccinated controls. The response was evaluated 48 h later bymeasuring the difference in footpad swelling between the twowith and without SLD for each animal (Kumari et al., 2008b). Aconsiderable DTH response was observed in vaccinated hamsterscompared with the other control groups as is evident in Fig. 3D.Con A induced a lymphoproliferative response in vaccinated ani-

Fig. 3. Leishmania parasite burden (number. of amastigotes per 100 cell nuclei) in the dab smears of spleen (A), liver (B) and bone marrow (C) of hamsters on days 45, 60, 90,and 120 post challenge (p.c.) Since the non-vaccinated challenged (Infected control) and the Bacillus Calmette Guerin (BCG) vaccinated and challenged group died after day90 (D 90) of the study period, their corresponding bars are not depicted in A, B and C. Delayed Type Hypersensitivity response (mm) to soluble Leishmania donovani lysate(SLD) as footpad swelling on days 45, 60 and 90 p.c. (D); Lymphoproliferative response (E) and nitric oxide (NO) production (F) following recombinant L. donovani p45(rLdp45) stimulation in vaccinated hamsters compared with unimmunized infected hamsters on days 45, 60 and 90 p.c. At designated time points after infection,lymphocytes (from lymph nodes) derived from different groups were stimulated with rLdp45 (10 lg/ml) for 5 days, and 18 h prior to termination of experiment 50 ll of XTT(2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) was added and the absorbance was read at 480 nm, taking 650 nm as a reference wavelength.The level of nitrite in the culture supernatants was assessed using Griess reagent. Results are means and S.E. for 3–4 hamsters per group done in duplicate and arerepresentative of two independent experiments with similar results. Significance values indicate the difference between the vaccinated group and infected group (⁄P < 0.05;⁄⁄P < 0.01 and ⁄⁄⁄P < 0.001).

R. Gupta et al. / International Journal for Parasitology 42 (2012) 429–435 433

mals which was similar to that observed in normal ones through-out the entire p.c. period (days 45, 60 and 90 p.c.) whereas it waslower in other control groups. In antigen-specific re-stimulationassays, there was significant (P < 0.001) stimulatory response inthe cells of vaccinated hamsters compared with the animals vacci-nated with BCG alone as well as unvaccinated infected controls(Fig. 3E) wherein a lesser proliferative response was observed.

However, it is not LTT itself that is behind the primary effectormechanism of immunity, but rather the stimulation of Leish-mania-specific T-cells to produce NO which assists in activatingmacrophages to kill the intracellular parasites. The supernatant of

rLdp45-stimulated lymphocytes from vaccinated hamsters pro-duced remarkable levels of NO (�3-fold) which also supports theview regarding the up-regulation of inducible nitric oxide synthase(iNOS) by Th1 cell-associated cytokines. Macrophages isolated fromnaïve hamsters, when incubated with stimulated supernatants oflymphocytes from rLdp45 + BCG vaccinated hamsters, producedmore significant (P < 0.001) amounts of NO (22.52 ± 0.79 lM) thanother control groups (7.5–8.2 lM values) on day 45 p.c. which fur-ther increased by days 60 and 90 p.c. (Fig. 3F). We also studied theimmune response generated in vaccinated hamsters wherein weused real-time quantitative PCR (RTqPCR) to assess the expression

Fig. 4. Splenic inducible nitric acid synthase (iNOS) and cytokine mRNA expression profile analysis of normal, infected and vaccinated hamsters (n = 3–4) on days 45 and 60post challenge (p.c.) by real-time quantitative PCR (RTq-PCR). Data are presented as mean ± S.E. and are representative of two independent experiments with similar results.Significance values indicate the difference between the vaccinated group and infected group (⁄P < 0.05; ⁄⁄P < 0.01 and ⁄⁄⁄P < 0.001).

434 R. Gupta et al. / International Journal for Parasitology 42 (2012) 429–435

of mRNAs for various cytokines and iNOS in splenic cells due tounavailability of commercial reagents for hamsters. Total RNA fromsplenic tissues was isolated using Tri-reagent (Sigma) and cDNAwas synthesized using a first-strand cDNA synthesis kit (Fermentas,Canada). The primers for RTqPCR, were designed using Beacon De-signer software (Bio-Rad, USA) on the basis of cytokines and iNOS

mRNA sequences available on PubMed (Melby et al., 2001) andare described elsewhere (Samant et al., 2009). Real-time PCR wasperformed as described earlier (Samant et al., 2009) using SYBRgreen PCR master mix (Bio-Rad, USA) on an iQ5 multicolor real-timePCR system (Bio-Rad). cDNAs from infected hamsters were used as‘‘comparator samples’’ and housekeeping gene HPRT was used for

R. Gupta et al. / International Journal for Parasitology 42 (2012) 429–435 435

normalization. A ‘‘no-template’’ control was included to eliminatecontamination or non-specific reactions. Differences in geneexpression were calculated by the comparative CT method (Samantet al., 2009) and results are expressed as the degrees of differencebetween DCt values of test and comparator samples. The mRNAexpression of Th1 and Th2 cytokines i.e. IFN-c, TNF-a, IL-12, TGF-b, IL-4, IL-10 and iNOS in hamsters of the rLdp45 + BCG vaccinatedgroup was evaluated on days 45 and 60 p.c. and compared with ani-mals infected with L. donovani as well as normal control groups. Anenhanced expression of Th1 type cytokines was observed on days 45and 60 when a significant increase in the level of IL-12 was observedat both time points (DCt value 39.71 ± 5.88 on day 45 as well as28.45 ± 6.86 on day 60 p.c) compared with the infected controls(DCt value 5.47 ± 0.84 and 11.16 ± 1.18). The expression levels ofiNOS and IFN-c mRNA transcripts increased significantly on day45 (P < 0.05) followed by a progressive increase on day 60 p.c(P < 0.01 for iNOS and P < 0.001 for IFN-c). TNF-a expression wassignificant at both time points (P < 0.05). It is well established thatrecovery from Leishmania infection relies on induction of the Th1 re-sponse with production of IFN-c and IL-12 and enhanced expressionof NO synthase. Extreme down-regulation in the expression levelsof Th2 type cytokines was observed with TGF-b and IL-4 expressionsignificantly down-regulated (P < 0.001) in the vaccinated groupcompared with the infected ones at day 45 p.c. (Fig. 4). However,the expression of IL-10 was not significant at all. High levels of IL-10, a major macrophage deactivating cytokine, is observed duringactive VL and is believed to favor parasite persistence. Our resultsare consistent with studies of Bhowmick et al. (2009) in which thecontrol of disease progression and parasite burden in vaccinatedmice was associated with augmentation of antigen-specific IFN-cproduction and down-regulation of IL-4, demonstrating a Th1 bias.

To our knowledge, this is the first report of molecular andimmunological characterization, together with prophylactic poten-tial, of rLdp45. This protein induced significantly higher cellular re-sponses such as LTT as well as NO release in vitro against curedhamsters together with analogous results, i.e. lymphocyte prolifer-ation and release of surplus amounts of Th1-type cytokines such asIFN-c and IL-12p40 in endemic/cured VL patients comparison withSLD. Further assessment of its prophylactic potential in hamstersupon challenge with a lethal dose of Leishmania revealed optimumprotection which was clearly associated predominantly with aTh1-type cytokine response, as indicated by the up-regulation ofiNOS, IFN-c, and IL-12, together with simultaneous down-regula-tion of TGF-b and IL-4. Moreover, interestingly, the vaccinated ani-mals survived for more than 10 months of observation, indicatingthe strong vaccine potential of this novel protein.

Acknowledgements

We thank the Director, Central Drug Research Institute (CDRI),India, for his keen interest and for providing facilities for the exper-iments. RG and PKK acknowledge research fellowship from Univer-sity Grants Commission (UGC), India. This report bears CDRICommunication No. 8215.

References

Bhowmick, S., Mazumdar, T., Ali, N., 2009. Vaccination route that inducestransforming growth factor beta production fails to elicit protective immunityagainst Leishmania donovani infection. Infect. Immun. 77, 1514–1523.

Carvalho, E.M., Bacellar, O., Brownell, C., Regis, T., Coffman, R.L., Reed, S.G., 1994.Restoration of IFN-gamma production and lymphocyte proliferation in visceralleishmaniasis. J. Immunol. 152, 5949–5956.

Costa, S.R., D’Oliveira Jr., A., Bacellar, O., Carvalho, E.M., 1999. T cell response ofasymptomatic Leishmania chagasi infected subjects to recombinant leishmaniaantigens. Mem. Inst. Oswaldo Cruz 94, 367–370.

Garg, R., Gupta, S.K., Tripathi, P., Naik, S., Sundar, S., Dube, A., 2005.Immunostimulatory cellular responses of cured Leishmania infected patientsand hamsters against the integral membrane proteins and non-membranoussoluble proteins of a recent clinical isolate of Leishmania donovani. Clin. Exp.Immunol. 140, 149–156.

Gupta, S.K., Sisodia, B.S., Sinha, S., Hajela, K., Naik, S., Shasany, A.K., Dube, A., 2007.Proteomic approach for identification and characterization of novelimmunostimulatory proteins from soluble antigens of Leishmania donovanipromastigotes. Proteomics 7, 816–823.

Heinzel, F.P., Schoenhaut, D.S., Rerko, R.M., Rosser, L.E., Gately, M.K., 1993.Recombinant interleukin 12 cures mice infected with Leishmania major. J. Exp.Med. 177, 1505–1509.

Holaday, B.J., Pompeu, M.M., Jeronimo, S., Texeira, M.J., Sousa Ade, A., Vasconcelos,A.W., Pearson, R.D., Abrams, J.S., Locksley, R.M., 1993. Potential role forinterleukin-10 in the immunosuppression associated with kala azar. J. Clin.Invest. 92, 2626–2632.

Khabiri, A.R., Bagheri, F., Assmar, M., 2006. Leishmania major: species specificdelayed hypersensitivity reaction induced by exogenous secreted antigen in theguinea pig. Exp. Parasitol. 112, 184–186.

Khabiri, A.R., Bagheri, F., Assmar, M., 2007. Leishmania major: common antigenresponsible for induction of delayed-type hypersensitivity response in guineapigs. Parasitol. Res. 100, 629–632.

Khalil, E.A., El Hassan, A.M., Zijlstra, E.E., Mukhtar, M.M., Ghalib, H.W., Musa, B.,Ibrahim, M.E., Kamil, A.A., Elsheikh, M., Babiker, A., Modabber, F., 2000.Autoclaved Leishmania major vaccine for prevention of visceral leishmaniasis:a randomised, double-blind, BCG-controlled trial in Sudan. Lancet 356, 1565–1569.

Kumari, S., Samant, M., Khare, P., Sundar, S., Sinha, S., Dube, A., 2008a. Induction ofTh1-type cellular responses in cured/exposed Leishmania-infected patients andhamsters against polyproteins of soluble Leishmania donovani promastigotesranging from 89.9 to 97.1 kDa. Vaccine 26, 4813–4818.

Kumari, S., Samant, M., Misra, P., Khare, P., Sisodia, B., Shasany, A.K., Dube, A., 2008b.Th1-stimulatory polyproteins of soluble Leishmania donovani promastigotesranging from 89.9 to 97.1 kDa offers long-lasting protection againstexperimental visceral leishmaniasis. Vaccine 26, 5700–5711.

Kushawaha, P.K., Gupta, R., Sundar, S., Sahasrabuddhe, A.A., Dube, A., 2011.Elongation factor-2, a Th1 stimulatory protein of Leishmania donovani,generates strong IFN-gamma and IL-12 response in cured Leishmania-infectedpatients/hamsters and protects hamsters against Leishmania challenge. J.Immunol. 187, 6417–6427.

MacMicking, J., Xie, Q.W., Nathan, C., 1997. Nitric oxide and macrophage function.Annu. Rev. Immunol. 15, 323–350.

Melby, P.C., Chandrasekar, B., Zhao, W., Coe, J.E., 2001. The hamster as a model ofhuman visceral leishmaniasis: progressive disease and impaired generation ofnitric oxide in the face of a prominent Th1-like cytokine response. J. Immunol.166, 1912–1920.

Misra, A., Dube, A., Srivastava, B., Sharma, P., Srivastava, J.K., Katiyar, J.C., Naik, S.,2001. Successful vaccination against Leishmania donovani infection in Indianlangur using alum-precipitated autoclaved Leishmania major with BCG. Vaccine19, 3485–3492.

Nozaki, Y., Hasegawa, Y., Ichiyama, S., Nakashima, I., Shimokata, K., 1997.Mechanism of nitric oxide-dependent killing of Mycobacterium bovis BCG inhuman alveolar macrophages. Infect. Immun. 65, 3644–3647.

Probst, P., Stromberg, E., Ghalib, H.W., Mozel, M., Badaro, R., Reed, S.G., Webb, J.R.,2001. Identification and characterization of T cell-stimulating antigens fromLeishmania by CD4 T cell expression cloning. J. Immunol. 166, 498–505.

Samant, M., Gupta, R., Kumari, S., Misra, P., Khare, P., Kushawaha, P.K.,Sahasrabuddhe, A.A., Dube, A., 2009. Immunization with the DNA-encodingN-terminal domain of proteophosphoglycan of Leishmania donovani generatesTh1-Type immunoprotective response against experimental visceralleishmaniasis. J. Immunol. 183, 470–479.

Sassi, A., Louzir, H., Ben Salah, A., Mokni, M., Ben Osman, A., Dellagi, K., 1999.Leishmanin skin test lymphoproliferative responses and cytokine productionafter symptomatic or asymptomatic Leishmania major infection in Tunisia. Clin.Exp. Immunol. 116, 127–132.

Singh, N., Gupta, R., Jaiswal, A.K., Sundar, S., Dube, A., 2009. Transgenic Leishmaniadonovani clinical isolates expressing green fluorescent protein constitutively forrapid and reliable ex vivo drug screening. J. Antimicrob. Chemother. 64 (2),370–374.

Tripathi, P., Ray, S., Sunder, S., Dube, A., Naik, S., 2006. Identification of Leishmaniadonovani antigens stimulating cellular immune responses in exposed immuneindividuals. Clin. Exp. Immunol. 143, 380–388.

Warren, H.S., Vogel, F.R., Chedid, L.A., 1986. Current status of immunologicaladjuvants. Annu. Rev. Immunol. 4, 369–388.