1

A new virulent phage infecting Lactococcus garvieae, with homology 1

to Lactococcus lactis phages 2

3

Giovanni Eraclio1, Denise M. Tremblay2, Alexia Lacelle-Côté2,3, Simon J. Labrie2,3, 4

Maria Grazia Fortina1 and Sylvain Moineau2,3* 5

6

1 Department of Food, Environmental and Nutritional Sciences, Division of Food Microbiology 7

and Bioprocesses, University of Milan, Via Celoria 2, 20133 Milan, Italy 8

9

2 Félix d’Hérelle Reference Center for Bacterial Viruses & GREB, Faculté de Médecine Dentaire, 10

Université Laval, Québec City, Québec, Canada, G1V 0A6 11

12

3 Département de biochimie, de microbiologie et de bio-informatique & PROTEO, Faculté des 13

sciences et de génie, Université Laval, Québec City, Québec, Canada, G1V 0A6 14

15

16

* Corresponding author. Mailing address: Département de biochimie, de microbiologie et de bio-17

informatique, Faculté des sciences et de génie, Université Laval, Québec City, Québec, Canada, 18

G1V 0A6. Phone: 418-656-3712. Fax: 418-656-2861. E-mail: Sylvain.Moineau@bcm.ulaval.ca19

AEM Accepted Manuscript Posted Online 25 September 2015Appl. Environ. Microbiol. doi:10.1128/AEM.02603-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

2

ABSTRACT 20

21

A new virulent phage belonging to the Siphoviridae family and able to infect Lactococcus 22

garvieae strains was isolated from compost soil. Phage GE1 has a prolate capsid (56 x 38nm) and 23

a long non-contractile tail (123 nm). It had a burst size of 139 and a latent period of 31 min. Its 24

host range was limited to only two L. garvieae strains out of 73 tested. Phage GE1 has a double-25

stranded DNA genome of 24,478 bp containing 48 predicted open reading frames (orfs). Putative 26

functions could be assigned to only 14 ORFs and significant matches in public databases were 27

found for only 17 ORFs, indicating that GE1 is a novel phage and its genome encodes several 28

new viral genes/proteins. Of these 17 ORFs, 16 were homologous to deduced proteins of virulent 29

phages infecting the dairy bacterium Lactococcus lactis, including previously characterized 30

prolate-headed phages. Comparative genome analysis confirmed the relatedness of L. garvieae 31

phage GE1 to L. lactis phages c2 (22,172 bp) and Q54 (26,537 bp), although its genome 32

organization was closer to that of phage c2. Phage GE1 did not infect any of the 58 L. lactis 33

strains tested. This study suggests that phages infecting different lactococcal species may have a 34

common ancestor. 35

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

3

INTRODUCTION 36

Lactococcus garvieae is the etiological agent of lactococcosis, a pathology affecting a 37

variety of fish species responsible for significant economic losses both in marine and freshwater 38

aquacultures (1). In addition, L. garvieae has been associated with subclinical intramammary 39

infections in cows (2). More recently, L. garvieae was associated with infections in humans and 40

is now considered an opportunistic and potentially zoonotic pathogen (3, 4). In an effort to find 41

its ecological niches, genetic investigations have revealed its presence, and sometimes 42

dominance, in several habitats: river and sewage waters, raw and processed foods including milk, 43

meats, and vegetables (5–7). 44

Despite growing attention, genomic characterization of L. garvieae progresses slowly, yet 45

the evolutionary history and global diversity of this emerging pathogen is particularly interesting. 46

The population structure and diversity of L. garvieae strains have been studied using comparative 47

genome analysis, which led to the development of an MLST scheme to identify specific strains 48

(8). These studies also revealed that L. garvieae is related to Lactococcus lactis, a non-pathogenic 49

bacterium used for the manufacture of several fermented dairy products (9). Divergent genomic 50

lineages were observed, with some ecotypes representing evolutionary intermediates between L. 51

lactis and L. garvieae (8). The presence of insertion sequences (IS) was also highly variable 52

among L. garvieae strains (10). Analysis of these IS sequences within individual genomes 53

revealed limited intra-genomic sequence diversity, suggesting that many ISs in L. garvieae are 54

evolutionarily young and may have been only recently acquired. Of note, the similarity of most L. 55

garvieae ISs to L. lactis ISs suggests possible genetic exchange between these two species. 56

Little is known about the presence of other mobile genetic elements such as phages in L. 57

garvieae. Phages are usually found in the same niches as their bacterial hosts and can have two 58

main life cycles, lytic or lysogenic. During the lytic cycle, the phage redirects the host 59

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

4

metabolism to produce new virions, resulting in host cell lysis and the release of numerous 60

virulent phages that can infect other targeted cells. During the lysogenic cycle, the phage genome 61

integrates into the host genome, remains in the host as a prophage, and replicates along with the 62

host genome, until the lytic cycle is induced by stress factors. Phages play key roles in bacterial 63

evolution, influencing the dynamics of bacterial populations and their adaptability through gene 64

exchange (11, 12). 65

The emergence of multi-drug-resistant bacteria has sparked renewed interest in virulent 66

phages for potential use in therapy or in sanitation strategies in the agricultural, food-processing 67

and fishing industries as well as in humans and animals (13, 14). However, phages can also 68

destroy bacteria that play key roles in production or fermentation processes, particularly in the 69

food and biotechnology industries (15, 16). 70

Very few lytic phages of L. garvieae have been identified to date (17–19). One L. 71

garvieae phage belonging to the Siphoviridae family (dsDNA genome, long non-contractile tail) 72

was investigated for controlling L. garvieae infections in fish (19). To our knowledge, only one 73

L. garvieae virulent phage has been investigated at the genomic level (20). L. garvieae phage 74

WP-2 belongs to the Podoviridae family (dsDNA genome, short non-contractile tail) of the order 75

Caudovirales (12). It was classified as a member of the Ahjdlikevirus in the Picovirinae 76

subfamily because it has a small genome (18,899 bp, 24 orfs) and a protein-primed DNA 77

polymerase (20). 78

Here, we report the molecular characterization of the novel L. garvieae phage, GE1. This 79

virulent phage was isolated from a Canadian compost soil in 2014 and belongs to the 80

Siphoviridae family. Comparative genome analyses suggest that this new siphophage is related to 81

virulent phages infecting L. lactis. 82

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

5

MATERIALS AND METHODS 83

Bacterial host and phage isolation. A total of 73 L. garvieae strains previously isolated from 84

different ecological niches (fish and dairy farms, vegetables, meat and cereals) (21) and 58 85

industrial L. lactis strains were used to determine the host range of the phage. Lactococcal strains 86

were grown statically at 30°C in M17 broth (Oxoid) supplemented with 0.5% glucose (GM17). 87

We tested Canadian samples of raw milk, wastewater, soil compost, and aquaculture water to 88

isolate phages infecting L. garvieae. The soil compost from which we isolated phage GE1 was 89

made from green waste (domestic compost) obtained from the Compo-Recycle Center at 90

Chertsey (Québec, Canada) and the samples used for phage isolation were taken from the top. 91

All samples were kept at 4°C until used and the same phage isolation protocol was used 92

(22). Five ml of each environmental sample (for the solid compost soil 5 g were resuspended in 5 93

ml of sterile water) were added to 5 ml of double strength GM17 supplemented with 10 mM 94

CaCl2, and inoculated with 100 µL of an overnight culture of an L. garvieae strain. Nineteen 95

representative strains of previously studied L. garvieae (8) were used for lytic phage isolation. 96

The mixtures were incubated overnight at 30°C. The cultures were centrifuged at 7,000 rpm for 97

10 min using an IEC Clinical Centrifuge (USA) and the supernatants were filtered (0.45 µm 98

cellulose acetate filter). Five ml of the filtered supernatant were added to double strength GM17 99

inoculated as above. This second amplification procedure was repeated three more times. The 100

presence of phages in the supernatants was tested by spot test, depositing 5 µL of the last 101

amplification on a GM17 plate with 10 mM CaCl2 containing a single L. garvieae strain. Clear 102

plaques were picked, purified three times, and amplified as described (23). To obtain 103

concentrated phage preparations, 1 L of lysate was mixed with polyethylene glycol 8000 (10%) 104

and separated on a discontinuous CsCl gradient followed by a continuous CsCl gradient, as 105

previously reported (24). 106

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

6

Microbiological assays. The host range of phage GE1 was assessed by spotting 5 µL of a 10-2 107

dilution of a phage lysate on top agar containing one lactococcal strain. One-step growth assays 108

were performed in triplicate with a multiplicity of infection (MOI) of 0.05 and the host strain L. 109

garvieae INS1 (21). The burst size was calculated by dividing the average phage titer after the 110

exponential phase by average titer before the infected cells began to release virions (25). 111

112

Electron microscopy. Ten µl of uranyl-acetate (2%) was deposited on a Formvar carbon-coated 113

grid (200 mesh; Pelco International). Cesium chloride-purified phages (10 µL) were mixed with 114

the stain by pipetting up and down. After 2 min, the grid was deposited on blotting paper and 115

dried for at least 5 minutes. Phages were observed at 80 kV using a JEOL1230 transmission 116

electron microscope at the Plateforme d'Imagerie Moléculaire et Microscopie of the Université 117

Laval. Capsid size and tail length were determined by measuring at least 10 phage specimens. 118

119

Phage DNA extraction, sequencing, and genome analysis. Phage DNA was extracted from 500 120

ml of lysate using the Qiagen Lambda Maxi DNA purification kit with modifications as 121

described previously (26). To determine the genome sequence of phage GE1, a sequencing 122

library was first prepared with the Nextera XT DNA Sample Prep Kit (Illumina) according to the 123

manufacturer’s instructions. The library was sequenced using a MiSeq Reagent Kit v2 on a 124

MiSeq system (Illumina). De novo assembly was performed with Ray assembler (27). Genome 125

extremities were amplified using converging primers, and the PCR product was sequenced with 126

an ABI 3730xl at the sequencing platform of the Centre Hospitalier de l’Université Laval. The 127

cos site was also confirmed by direct sequencing of the phage DNA using forward (5’-128

GCAAGGAGGTAATCAGATGCA-3’) and reverse (5’-GAACGCATTCTGTGAGCTTG-3’) 129

primers. 130

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

7

Open reading frame (ORF) prediction was carried out using ORF Finder 131

(http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and RAST Server (28). An ORF was considered 132

valid only if its starting codon was AUG, UUG or GUG and it was at least 30 amino acids (aa) in 133

length. Ribosomal binding sites (RBS) were also identified. Functions and domains were 134

attributed by comparison of the translated products using BLASTp (29). PSI-BLAST and 135

InterProScan (http://www.ebi.ac.uk/) were used to search for more distant homologous proteins 136

and conserved domains, respectively, when significant similarity was found by BLAST searches. 137

Theoretical molecular masses (MM) and isoelectric points (pI) of the phage proteins were 138

obtained using ProtParam (http://web.expasy.org/protparam/). tRNAs were identified using the 139

tRNAscan-SE server (30) and confirmed using ARAGORN (31). Virulence Factor Databases 140

(32) together with DBETH (33) were used to identify virulence factors. 141

142

Structural protein profile. Purified GE1 and c2 phages (~1011 PFU/mL) were dialyzed (0.02 M 143

Tris-HCl pH 7.4, 0.1 M NaCl, 0.1 M MgSO4), mixed with 4X loading buffer (0.25 M Tris-HCl 144

pH 6.8, 40% [vol/vol] glycerol, 8% [wt/vol] SDS, 20% [vol/vol] β-mercaptoethanol, and 0.1% 145

[wt/vol] bromophenol blue), and boiled for 5 min. Proteins were separated on an Any kD™ Mini-146

PROTEAN® TGX™ Precast Protein Gel (Bio-Rad) and stained with Coomassie blue. 147

148

Proteomic tree design. The predicted proteome of L. garvieae phage GE1 was compared with 149

other lactococcal phage proteomes, including the L. garvieae phage WP-2 (20) and members of 150

the 10 L. lactis phage groups (34). The genomes were downloaded from NCBI and the proteins 151

were extracted using the published annotations. The terminase was used as the starting point to 152

generate a long phage protein concatemer for each phage (35 phages in total). The order of the 153

proteins was identical to the gene order presented in the genome. For the two L. lactis phage 154

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

8

genomes (KSY1 and P087) in which a terminase was not found, the protein concatemers were 155

constructed following the gene order as deposited in GenBank. MEGA 5 (35) software and a 156

BLOSUM matrix were used for multiple alignments. An unrooted phylogenetic tree was 157

constructed using the neighbor-joining algorithm (36). The phylogeny was tested with 100 158

bootstraps replicates. 159

160

Accession number. The annotated genomic sequence of phage GE1 was deposited in GenBank 161

under accession number KT339177. 162

163

RESULTS 164

165

Characterization of phage GE1. L. garvieae phage GE1, a virulent phage isolated from a 166

compost soil sample, belongs to the Siphoviridae family (Fig. 1). It has a prolate capsid of 56 nm 167

± 3 nm by 38 nm ± 3 nm and a non-contractile tail of 123 nm ± 12 nm in length and 11 nm ± 2 168

nm in width. The phage morphology is highly reminiscent of phages c2 and Q54, members of 169

two distinct L. lactis phage groups that bear their names (34). However, the tail length of phage 170

GE1 is slightly longer (34). 171

The burst size of phage GE1 was calculated to be 139 ± 13virions per infected cell and its 172

latency period was 31 ± 4 min, similar to other lactococcal phages (36). The host range of phage 173

GE1 was assessed using a collection of 73 L. garvieae strains and 58 industrial L. lactis strains. 174

Phage GE1 was highly specific as it infected only two L. garvieae strains, its host INS1, as well 175

as strain INS2, which was isolated from a similar ecological niche (vegetables) (21). Phage GE1 176

did not infect any of the 58 L. lactis strains tested. 177

178

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

9

Genome of phage GE1 and its cos site. Phage GE1 has a 24,847 bp linear double-stranded 179

DNA genome with a GC content of 37.8%, similar to the GC content of its host genome (8) but 180

slightly higher than that of L. lactis phage genomes (35%) (36). Analysis of the phage GE1 181

genome did not identify any tRNA or recognizable virulence factors. The genome has cohesive 182

ends consisting of single-stranded 9-bp 3’ overhangs (Fig. 2a). Analysis of the DNA region 183

surrounding the cos site revealed characteristics similar to L. lactis phages belonging to the c2 184

group (37). This region is characterized by inverted repeat sequences as well as 22 direct repeats. 185

Overall, this region is AT-rich (69%) compared to the rest of the GE1 genome (62%). Three G 186

boxes and no C clusters were found near the cos site (Fig. 2a). 187

The inverted repeat found in the cos site of phage GE1 (GCAA) lacks a conserved T in 188

one of the consensus sequences (TCAN(N4-7)NACT), typically found within a 15-bp segment 189

spanning the cos site of many L. lactis phages (38). The absence of this conserved base in the 190

consensus cos site is reminiscent of the cos site of lactococcal phage Q54, which has a CCAA 191

inverted repeat. 192

The cos region of GE1 also contains five λ-like R consensus sequences, which are usually 193

involved in terminase recognition and binding, as well as in packaging termination (39). The 194

sequences were compared with those previously reported for L. lactis phages c2, bIL67 (c2-like), 195

and Q54. As reported for phage Q54 (37), phage GE1’s five λ-R sequences are unevenly 196

distributed, but across a smaller genomic region (500 bp compared to 900 bp of phage Q54). This 197

contrast with coliphage λ and lactococcal phage c2 whose λ-R sequences are regularly spaced. 198

Alignment analysis of the R sites from GE1 (Fig. 2b) found bases in common involved in the 199

packaging process, similar to those observed for c2 and Q54. 200

201

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

10

Analysis of phage GE1 genes. A total of 48orfs longer than 30 codons were predicted from the 202

genome sequence (Table 1). The size of the gene products range from 44 (ORF17 and ORF26) to 203

839 amino acids (ORF37), with an average predicted protein size of 153 amino acids. Coding 204

regions represent approximately 88% of the genome and the longest non-coding region is 657 bp, 205

occurring between orf27 and orf28. As for c2-like lactococcal phages, the GE1 genome is 206

organized in two main gene clusters, grouping the presumed early- and late-expressed genes (40, 207

41). The late-expressed genes code for proteins involved in packaging (orf40), cell lysis (orf29 208

and orf38) and phage morphology (orf32, orf34, and orf37). No lysogeny module was found in 209

the genome, confirming the lytic nature of phage GE1. 210

Seven orfs (1, 11, 14, 20, 24, 27, and 28) possess a typical RBS domain (AGGAGA). Of 211

these, orf27 and orf28 are located at the ends of the 657-bp intergenic region between early- and 212

late-expressed genes. Moreover, orf27 (early gene) is also preceded by the consensus -10 and -35 213

promoter sequences (TTGACA-17 bp-TATAAT), whereas upstream of orf28 (late gene) only a-214

10 consensus sequence was found. These characteristics suggest that the region between orf27 215

and orf28 could act as an origin of replication, as already reported for phage c2 (42). 216

217

Proteome of phage GE1. The functions of phage GE1 deduced proteins were determined by 218

comparing (BLASTp) with the GenBank database. When low similarity was found between GE1 219

proteins and other phage proteins, putative functions were reinforced by identifying conserved 220

domains and/or position-specific iterative comparisons. Only ORFs with a significant protein hit 221

in GenBank are presented in Table 1. Predicted functions were attributed to 14 ORFs (out of 48 222

ORFs, 29%) and only 17 ORFs (35%) matched proteins in the GenBank database, indicating that 223

new viral genes/proteins were identified by characterizing this novel phage. Details are given 224

below for some ORFs. 225

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

11

Homing endonucleases and recombination genes. Three ORFs (ORF9, ORF13 and ORF39) were 226

predicted to be homing endonucleases. These ORFs had similarity with deduced proteins found 227

in Lactococcus phages 712 and P745 (43), both 936-like phages, as well as with L. lactis phage 228

Q54 (37). Since homing endonucleases promote genetic exchange and horizontal transfer (44), 229

this part of the phage GE1 genome may have arisen through the acquisition of mobile DNA, as 230

already proposed for phage 712 (45). ORF15 and ORF22 had similarity to proteins with putative 231

recombination functions, found in Streptococcus pseudopneumoniae and 936-like phage jm3 232

(43). 233

234

Replication. ORF12 and ORF14 have homology with a glutamyl-tRNA synthase protein found in 235

Lactococcus phage c2 and with a single-stranded binding protein of lactococcal 936-like phages, 236

such as phi7 and P113G (43). Glutamate tRNA synthase catalyses the attachment of the amino 237

acid glutamine to its cognate transfer RNA molecule in a highly specific two-step reaction (46). 238

Single stranded binding proteins are required during DNA replication, repair and recombination 239

(40, 47, 48). 240

241

Morphogenesis and lysis. Phage GE1 structural proteins (ORF32/major capsid protein; ORF34/ 242

major tail protein; ORF37/minor tail protein) and proteins involved in packaging 243

(ORF40/terminase) and lysis (ORF29/holin; ORF38/holin) showed similarities to proteins found 244

in other phages possessing the same morphological features, particularlyc2, Q54, CB17, 5447, 245

and 923 (34, 49). ORF35 possesses an immunoglobulin-like domain but did not match with other 246

proteins in databases. Immunoglobulin-like proteins may be involved in host recognition (50). 247

The structural protein profile of phage GE1 was determined by SDS-PAGE (Fig. 1B) and found 248

to be highly related to phage c2 (37). 249

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

12

Comparison of prolate-headed phages. As demonstrated above, phage GE1 has similarities to 250

L. lactis phages c2 and Q54, both prolate-headed phages. The genome organization and proteome 251

of phage GE1 were specifically compared to those of L. lactis phages c2 and Q54. Figure 3 252

clearly confirms the relatedness of phage GE1 to c2 and Q54 phages. GE1 possesses 13 ORFs 253

that align with those of phage c2 (amino acid identity of 25 to 58%). They are principally 254

involved in replication (six ORFs) and morphogenesis (seven ORFs), and five of these seven 255

proteins were also common to phage Q54 (amino acid identity of 27 to 44%). However, the 256

genome organization of phage GE1 is closer to phage c2 than Q54, as illustrated by gene 257

orientation (Fig. 3). 258

259

Phylogenetic studies of L. garvieae phages. Finally, a phylogenetic analysis was performed 260

using L. garvieae phages (GE1 and WP-2) as well as members of the 10 currently recognized 261

groups of L. lactis phages to confirm the relationships described above. Figure 4 shows a 262

proteomic phylogenetic tree constructed using MEGA 5 software and the neighbor-joining 263

method. This global comparison revealed that the two L. garvieae phages are distributed into L. 264

lactis phages, indicating that they probably evolved from a common ancestor. The genomic 265

comparison also demonstrated that phage GE1 originates at the same point as other prolate-266

headed phages, diverging, together with phage Q54, in a separate branch. 267

268

DISCUSSION 269

To date, L. garvieae phages have been poorly characterized. GE1 is the first L. garvieae 270

siphophage to be characterized at the genomic level. Phage GE1 shares some characteristics with 271

other lactococcal phages, specifically those infecting the food-grade bacterial species, L. lactis. 272

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

13

Phage GE1 has prolate capsid (morphotype B2), narrow host spectrum, and burst size and latent 273

period similar to other L. lactis phages. 274

Significant research attention has focused on phages infecting L. lactis in recent decades 275

because these phages pose a significant risk to milk fermentation processes (51). The main 276

interest in studying these phages is to understand their diversity and evolution to enable 277

development of efficient phage control tools (52). L. lactis phages are currently grouped into ten 278

taxonomic groups based on morphology and genome analysis (17) and, of these, phages 936, c2, 279

and P335 (all Siphoviridae phages) are the most frequently encountered in the dairy industry (53). 280

Over 80 L. lactis phage genome sequences are now publicly available. 281

L. garvieae strains are found in raw milk and in a range of aquatic and terrestrial 282

environments (21). Some L. garvieae strains may also be major components of the autochthonous 283

microbial populations of certain artisanal cheeses (5). In fact, it is believed that the activity of L. 284

garvieae strains may contribute to the final sensory characteristics of some dairy products (54). 285

The adaptation of L. garvieae to the milk environment was likely enabled by the acquisition of 286

certain plasmids (55). Not surprisingly, L. garvieae phages have similarities to L. lactis phages, 287

also found in dairy environments. 288

Comparative genome and proteome analyses clearly demonstrated that phage GE1 is 289

related to L. lactis c2 and Q54 groups (Figures 3 and 4). Its genome size of 24,847 bp is also 290

intermediate to c2 (22,172 bp) and Q54 (26,537 bp). The GE1 genome has cohesive extremities 291

containing a cos site [GCAA(N9)AACT], differing from the c2 [TCAA(N4)AACT] and general 292

lactococcal phage consensus cos sites [TCAN(N4)NACT] (38), but similar to the phage Q54 cos 293

site [CCAA(N10)AACT]. The regions flanking the cos site contain several features common to 294

other lactococcal phages such as the presence of direct and inverted repeats, and an A/T-rich 295

region. 296

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

14

A global analysis of the genomes of phages GE1, c2, and Q54 shows that c2 and GE1 are 297

similarly organized, with two large modules in opposite orientations starting at the probable 298

origin of replication. In phage GE1, an extra module (4 genes) was detected at the end of the late 299

gene cluster, as in phage Q54. The predicted proteome of phage GE1, however, was closer to that 300

of phage c2 with 13 ORFs sharing similarity. In the phage GE1 early-expressed module, five 301

genes (orfs 9, 11, 13, 14, and 22) code for proteins homologous to those found in L. lactis 936-302

like phages. These latter phages, which also belong to the Siphoviridae family but have a small 303

isometric capsid, are highly abundant in dairy environments (56), suggesting possible 304

recombination events. Members of the rarely isolated Q54 group were proposed to be the result 305

of past recombination events between 936- and c2-like phages (37). Another striking feature of 306

phage GE1 is the low level of similarity of its proteome with proteins in existing databases, 307

confirming its novelty. 308

309

Acknowledgements 310

We would like to thank Barbara-Ann Conway (Medical Writer & Editor) for editorial 311

assistance. We also thank Alex Hynes for comments on the manuscript. We are grateful to 312

Laetitia Bonifait and Caroline Duchaine for compost soil samples. We are grateful to Frederic 313

Raymond and Jacques Corbeil for initial genome assembly. S.M. acknowledges funding from the 314

Natural Sciences and Engineering Research Council of Canada. S.M. holds a Tier 1 Canada 315

Research Chair in Bacteriophages. 316

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

15

REFERENCES 317

1. Vendrell D, Balcázar JL, Ruiz-Zarzuela I, de Blas I, Gironés O, Múzquiz JL. 2006. 318 Lactococcus garvieae in fish: a review. Comp Immunol Microbiol Infect Dis 29:177-198. 319

2. Devriese LA, Hommez J, Laevens H, Pot B, Vandamme P, Haesebrouck F. 1999. 320 Identification of aesculin-hydrolyzing streptococci, lactococci, aerococci and enterococci 321 from subclinical intramammary infections in dairy cows. Vet Microbiol 70:87–94. 322

3. Aubin GG, Bémer P, Guillouzouic A, Crémet L, Touchais S, Fraquet N, Boutoille D, 323 Reynaud A, Lepelletier D, Corvec S. 2011. First report of a hip prosthetic and joint 324 infection caused by Lactococcus garvieae in a woman fishmonger. J Clin Microbiol 325 49:2074–2076. 326

4. Russo G, Iannetta M, D’Abramo A, Mascellino MT, Pantosti A, Erario L, Tebano G, 327 Oliva A, D’Agostino C, Trinchieri V, Vullo V. 2012. Lactococcus garvieae endocarditis 328 in a patient with colonic diverticulosis: first case report in Italy and review of the literature. 329 New Microbiol 35:495-501. 330

5. Fortina MG, Ricci G, Acquati A, Zeppa G, Gandini A, Manachini PL. 2003. Genetic 331 characterization of some lactic acid bacteria occurring in an artisanal protected 332 denomination origin (PDO) Italian cheese, the Toma piemontese. Food Microbiol 20:397–333 404. 334

6. Fortina MG, Ricci G, Borgo F. 2009. A study of lactose metabolism in Lactococcus 335 garvieae reveals a genetic marker for distinguishing between dairy and fish biotypes. J 336 Food Prot 72:1248–1254. 337

7. Aguado-Urda M, Teresa Cutuli M, Mar Blanco M, Aspiroz C, Tejedor JL, 338 Fernández-Garayzábal JF, Gibello A. 2010. Utilization of lactose and presence of the 339 phospho-β-galactosidase (lacG) gene in Lactococcus garvieae isolates from different 340 sources. Int Microbiol 13:189–193. 341

8. Ferrario C, Ricci G, Milani C, Lugli GA, Ventura M, Eraclio G, Borgo F, Fortina 342 MG. 2013. Lactococcus garvieae: Where is it from? A first approach to explore the 343 evolutionary history of this emerging pathogen. PLoS One 8. doi: 344 10.1371/journal.pone.0084796. 345

9. Casalta E, Montel MC. 2008. Safety assessment of dairy microorganisms: The 346 Lactococcus genus. Int J Food Microbiol 126:271–273. 347

10. Eraclio G, Ricci G, Fortina MG. 2015. Insertion sequence elements in Lactococcus 348 garvieae. Gene 555:291–296. 349

11. Weinbauer MG. 2004. Ecology of prokaryotic viruses. FEMS Microbiol Rev 28:423-433. 350

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

16

12. Veesler D, Cambillau C. 2011. A common evolutionary origin for tailed-bacteriophage 351 functional modules and bacterial machineries. Microbiol Mol Biol Rev 75:423–433. 352

13. Oliveira, I, Almeida, RCC, Hofer, E, Almeida P. 2012. Bacteriophage amplification 353 assay for detection of Listeria spp. using virucidal laser. Brazilian J Microbiol 43:1128–354 1136. 355

14. Hanlon GW. 2007. Bacteriophages: an appraisal of their role in the treatment of bacterial 356 infections. Int J Antimicrob Agents 30:118-128. 357

15. Garneau JE, Moineau S. 2011. Bacteriophages of lactic acid bacteria and their impact on 358 milk fermentations. Microb Cell Fact 10(Suppl 1):S20. doi: 10.1186/1475-2859-10-S1-359 S20. 360

16. Moineau S, and Lévesque C. 2005. Control of bacteriophages in industrial fementations, 361 p285-286. In: Kutter E, Sulakvelidze A (ed), Bacteriophages: Biology and Applications, 362 CRC Press. 363

17. Park KH, Matsuoka S, Nakai T MK. 1997. A virulent bacteriophage of L. garvieae 364 (formerly Enterococcus seriolicida) isolated from yellowtail Seriola quinqueradiata. Dis 365 Aquat Org 29:145–149. 366

18. Ghasemi SM, Bouzari M, Shaykh Baygloo N, Chang H-I. 2014. Insights into new 367 bacteriophages of Lactococcus garvieae belonging to the family Podoviridae. Arch Virol 368 159:2909–2915. 369

19. Nakai T, Sugimoto R, Park KH, Matsuoka S, Mori K, Nishioka T, Maruyama K. 370 1999. Protective effects of bacteriophage on experimental Lactococcus garvieae infection 371 in yellowtail. Dis Aquat Organ 37:33–41. 372

20. Ghasemi SM, Bouzari M, Yoon BH, Chang H-I. 2014. Comparative genomic analysis 373 of Lactococcus garvieae phage WP-2, a new member of Picovirinae subfamily of 374 Podoviridae. Gene 551:222–229. 375

21. Ferrario C, Ricci G, Borgo F, Rollando A, Fortina MG. 2012. Genetic investigation 376 within Lactococcus garvieae revealed two genomic lineages. FEMS Microbiol Lett 377 332:153-161. 378

22. Haddad L El, Moineau S. 2013. Characterization of a novel panton-valentine leukocidin 379 (PVL)-encoding staphylococcal phage and its naturally PVL-lacking variant. Appl Environ 380 Microbiol 79:2828–2832. 381

23. Émond É, Holler BJ, Boucher I, Vandenbergh PA, Vedamuthu ER, Kondo JK, 382 Moineau S. 1997. Phenotypic and genetic characterization of the bacteriophage abortive 383 infection mechanism AbiK from Lactococcus lactis. Appl Environ Microbiol 63:1274–384 1283. 385

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

17

24. Samson JE, Moineau S. 2010. Characterization of Lactococcus lactis phage 949 and 386 comparison with other lactococcal phages. Appl Environ Microbiol 76:6843–6852. 387

25. Moineau S, Durmaz E, Pandian S, Klaenhammer TR. 1993. Differentiation of two 388 abortive mechanisms by using monoclonal antibodies directed toward lactococcal 389 bacteriophage capsid proteins. Appl Environ Microbiol 59:208–212. 390

26. Deveau H, Van Calsteren MR, Moineau S. 2002. Effect of exopolysaccharides on 391 phage-host interactions in Lactococcus lactis. Appl Environ Microbiol 68:4364–4369. 392

27. Boisvert S, Laviolette F, Corbeil J. 2010. Ray: simultaneous assembly of reads from a 393 mix of high-throughput sequencing technologies. J Comput Biol 17:1519–1533. 394

28. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes 395 S, Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, 396 McNeil LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens R, 397 Vassieva O, Vonstein V, Wilke A, Zagnitko O. 2008. The RAST server: rapid 398 annotations using subsystems technology. BMC Genomics 9:75. doi: 10.1186/1471-2164-399 9-75. 400

29. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 401 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search 402 programs. Nucleic Acids Res 25:3389-3402. 403

30. Lowe TM, Eddy SR. 1997. tRNAscan-SE: a program for improved detection of transfer 404 RNA genes in genomic sequence. Nucleic Acids Res 25:955–964. 405

31. Laslett D, Canback B. 2004. ARAGORN, a program to detect tRNA genes and tmRNA 406 genes in nucleotide sequences. Nucleic Acids Res 32:11–16. 407

32. Chen L, Xiong Z, Sun L, Yang J, Jin Q. 2012. VFDB 2012 update: toward the genetic 408 diversity and molecular evolution of bacterial virulence factors. Nucleic Acids Res 409 40:D641-645. 410

33. Chakraborty A, Ghosh S, Chowdhary G, Maulik U, Chakrabarti S. 2012. DBETH: a 411 database of bacterial exotoxins for human. Nucleic Acids Res 40:D615-620. 412

34. Deveau H, Labrie SJ, Chopin M-C, Moineau S. 2006. Biodiversity and classification of 413 lactococcal phages. Appl Environ Microbiol 72:4338–4346. 414

35. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: 415 molecular evolutionary genetics analysis using maximum likelihood, evolutionary 416 distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739. 417

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

18

36. Dupuis ME, Moineau S. 2010. Genome organization and characterization of the virulent 418 lactococcal phage 1358 and its similarities to Listeria phages. Appl Environ Microbiol 419 76:1623–1632. 420

37. Fortier LC, Bransi A, Moineau S. 2006. Genome sequence and global gene expression 421 of Q54, a new phage species linking the 936 and c2 phage species of Lactococcus lactis. J 422 Bacteriol 188:6101–6114. 423

38. Perrin R, Billard P, Branlant C. 1997. Comparative analysis of the genomic DNA 424 terminal regions of the lactococcal bacteriophages from species c2. Res Microbiol 425 148:573–583. 426

39. David Cue MF. 1993. The role of cosB, the binding site for terminase, the DNA 427 packaging enzyme of bacteriophage lambda, in the nicking reaction. J Mol Biol 234:594–428 609. 429

40. Brussow H. 2001. Phages of dairy bacteria. Annu Rev Microbiol 55:283–303. 430

41. Lubbers MW, Waterfield NR, Beresford TPJ, Le Page RWF, Jarvis AW. 1995. 431 Sequencing and analysis of the prolate-headed lactococcal bacteriophage c2 genome and 432 identification of the structural genes. Appl Environ Microbiol 61:4348–4356. 433

42. Lubbers MW, Ward LJ, Beresford TP, Jarvis BD, Jarvis AW. 1994. Sequencing and 434 analysis of the cos region of the lactococcal bacteriophage c2. Mol Gen Genet 245:160–435 166. 436

43. Mahony J, Kot W, Murphy J, Ainsworth S, Neve H, Hansen LH, Heller KJ, Sørensen 437 SJ, Hammer K, Cambillau C, Vogensen FK, Van Sinderen D. 2013. Investigation of 438 the relationship between lactococcal host cell wall polysaccharide genotype and 936 phage 439 receptor binding protein phylogeny. Appl Environ Microbiol 79:4385–4392. 440

44. Belfort M, Bonocora RP. 2014. Homing endonucleases: from genetic anomalies to 441 programmable genomic clippers. Methods Mol Biol 1123:1–26. 442

45. Mahony J, Deveau H, Mc Grath S, Ventura M, Canchaya C, Moineau S, Fitzgerald 443 GF, Van Sinderen D. 2006. Sequence and comparative genomic analysis of lactococcal 444 bacteriophages jj50, 712 and P008: evolutionary insights into the 936 phage species. 445 FEMS Microbiol Lett 261:253–261. 446

46. Freist W, Gauss DH, Ibba M SD. 1997. Glutaminyl-tRNA synthetase. Biol Chem 447 378:1313–1329. 448

47. Scaltriti E, Polverini E, Grolli S, Eufemi E, Moineau S, Cambillau C, Ramoni R. 449 2013. The DNA binding mechanism of a SSB protein from Lactococcus lactis siphophage 450 p2. Biochim Biophys Acta 1834:1070–1076. 451

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

19

48. Scaltriti E, Tegoni M, Rivetti C, Launay H, Masson J-Y, Magadan AH, Tremblay D, 452 Moineau S, Ramoni R, Lichière J, Campanacci V, Cambillau C, Ortiz-Lombardía M. 453 2009. Structure and function of phage p2 ORF34(p2), a new type of single-stranded DNA 454 binding protein. Mol Microbiol 73:1156–1170. 455

49. Rakonjac J, O’Toole PW, Lubbers M. 2005. Isolation of lactococcal prolate phage-456 phage recombinants by an enrichment strategy reveals two novel host range determinants. 457 J Bacteriol 187:3110–3121. 458

50. Fraser JS, Maxwell KL, Davidson AR. 2007. Immunoglobulin-like domains on 459 bacteriophage: weapons of modest damage? Curr Opin Microbiol 10:382-387. 460

51. Mahony J, van Sinderen D. 2014. Current taxonomy of phages infecting lactic acid 461 bacteria. Front Microbiol 5:7. doi: 10.3389/fmicb.2014.00007. 462

52. Samson JE, Moineau S. 2013. Bacteriophages in food fermentations: new frontiers in a 463 continuous arms race. Annu Rev Food Sci Technol 4:347–368. 464

53. Mahony J, Bottacini F, van Sinderen D, Fitzgerald GF. 2014. Progress in lactic acid 465 bacterial phage research. Microb Cell Fact 13(Suppl 1):S1. doi: 10.1186/1475-2859-13-466 S1-S1. 467

54. Fernández E, Alegría Á, Delgado S, Mayo B. 2010. Phenotypic, genetic and 468 technological characterization of Lactococcus garvieae strains isolated from a raw milk 469 cheese. Int Dairy J 20:142–148. 470

55. Flórez AB, Mayo B. 2015. The plasmid complement of the cheese isolate Lactococcus 471 garvieae IPLA 31405 revealed adaptation to the dairy environment. PLoS One 472 10:e0126101. doi: 10.1371/journal.pone.0126101. 473

56. Mahony J, Murphy J, Van Sinderen D. 2012. Lactococcal 936-type phages and dairy 474 fermentation problems: from detection to evolution and prevention. Front Microbiol 3:335. 475 doi: 10.3389/fmicb.2012.00335. 476

477

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

20

A)

B)

478 Figure 1. Morphology and structural proteome of phage GE1. Panel A) Electron micrograph of phage 479 GE1. Panel B) Structural protein profiles of phages GE1 and c2. M, Molecular Markers (Bio-Rad). 480 Numbers on the left indicate the molecular mass of the markers (Lane M). 481

GE1 c2

250 150 100

75

50

37

kDa M

25

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

21

A) 482

483 B) 484

485 Figure 2. Analysis of GE1 cos region. (A) Analysis of the cos site and the flanking regions. Direct repeats 486 (bold arrows), inverted repeats (bold, dash arrows), A/T rich regions and G-rich segments are indicated. 487 Details of the cohesive termini (rectangle) are also shown together with the site of cleavage (vertical 488 arrows). Shading indicated nucleotides that belong to the consensus sequence found in all lactococcal 489 phage for which the cos site has been determined. (B) Multiple alignments of λ-like R consensus 490 sequences from Q54, GE1, and c2. Conserved nucleotides are shaded. 491

ttaattggtgatgtcatcttttatataacctgctttctttagagtgttgtatatagagttaatggc

aaggaggtaatcagatgcagttaatagatacctgttagtgtaattcgttactccttttatgtcctc

tgttattgtattcaatataatttgctcttctgttaagttgctattattcatAATATATTTCCTTTC

TATATATATAGTCTATCATAATACATTACTATTGTCAACTGTTATGTGATCATGTGTGTGCTTAGT

ACTGTGCTTACTCATCTATGTCTATGTATATCTGTTGCTTATTGATTGAATGAAATAATAAATAAA

TGTAAAGAGAAAGGTAAAGAATTAAATGAAAAAGATTTCGTGTAAATTGTAAATTTTGTCAGGAAG

AGTGGCGTAAGTGTACGGGGGTGTAATAATTGGGGGTAGGGGGCAAGAGTGCAACAACTCCTTCGC

ATTTACATTTCAATTTTCATTTTCAATTATTTTCATAATATAAAAACCTTACACAAGCTCACAGAA

TGCGTTCTAAGCTCATATAAGGTATCTTGctataatgttatcttaacttctttaaactctttctgt

aacagctctagagcatcatgcaccctttcttct//ttttctttatctaaaacattgcgtaacttag

ctttacaccaaactgtaccaggtttctctttcaatttctctaaccattcttctaagttcat

ORF 48

ORF 1

A/T-richregion

G box

A/T-richregion

Q54 R1 ATCTTAAACAGAAATGCAA

R2 TCTAAAATCAGAAAGAATA R3 TAATAAAAAAGAAATAAAC R4 TTTTAGACAAGAAAGGAGG R5 AAAGCAAGAAGAAAGAGCC R6 AATGGGAAAAGAAAATTTT R7 CTTAAGAAGCGAAACATAT R8 CTACACAAGAGAAACACGA R9 GCAATAAAACGAAAAGAAA GE1 R1 TTGATTGAATGAAATAATA

R2 AATGTAAAGAGAAAGGTAA R3 AGAATTAAATGAAAAAGAT R4 CAAACTCAAAGAAAGGGTC R5 ATGTCAGTAAGAAACGGTT c2 R1 TAAGAAAGAAGAAAGAAAG

R2 TAACTAAAAAGAAAGAAGA R3 TTTTCAAAACGAAAAATGG R4 TAATAAAATAGAAAAGTGA

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

22

Table 1. Features of the ORFs of L. garvieae phage GE1.

ORF Stranda Positions Start Stop

Size aa

MMb

kDa pI Putative RBS and start codonc Predicted functiond

Best-match BLASTp result # aa shared

with best match / total # aa in best match (% ID)

E value Sizee (aa)

Accession numbers

1 - 529 104 141 16.9 6.8 AGGAGActagaATG - 2 - 678 526 50 6.1 9.8 aAGGAGtgcaagctATG - 3 - 854 675 59 7.2 9.3 AAGAAAGgcaatgtagtgaaagaATG - 4 - 1039 842 65 7.7 9.5 AAGAAAGAggtagaaaATG - 5 - 1295 1029 88 10.1 9.8 AAGAAAGaaaacatctaaaATG - 6 - 1650 1477 57 6.8 8.7 gAAGAGGtatagaaATG - 7 - 1949 1653 98 11.1 4.5 AGAGGAttgagATG - 8 - 2256 1951 101 11.5 4.5 GAGgtGAAaagagcATG - 9 - 2678 2253 141 16.2 10.1 AGGAGtttatagaccaGTG HNH endonuclease ORF31 Lactococcus phage 712 66/137 (48) 3e-32 141 YP_764291.1 10 - 2947 2675 90 10.4 7.9 GAAAGGGGAtatatATG - 11 - 3588 3073 171 20.0 9.4 AGGAGAactttaATG - ORF41 Lactococcus phage 191 54/162(33%) 5e-11 177 AFE86775.1 12 - 3770 3588 60 7.1 4.7 GAAAGGccattATG tRNAsynthetase ORF6 Lactococcus phage c2 24/52(46%) 0.15 54 NP_043532.1 13 - 4179 3754 141 16.4 9.8 ctgacttgccattttaacATG HNH endonuclease ORF48 Lactococcus phage

P475 74/142 (52) 3e-36 145 AGI11121.1

14 - 4510 4181 109 11.9 4.7 AAGAGAatataaattATG ssDNA-binding protein ORF40 Lactococcus phage 7 49/117 (42) 2e-18 119 YP_008318242.1 15 - 5031 4531 166 18.3 7.8 AGGAAAttgaattcgcATG ERF recombinase Rec, S. pseudopneumoniae 58/123 (47) 1e-29 207 WP_000163473.1 16 - 5231 5028 67 7.8 5.2 AGGAGGacaagaagaaATG - 17 - 5402 5268 44 5.4 6.7 atacAGAGGtggatagATG - 18 - 5637 5389 82 10.0 9.5 AtgAGGGAtttaagttagATG - ORF10 Lactococcus phage c2 31/77(40%) 2e-05 83 NP_043536.1 19 - 5920 5621 99 11.9 4.9 CGTAGAGGActttggcaagtATG - 20 - 6176 5913 87 10.3 4.6 AGGAGAgtaatATG - gp25 Lactococcus phage KSY1 27/60(45%) 3e-07 99 YP_001469023.1 21 - 6531 6352 59 7.1 7.9 AGGttGAGAtattagaATG - 22 - 7478 6528 316 36.1 5.4 AAGGAGtAaatacaGTG DNA polymerase ORF42 Lactococcus phage jm3 166/317 (52) 6e-106 315 YP_008318192.1 23 - 7737 7465 90 10.5 8.9 GGAAAGGctttggattATG - 24 - 8148 7921 75 9.0 8.9 AGGAGAaaacaaaATG - 25 - 8355 8218 45 5.4 9.4 AAAGGAcggtgttattATG - 26 - 8476 8342 44 5.1 9.7 GAGAGGtttagaaaATG - 27 - 8651 8466 61 7.3 4.7 AGGAGActattatATG - 28 + 9309 9461 50 5.8 4.5 AGGAGAaaggtttATG - 29 + 9463 9951 162 18.2 5.2 tactcattacctatttaatATG Holin ORF24 Lactococcus phage c2 92/159(58) 1e-59 161 NP_043550.1 30 + 10496 11167 223 24.9 9.0 AAAGGAAAtaattaaTTG - 31 + 11177 12109 310 34.7 5.2 AAAtAGAGGtaacaaATG - 32 + 12096 13667 523 57.6 4.9 GAAGAGtgaggtagaagATG Major capsid protein MCP Lactococcus phage CB17 130/535 (24) 9e-22 489 AAZ95019.1 33 + 13684 14484 266 28.9 5.2 AAAGAGgtaacttATG - 34 + 14486 15100 204 22.4 4.7 AAGAAAGGtataatttaatATG Major tail protein ORF23 Lactococcus phage Q54 65/200 (33) 1e-21 212 YP_762592.1 35 + 15151 15342 63 6.7 6.0 AGGGGGAAggTTG Ig-like domain 36 + 15366 15617 83 9.6 5.6 AGGGGActtaatATG - 37 + 15798 18317 839 87.8 5.5 AGGAAAttaatTTG Tail protein Pl10 Lactococcus phage 5447 123/471 (26) 3e-22 622 AAT73602.1 38 + 18331 18606 91 10.2 9.3 AGGGAAaataATG Holin Gl17 Lactococcus phage 923 54/85 (65) 1e-27 96 AAT81366.1 39 + 18684 18968 94 10.9 8.3 AGcttgtGGGGGtAtcATG HNH endonuclese Gp27 Lactococcus phage Q54 44/101 (44) 4e-16 103 YP_762596.1

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

23

40 + 18968 20605 545 61.3 6.6 AtGGGGtGGtaATG Terminase ORF28 Lactococcus phage Q54 191/507 (38) 2e-96 514 YP_762597.1 41 + 20605 20901 98 11.4 9.1 AGGGAAattaatctaATG - ORF35 Lactococcus phage c2 20/65(31%) 0.005 99 NP_043561.1 42 + 20901 22100 399 46.6 5.5 AAGGAGtttatgtaATG - 43 + 22100 22759 219 24.9 5.8 GAAAGGttacgggtataatttaATG - 44 + 22759 23526 255 27.5 4.8 GAAGGGttatgttggtggattaATG - 45 - 23708 23568 46 4.9 9.5 AGGAGAacatcATG - 46 - 24237 23797 146 16.4 10.2 GAAAGGtggttatatgtaATG - 47 - 24410 24237 57 6.6 4.0 AAGcAGGttatataaaagATG - 48 - 24576 24394 60 6.8 4.7 AGGAAAtatattATG -

MCP, Major Capsid Protein; Rec, Recombinase; S., Streptococcus. a Orientation of the gene in the genome. b MM, molecular mass. c RBS, ribosomal binding site: uppercase letters represent hypothetical RBS sequences, bold letters represent starting codons. d – indicates no significant matches. e Total size of the aligned proteins.

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

24

Figure 3. Genomic comparison of GE1, Q54 and c2 phages. ORFs from GE1 showing similarity with other phages are linked by gray shading and the percent amino acid identity indicated is representative of the aligned region.

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from

25

507

508 509 510 Figure 4. Phylogenetic tree of different lactococcal phage proteomes determined using the neighbor-joining 511 algorithm. The bar shows the difference between the phages in amino acids. 512 513 514

515

516

on April 14, 2018 by guest

http://aem.asm

.org/D

ownloaded from