Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=tase20

Annales de la Société entomologique de France (N.S.)International Journal of Entomology

ISSN: 0037-9271 (Print) 2168-6351 (Online) Journal homepage: http://www.tandfonline.com/loi/tase20

A new genus of gall-forming aphids of tribeFordini Baker, 1920 (Hemiptera: Aphididae:Eriosomatinae) from Near East

Shalva Barjadze, Susan Halbert, Danièle Matile & Rachel Ben-Shlomo

To cite this article: Shalva Barjadze, Susan Halbert, Danièle Matile & Rachel Ben-Shlomo(2018) A new genus of gall-forming aphids of tribe Fordini Baker, 1920 (Hemiptera: Aphididae:Eriosomatinae) from Near East, Annales de la Société entomologique de France (N.S.), 54:6,511-521, DOI: 10.1080/00379271.2018.1532814

To link to this article: https://doi.org/10.1080/00379271.2018.1532814

Published online: 14 Nov 2018.

Submit your article to this journal

Article views: 129

View Crossmark data

A new genus of gall-forming aphids of tribe Fordini Baker, 1920 (Hemiptera: Aphididae:Eriosomatinae) from Near East

Shalva Barjadze*a, Susan Halbertb, Danièle Matilec & Rachel Ben-Shlomod

aInstitute of Zoology, Ilia State University, Giorgi Tsereteli 3, Tbilisi 0162, Georgia; bDivision of Plant Industry, Florida Department ofAgriculture and Consumer Services, Florida State Collection of Arthropods, Gainesville, FL 32608, USA; cMuséum National d’HistoireNaturelle UMR 7205 MNHN-CNRS : ISYEB, Institut de Systématique, Evolution, Biodiversité 57, rue Cuvier CP 50 F - 75005 Paris,France; dDepartment of Biology, University of Haifa-Oranim, Tivon 36006, Israel

(Accepté le 1 octobre 2018; publié en ligne le 14 novembre 2018)

Summary. Inbaria n. gen. is proposed based on type species Geoica swirskii Remaudière & Inbar, 2004, resulting in a newcombination, Inbaria swirskii (Remaudière & Inbar, 2004) n. comb. Inbaria easily differs from all Pistacia gall-producingaphids of the tribe Fordini by the size of the primary and secondary rhinaria in fall migrants. Inbaria n. gen. is differentiatedmorphologically from the similar genera Geoica Hart, 1894 and Slavum Mordvilko, 1927. Genetically (COI), the twogenera Geoica and Inbaria show a large divergence of more than 9% of the sequence. Notes on some morphologicalcharacters in apterous fundatrigeniae and descriptions of the embryo of the apterous exule, within alate viviparous femalesof I. swirskii, are provided.

Résumé. Un nouveau genre de puceron galligène de la tribu des Fordini Baker, 1920 (Hemiptera : Aphididae :Eriosomatinae) du Proche-Orient. Inbaria n. gen. est décrit sur la base de son espèce-type Geoica swirskii Remaudière &Inbar, 2004, entraînant la nouvelle combinaison Inbaria swirskii (Remaudière & Inbar, 2004) n. comb. Inbaria sedifférencie facilement de tous les autres pucerons galligènes de la tribu des Fordini vivant sur Pistacia par la taille desrhinaria primaires et secondaires des migrants automnaux. Inbaria n. gen. Se différencie morphologiquement des genressemblables Geoica Hart, 1894 et Slavum Mordvilko, 1927. Génétiquement (COI), les deux genres Geoica et Inbariamontrent une grande divergence de plus de 9% dans leur séquence. Des notes sur les caractères morphologiques desfondatrigènes aptères et des descriptions de l’embryon de la fondatrigène ailée, chez des femelles vivipares de I. swirskii,sont données.

urn:lsid:zoobank.org:act:60987DE1-F74E-43B9-BB04-39A47E641E0A

Keywords: Pistacia; Jordan; Israel; taxonomy; morphology; molecular divergence

Nineteen aphid genera with 107 valid species belong tothe tribe Fordini (Remaudière & Remaudière 1997;Blackman & Eastop 2018). The single species of thegenus Aloephagus Essig, 1950 lives on species of Aloe(Aloaceae) in the Holarctic region, and Dimelaphis Zhang,1998 lives on Juglans regia L. (Juglandaceae) in China(Blackman & Eastop 2018). Species from the generaAploneura Passerini, 1863, Asiphonella Theobald, 1923,Baizongia Rondani, 1848, Chaetogeoica Remaudière &Tao, 1970, Forda von Heyden, 1837, Geoica Hart, 1894,Geopemphigus Hille Ris Lambers, 1933, Paracletus vonHeyden, 1837, Rectinasus Theobald, 1914, SlavumMordvilko, 1927, Smynthurodes Westwood, 1849, andTramaforda Manheim, 2007, are associated with speciesof Pistacia (Anacardiaceae) as their primary host plantsand often produce species-specific galls (Davatchi 1958;Manheim 2007; Blackman & Eastop 2018). The followingfive Fordini genera: Kaburagia Takagi, 1937, Meitanaphis

Tsai & Tang, 1946, Melaphis Walsh, 1867, NurudeaMatsumura, 1917, and Schlechtendalia Lichtenstein,1883, produce galls on species of Rhus in East Asia(Anacardiaceae) (Zhang et al. 2006; Ren et al. 2017;Blackman & Eastop 2018).

The genusGeoica is comprised of about 11 aphid species,which make sealed spherical galls on Pistacia spp. in thePalaearctic region (Davatchi 1958; Brown & Blackman1994; Blackman & Eastop 2018). Species of the genus inthe native area of Pistacia are mostly heteroecious and host-alternating betweenPistacia galls and roots of Poaceae, exceptGeoica mimeuri (Gaumont, 1930), which is monoecious onPistacia spp. in Morocco (Blackman & Eastop 2018).Geoicaswirskii Remaudière & Inbar, 2004 in Remaudière et al.(2004), was described based on gall-living apterous fundatri-geniae, alate migrants and first instar nymphs born frommigrants living on Pistacia atlantica Desf. (Anacardiaceae).Alate viviparous females (fall migrants) of this species have

*Corresponding author. Email: shalva.barjadze@yahoo.com

Annales de la Société entomologique de France (N.S.), 2018Vol. 54, No. 6, 511–521, https://doi.org/10.1080/00379271.2018.1532814

© 2018 Société entomologique de France

Published online 14 Nov 2018

single oval-shaped secondary rhinaria apically on antennalsegments III–IV, which occupy more than half of the circum-ference of a segment and 0.4–0.6 times its length, and similarprimary rhinaria on antennal segments V and VI. All otherGeoica species have at least three oval or roundish, smallsecondary rhinaria on antennal segment III (Brown &Blackman 1994). Geoica swirskii induces bulbous, sphericalgalls on the leaf stem between bases of leaflets (Figure 2),while all Geoica produce galls on the midrib of the leaflet(Figure 3).

Shape, size, and number of secondary rhinaria and exis-tence of laterally merged anal plate and cauda in fallmigrants, dorsal setae on abdominal segments I–VII withfurcate apices in embryos of apterous exules within alateviviparous females (fall migrants) of Geoica swirskii, andlocation and structure of galls are unique and easily distin-guish this species from the other Fordini aphids.

Based on the aforementioned differences we proposethe genus Inbaria n. gen., with type species Geoicaswirskii Remaudière & Inbar, 2004 which becomes anew combination, Inbaria swirskii (Remaudière & Inbar,2004) n. comb. This genus currently is found in Jordan(Bir Ad Dabbaghat) and Israel (Gamla, Mezar, Yavniel

highland) (Figure 1b). Description of the new genus isgiven below.

Material and methods

Specimens of Inbaria swirskii were collected in the type locality(Jordan, Bir Ad Dabbaghat) on 15.X.2002 by Moshe Inbar.Specimens were cleared and individually mounted in CanadaBalsam on microscope slides using techniques described byMartin (1983). The specimens were studied using a Nikon EclipseE400 compound light microscope (Nikon Instech Co., Ltd.,Kawasaki, Kanagawa, Japan), and drawings were made by drawingtube Nikon Y-IDT attached to the Nikon Eclipse E400 microscope.Photographs were made by a color-fitted digital camera ZeissAxiocam 503 (Carl Zeiss Microscopy GmbH, Jena, Germany) oncompound light microscope Zeiss Axio Imager M2.

Some specimens previously preserved in 70% ethyl alco-hol were observed with a scanning electron microscope(SEM). In order to dehydrate specimens, they were kept in70% ethyl alcohol for 24 h, then transferred in 85% ethylalcohol for 24 h, 95% ethyl alcohol for 24 h, 100% ethylalcohol for 24 h, and finally kept in ethyl acetate for 24 h.Samples were covered by a thin layer of molecular gold-palladium using a Denton Vacuum Desk V sputter coater(Denton Vacuum LLC, Moorestown, New Jersey, USA).Observations and SEM microphotographs were done with a

Figure 1. Inbaria swirskii (Remaudière & Inbar). a, Bir Ad Dabbaghat, Jordan – type locality of Inbaria swirskii; b, distribution map ofInbaria spp. 1: Gamla; 2: Mezar; 3: Bir Ad Dabbaghat.

512 S. Barjadze et al.

JEOL JSM–5510LV scanning electron microscope (JEOLUSA, Inc., Peabody, Massachusetts, USA).

Abbreviations

FSCA Florida State Collection of Arthropods,Florida Department of Agriculture andConsumer Services, Gainesville, FL, USA

BMNH Natural History Museum, London, UnitedKingdom

ISU Ilia State University, Tbilisi, GeorgiaMNHN Muséum national d’Histoire naturelle,

Paris, FranceSMNHTAU The Steinhardt Museum of Natural History,

Tel Aviv University, Israel.

Material examined

Type material. Holotype: alate viviparous female(fall migrant), Jordan, Bir Ad Dabbaghat (misspelledon the label as “Bir Dabarat”), 30°24'N, 35°30'E, 1616m asl, ex. Pistacia atlantica, 15.X.2002, leg. M.Inbar, det. G. Remaudière, MNHN (EH) 24261, depos-ited at MNHN.

Paratypes: 4 alate viviparous females (fall migrants) ontwo slides, same data as for holotype, N 017049, depos-ited at BMNH; 21 alate viviparous females (fall migrants)on 9 slides, MNHN (EH) 24262-24270 same data as forholotype, deposited at MNHN; 5 apterous female (apter-ous fundatrigenia), on 2 slides, MNHN (EH) 24271-24272, same data as for holotype, deposited at MNHN;1 apterous female (apterous fundatrigenia), same data asfor holotype, N 017049, deposited at BMNH.

Additional material: JORDAN, Bir Ad Dabbaghat, 3apterous and 2 alate viviparous females, sample N J1and 2 alate viviparous females sample N J4 and 2alate viviparous females sample N J5, same data asfor paratypes, mounted single specimen on each slide,

det. Sh. Barjadze and S. Halbert, deposited atSMNHTAU; 2 apterous and 1 alate viviparous female,sample N J1 and 2 alate viviparous females, sample NJ4 and 2 alate viviparous females, sample N J5, samedata as for paratypes, mounted single specimen oneach slide, det. Sh. Barjadze and S. Halbert, depositedat FSCA; 2 apterous and 2 alate viviparous females,sample N J1 and 1 alate viviparous female, sample NJ4 and 2 alate viviparous females, sample N J5, samedata as for paratypes, mounted single specimen oneach slide, det. Sh. Barjadze and S. Halbert, depositedat ISU; 6 apterous viviparous female mounted onSEM stub from sample N J4 deposited at ISU.Investigated material belonged to Dr Moshe Inbar.

Every gall contained solely genetically identicalaphids. DNA was extracted from the aphids previouslypreserved in 96% ethyl alcohol (ca. 100 aphids pergall) using DNeasy Blood and Tissue Kit (Qiagen). Afragment of 711 bp of the mitochondrial COI genewas amplified by PCR in a total volume of 13 µland at an annealing temperature of 55°C. Primerdesign followed COI sequences found in GenBank(AY227075; F- GGTCTGGGATAATTGGTTCTTC,and R- AGGCCAATTGTTATTATAGC). The singlePCR products of the amplified fragments were purified(Illustra ExoProstar, GE Healthcare, Amersham, UK)and sequenced using BigdyeR terminator sequencingprocedure (Applied Biosystems, Thermo FisherScientific, Austin, Texas, USA), and were read byABI 3130xl Fluorescence-Reader (AppliedBiosystems). Chromatograms were checked visually,and the least clear ends of each sequence wereexcluded from the analysis. Sequences were alignedusing the software MEGA 5.1 (Tamura et al. 2011).All SNPs (single nucleotide polymorphisms) were re-checked visually, and the resulting phylogenetic den-drogram was clustered by the maximum likelihoodmethod (1000 bootstraps).

Figure 2–4. Shape of Pistacia atlantica-feeding aphids galls. 2, Gall of Inbaria (bar: 2.5 cm). Note the location of the gall on the leaf stembetween bases of leaflets. 3, Gall of Geoica sp. (bar: 2 cm). 4, Gall of Slavum wertheimae (bar: 5 cm); All photos were taken by M. Inbar.

Annales de la Société entomologique de France (N.S.) 513

Results

Morphological analysis

Inbaria n. gen.

Type species: Geoica swirskii Remaudière & Inbar 2004:38 (Figures 1, 2, 5–21, 25)

Diagnosis. The new genus Inbaria has a combinationof the following morphological characters: single oval-shaped large primary and secondary rhinaria, whichoccupy more than half of the circumference of theantennal segment and 0.4–0.8 of the antennal

segment length, in fall migrants (Figures 6, 7, 9–13);antennal segment VI equals or is slightly longer thanantennal segment III in fall migrants (Figures 6, 7);marginal wax gland plates are invisible on abdominaltergites I–V in fall migrants; laterally merged analplate and cauda, forming perianal ring with analaperture in the middle in fall migrants (Figure 25);some dorsal setae on the abdominal segment I–VIIwith furcate apices: bi- or tri- or rarely tetrafurcate inembryos of apterous exule within alate viviparousfemales (fall migrants) and first instar larvae ofapterous exule born from alate females (Figure 21).The new genus produces galls on the leaf stem

Figure 5–8. Inbaria swirskii (Remaudière & Inbar), paratypes. 5, habitus of apterous fundatrigenia (bar: 0.5 mm); 6, head and thorax offall migrant (bar: 0.3 mm); 7, antenna of fall migrant (bar: 0.1 mm); 8, abdomen of fall migrant (bar: 0.4 mm).

514 S. Barjadze et al.

between bases of leaflets of Pistacia atlantica(Figure 2). No other Pistacia-feeding species of

Fordini makes galls on the leaf stem between basesof leaflets.

Figure 9–18. Inbaria swirskii (Remaudière & Inbar), antennal segments and sensory structures of alate viviparous female. 9, antenna(bar: 50 μm); 10, antennal segment III (arrow on coeloconic sensillum) (bar: 10 μm); 11, antennal segment IV (bar: 10 μm); 12, antennalsegment V (arrows on pit-like depression and coeloconic sensillum) (bar: 10 μm); 13, antennal segment VI and apical part of antennalsegment V (arrows on pit-like depressions and coeloconic sensillum) (bar: 20 μm); 14, coeloconic sensillum on the surface of primaryrhinarium on antennal segment VI (bar: 1 μm); 15, coeloconic sensillum on surface of primary rhinarium on antennal segment V (bar: 2μm); 16, coeloconic sensilla (arrows) as accessory sensoria near large primary placoid sensillum on the antennal segment VI (bar: 1 μm);17, pit-like depression on antennal segment IV (bar: 1 μm); 18, antennal segment VI (arrow on the secondary rhinarium) (bar: 20 μm).

Annales de la Société entomologique de France (N.S.) 515

Etymology. The generic name Inbaria is of femininegender and given in honor of Prof. Moshe Inbar(former surname Burstein), who has workedintensively on the biology and ecology of thePistacia-gall producing Fordini aphids for severaldecades.

Description. Apterous fundatrigeniae (n = 13). Body small,oval with 5-segmented antennae (Figure 5). Length ofantennae ca. 1/5 length of body. Primary rhinaria onantennal segments IV and V small, non-ciliated, accessoryrhinaria ciliated. Frons convex. Eyes only with triommatidia.Rostrum short, reaches or slightly exceeds the middle coxae.Ultimate rostral segment oblong triangular with blunt apexand 2 accessory setae. Tarsi 2-segmented. First tarsalchaetotaxy: 3:3:2 or 3:3:3. Siphunculi absent. Anal plateenlarged and surrounded by the U-shaped abdominaltergite VIII and forming trophobiotic organ (Figure 5).Cauda small with a few setae. Wax gland cells and plateson the head and prothorax are invisible; wax glands presenton spinal, pleural and marginal positions of meso- andmetathorax, sometimes invisible on mesothorax; variable-sized wax gland plates present on spinal, pleural andmarginal positions of abdominal segments I–VII. Dorsaland ventral setae short and pointed.

In the original description of Geoica swirskii, theauthors stated the first tarsal chaetotaxy as 2:2:2(Remaudière et al. 2004), but it is 3:3:2 or 3:3:3. Theyalso stated the wax gland plates were absent or probablyindistinct (Remaudière et al. 2004), whereas they are pre-sent on segments as mentioned above.

Fall migrant (n = 48). Body small, with 6-segmentedantennae (Figures 6, 8, 9). Length of antennae ca. 1/3–1/4 length of body (Figure 6). Single oval-shaped largesecondary rhinaria apically on antennal segments III-IV,which occupy more than half of the circumference of asegment and 0.4–0.6 the antennal length of the segment(Figures 7, 9–11). Very rarely single, small, round sec-ondary rhinarium present on the basal part of antennalsegment VI (Figure 18). Primary rhinarium on antennalsegments V and VI large, non-ciliated and similar inappearance to secondary rhinaria of antennal segmentsIII and IV by size and shape, occupying 0.6–0.8 of theantennal length (Figures 7, 12, 13, 18). Both primary andsecondary rhinaria have on their surfaces 0–9 pit-likedepressions, each with or without a single coeloconicsensillum, a peg-like sensillum bearing a cuticular pro-jection at its tip (0–4 on antennal segment III; (0) 1–6 onantennal segment IV; 2–8 on antennal segment V; 1–9 onantennal segment VI) (Figures 7, 10, 12–15, 17). The

Figure 19–21. Inbaria swirskii (Remaudière & Inbar). Embryo of apterous exule within abdomen of alate viviparous females. 19,habitus (bar: 200 μm); 20, posterior part of abdomen (bar: 50 μm); 21, abdominal segment IV with dorsal setae (bar: 50 μm).

516 S. Barjadze et al.

diameter of the pit-like depression varies between 2 and4 μm. Accessory rhinaria (coeloconic sensilla) on anten-nal segment VI are ciliated (Figures 13, 16). Frons con-vex. Head and thorax without wax gland cells and plates.Rostrum very short, not reaching middle coxae. Ultimaterostral segment is oblong triangular with blunt apex and2 accessory setae. Tarsi 2-segmented. First tarsal chaeto-taxy: 3:3:3 and rarely 3:4:3, 3:4:4 and 4:3:3. Forewing:costal and subcostal veins pigmented; pterostigma notextending around wing tip and edges pigmented; medialvein of forewing simple. Hind wing with two obliqueveins. Setae on dorsal and ventral sides of abdomenpointed. Siphunculi absent. Anal plate and cauda aremerged laterally, forming pigmented perianal ring withanal aperture in the middle of the pale membranous area(Figures 8, 25). Anal plate is not enlarged and is notsurrounded by the U-shaped abdominal tergite VIII(Figure 8). Anal plate and cauda are the same size(Figure 25). In four paratype specimens, cauda with4–6 short and pointed setae arranged as one row nearcaudal apex, and anal plate with 14–19 long and pointedsetae not arranged in the longitudinal rows. Spinal regionof abdominal tergites with a row(s) of small wax glandplates consisting of 2–6 gland cells or single wax cells.

The biggest wax gland plates have 15 cells and aresituated on the spinal part of abdominal tergite VII.Marginal gland plates on abdominal dorsum I–V invisi-ble and sometimes only separated wax gland cells can beobserved. Abdominal dorsum VI–VII with small mar-ginal gland plates.

No details (description, photos) were provided onthe perianal organ in alate viviparous females (fallmigrants) of Geoica swirskii in the original description(Remaudière et al. 2004).

Embryo of apterous exule within alate females(n = 10). Antennae 4- or 5-segmented. Primary rhinar-ium on last antennal segment with ciliate rim. Bodylength 0.699–0.895 mm (Figure 19). Eye as triomati-dium. Tarsi 2-segmented. First tarsal chaetotaxy: 2:2:2.Antennae and legs have pointed setae. Five to 8 spino-pleural setae (0.029–0.049 mm) on abdominal tergitesI–VII are stout, have pointed or furcate apices (bi- ortri- or sometimes tetrafurcate), or rarely fan-shaped(Figure 21). Two to 4 similarly shaped marginal setaeare developed on abdominal tergites I-VII (Figure 21).At least one marginal seta is always pointed and longerthan all other setae on abdominal dorsum (0.054–0.071 mm) (Figure 21). Ventral setae short and always

Figure 22–25. Aploneura lentisci Passerini on Pistacia lentiscus from France, Slavum wertheimae Hille Ris Lambers onPistacia mutica from Iran and Inbaria swirskii (Remaudière & Inbar) (paratype) on Pistacia atlantica from Jordan. 22,Slavum wertheimae, habitus of alate viviparous female (bar: 500 μm); 23, Aploneura lentisci, antenna of alate viviparous female(bar: 10 μm); 24, Slavum wertheimae, antenna of alate viviparous female (bar: 10 μm); 25, Inbaria swirskii, perianal ring of alateviviparous female (bar: 20 μm).

Annales de la Société entomologique de France (N.S.) 517

pointed. Abdominal tergite VIII with 4–6 setae. Analplate with 2 longitudinal rows of 10–12 long pointedsetae (Figure 20).

Biology and distribution of the type species – Inbariaswirskii

Biology. Inbaria swirskii is known only from gall-livingmorphs (apterous fundatrigeniae and fall migrants) onPistacia atlantica. The galls are formed in the spring and bythe fall may contain up to few hundred alate females (fallmigrants). Its secondary host plant, life cycle and othermorphs are unknown (Remaudière et al. 2004; Blackman &Eastop 2018).

Distribution. The host tree, P. atlantica, has a widespreadbut disjunct Irano-Turanian distribution, primarily due toclimatic changes in the Pleistocene and Holocene. Inbariaswirskii was described from Jordan, Bir Ad Dabbaghat(30°24'N, 35°30'E) (Figure 1). The wide anddiscontinuous distribution of P. atlantica in diverseecological stresses was found to be positively correlatedwith genetic diversity and speciation (Avrani et al. 2012),hence further speciation is expected to be found in thegenus Inbaria.

Molecular analysis

Sequencing of a segment of 513 bp of the mitochondrialbarcoding gene cytochrome oxidase I (COI) indicates alarge deviation between Geoica species and Inbaria(Figure 27). We sequenced various samples of Geoicaspp. collected from Pistacia atlantica, P. palaestinaBoiss., P. khinjuk Stocks and P. mutica Fisch. & C.A.Mey (sequences are deposited in GenBank; accessionnumbers: MH822908–MH822918). We aligned and clus-tered them with several samples of aphids from gallsfound on the leaf stem between bases of leaflets (typicalfor Inbaria) collected in Israel and Jordan (accessionnumbers: MH822902–MH822907). Phylogenetically, twoclearly separate clades are evident. All aphids from gallsfound on the leaf stem between bases of leaflets clusteredtogether in one clade – Inbaria. The discovery of threedifferent haplotypes suggests the existence of three possi-ble species in the genus Inbaria. Interestingly, three dif-ferent haplotypes (I–III) are detected in Bir Ad Dabbaghat,Jordan, which is the type locality of Inbaria swirskii.Aphids from the gall of the type specimen (holotype) ofInbaria swirskii display Haplotype I. Haplotype II is cur-rently known from Bir Ad Dabbaghat, Jordan only, whileHaplotype III has wide distribution and was detected inBir Ad Dabbaghat, Jordan, as well as Mezar and Gamla,Israel (Figures 1, 27). Morphological descriptions of thesehaplotypes are currently unobtainable, and will remain a

Figure 26. Geoica wertheimae, habitus of alate viviparous female (holotype) on Pistacia palaestina from Israel (bar: 500 μm).

518 S. Barjadze et al.

future challenge. The genus Geoica, comprised of variousspecies and haplotypes residing on several species ofPistacia hosts, of which all clusters together, distinctlyfrom Inbaria, with minimum 48 (> 9%) SNPs betweenthe two genera.

Among the gall-forming Fordini aphids, most samples ofInbaria showed higher similarity in COI sequences to thegenus Slavum than to the genus Geoica (650–700 bp; max.92% similarity with Slavum wertheimae Hille Ris Lambers,1957).

Discussion

In the Pistacia gall-producing Fordini, two genera, Aploneuraand Slavum, have a single secondary rhinarium (placoid sen-sillum) on antennal segments III and IV in fall migrants;however: (1) the secondary rhinaria in these genera are dis-tinctly smaller (Figures 23, 24) than in Inbaria (Figures 7–9);(2) the secondary rhinaria do not occupy more than half of theantennal segments’ circumference in Aploneura and Slavum(Figures 23, 24), whereas it is always more than half of theantennal segments’ circumference in Inbaria (Figures 7, 8);and (3) the anal plate and cauda in fall migrants of Aploneura

and Slavum are separated (Figure 22), whereas in Inbaria theyare laterally merged to form perianal ring (Figure 25).Secondary rhinaria in fall migrants of Aploneura spp. areciliated (Figure 23) (Hille Ris Lambers 1957), while they arenon-ciliated in Inbaria. In addition, dorsal setae on abdominaltergites I–VII have pointed or furcate (bi- or tri- or sometimestetrafurcate) apices in embryos of apterous exule within fallmigrants (Figure 21) and first instar larvae of apterous exuleborn from fall migrants in Inbaria (paratype specimen of firstinstar exule of Geoica swirskii was investigated), while thesesetae are pointed or with round or bulbous apices in threeheteroecious Slavum spp. (S. esfandiarii Davatchi &Remaudière, S. lentiscoides Mordvilko, and S. mordvilkoiKreutzberg) (Davatchi & Remaudière 1957; Davatchi 1958;Remaudière et al. 2004). Moreover, Inbaria induces sphericalgalls on the leaf stem between bases of leaflets (Figure 2),whereas Aploneura spp. produce pocket-like, kidney shapedgalls on the mid-rib of leaflets, and Slavum spp. produce bag-,coral- and cauliflower-like galls on leaflets or on twigs(Figure 4) (Hille Ris Lambers 1957; Davatchi 1958;Remaudière et al. 2004; Blackman & Eastop 2018).

The existence of the merged anal plate and cauda (peri-anal ring) (Figure 25) and spherical galls in Inbaria are

Figure 27. A maximum likelihood dendrogram drawn for COI sequences (513 bp) of Inbaria (accession numbers: MH822902–MH822907). The dendrogram includes sequences of various haplotypes of Geoica spp. residing on P. atlantica (Pa), P. palaestina (Pp),P. khinjuk (Ph) and P. mutica (Pm) (accession numbers: MH822908–MH822918). Additional sequences taken from GenBank (designatedGB). Bootstrap values are shown at the nodes. The gall of type specimen of Inbaria swirskii is designated with*.

Annales de la Société entomologique de France (N.S.) 519

reminiscent of the genus Geoica, but Inbaria differs fromGeoica by (1) the number of secondary rhinaria on antennalsegment III in fall migrants: always single in Inbaria(Figures 6, 9) vs. minimum 3 in Geoica (Figure 26); (2) thesecondary rhinaria do not occupy more than half of theantennal segments’ circumference in fall migrants ofGeoica (Figure 26), whereas it is always more than half ofthe antennal segments’ circumference in the same form ofInbaria (Figures 7, 8); (3) antennal segment VI is distinctlyshorter than antennal segment III in fall migrants of allGeoica spp. (Figure 26), while antennal segment VI equalsor is slightly longer than antennal segment III (0.96–1.20) inthe same form of Inbaria (Figures 6, 7); (4) abdominaltergites I–V usually with visible marginal wax gland platesin fall migrants ofGeoica (Blackman & Eastop 2018), whilemarginal wax gland plates are invisible on abdominal tergitesI–V in the same form of Inbaria; (5) some dorsal setae onabdominal tergites I–VII have pointed or furcate (bi- or tri- orsometimes tetrafurcate) apices in embryos of apterous exulewithin fall migrants (Figure 21) and apterous exules inInbaria, while these setae are pointed or attenuated or spa-tulate or fan-shaped (not with furcate apices) in Geoica spp.(Davatchi & Remaudière 1957; Brown & Blackman 1994;Remaudière et al. 2004; Blackman & Eastop 2006); (6)Inbaria induces galls on the leaf stem between bases ofleaflets (Figure 2), while all Geoica spp. produce galls onthe midrib of the leaflet (Figure 3) (Davatchi 1958; Brown &Blackman 1994; Remaudière et al. 2004; Blackman &Eastop 2018).

Similar extra-large secondary rhinaria in alate femalesoccur in two Fordini genera, Kaburagia and Meitanaphisthat produce galls on Rhus in East Asia (Yang et al. 2009).Inbaria differs from Kaburagia and Meitanaphis by theexistence of the perianal ring – a completely merged analplate and cauda (separated in Kaburagia and Meitanaphis)(Tsai & Tang 1946; Chowdhuri et al. 1969; Remaudièreet al. 2004). Moreover, alate females of Kaburagia andMeitanaphis have well-developed marginal wax glandplates on the abdominal tergites I–V, while marginalgland plates on the same abdominal tergites are invisiblein Inbaria (Ghosh 1986; Remaudière et al. 2004; L. Jiang,personal communication). Alate females of Meitanaphiselongallis Tsai & Tang, 1946 have numerous microtrichiaand small coeloconic sensilla on the surface of largeplacoid primary and secondary rhinaria. Each coeloconicsensillum is surrounded by a ring of hair-like processesand looks like a ciliary crown (Yang et al. 2009), whileInbaria has several coeloconic sensilla and pit-like depres-sions (0–9) on the surface of the primary and secondaryrhinaria, lacking the surrounding ring of hair-like pro-cesses (Figures 7, 10, 12–15, 17).

In most aphids, the coeloconic sensillum is located on thesurface of antennal segment II and on the basal part of the lastantennal segment near the large primary rhinarium (placoidsensillum) (Bromley et al. 1979), and the sensillum peg

always has cuticular projections at the tip. The coeloconicsensillum’s location on antennal segments III–V and espe-cially on the surface on primary and secondary rhinaria (pla-coid sensilla) on these antennal segments in alate females ofthe genera Inbaria and Meitanaphis is an unusual phenom-enon and was found in the genera Geoica and Forda as well(first author’s personal investigation). Pit-like depressionswithout a coeloconic sensillum on the surface of the primaryand secondary rhinaria (Figure 17) perhaps have a sensoryfunction. Further detailed investigation is necessary to studythe structure and functions of pit-like depressions and coelo-conic sensilla situated on the surface of primary and secondaryrhinaria in Inbaria.

Conclusion

The new genus Inbaria was erected based on morpholo-gical characters observed in fall migrants and embryoswithin abdomen of fall migrants in Geoica swirskii.Individuals belonging to the new genus produce galls onthe leaf stem between bases of leaflets of Pistacia. NoPistacia-feeding Fordini makes galls on the leaf stembetween bases of leaflets. By the number of secondaryrhinaria in fall migrants the new genus is similar toSlavum, while by the shape of the perianal ring in fallmigrants and gall shape it is similar to Geoica.

Acknowledgments

We thank the colleagues who helped us during the preparation ofthis paper: P. Brown and R. Blackman (The Natural HistoryMuseum, London, UK) and Liyun Jiang (Institute of Zoologyof Chinese Academy of Sciences, Beijing, China) for providinginformation and photos of Kaburagia and Meitanaphis. We aregrateful to Elijah Talamas and Silvia Vau (Division of PlantIndustry, Florida Department of Agriculture and ConsumerServices, Gainesville, FL, USA) for help in taking of photos.We thank Paul Skelley (Division of Plant Industry, Gainesville,FL, USA) for reviewing the manuscript. We thank the FloridaDepartment of Agriculture and Consumer Services, Division ofPlant Industry for their support of this work; and the anonymousreferees, whose helpful suggestions contributed to this study.

References

Avrani S, Ben-Shlomo R, Inbar M. 2012. Genetic structure of agalling aphid and its host Pistacia atlantica across an Irano-Turanian distribution: from fragmentation to speciation? TreeGenetics & Genomes. 8:811–820.

Blackman RL, Eastop VF. 2006. Aphids on the World’s herbaceousplants and shrubs. Vol. 1 & 2. Chichester: Wiley; p. 1439.

Blackman RL, Eastop VF 2018. Aphids on the world’splants: an online identification and information guide.Accessed 2018 May 30. http://www.aphidsonworldsplants.info

520 S. Barjadze et al.

Bromley AK, Dunn JA, Anderson M. 1979. Ultrastructure of theantennal sensilla of aphids. I. Coeloconic and placoid sensilla.Cell Tissue Research. 203:427–442.

Brown PA, Blackman RL. 1994. Morphometric variation in theGeoica utricularia (Homoptera: Aphididae) species group onPistacia (Anacardiaceae), with descriptions of new species anda key to emigrant alatae. Systematic Entomology. 19:119–132.

Chowdhuri AN, Basu RC, Chacrabarti S, Raychaudhuri DN.1969. Aphids (Homoptera) of Simla (Himachal Pradesh),India. Oriental Insects. 3:83–92.

Davatchi GA. 1958. Étude biologique de la faune entomologiquedes Pistacia sauvages et cultivés. Bulletin trimestriel de lasociété de pathologie végétale et d’Entomologie agricole deFrance. 37:1–166.

Davatchi GA, Remaudière G. 1957. Quelques Fordinae nou-veaux ou peu connus des Pistacia (Hom. Aphidoidea).Revue de Pathologie Végétale et d’Entomologie Agricolede France. 36:165–183.

Ghosh LK. 1986. A conspectus of Aphididae (Homoptera) ofHimachal Pradesh in Northwest Himalaya, India. ZoologicalSurvey of India. 16:1–282.

Hille Ris Lambers D. 1957. On some Pistacia aphids (Homopt.,Aphididae) from Israel. Bulletin of the Research Council ofIsrael. 6B:170–175.

Manheim O. 2007. Tramaforda wooli, a new genus and speciesof Fordinae (Homoptera: Eriosomatidae) from Israel. IsraelJournal of Entomology. 37:47–54.

Martin J. 1983. The identification of common aphid pests oftropical agriculture. Tropical Pest Management. 29:395–411.

Remaudière G, Inbar M, Menier JJ, Shmida A. 2004. Un nou-veau Geoica gallicole sur Pistacia atlantica en Jordanie(Hemiptera, Aphididae, Eriosomatinae, Fordini). Revuefrançaise d’ Entomologie (N.S.). 26:37–42.

Remaudière G, Remaudière M. 1997. Catalogue of the world’sAphididae. Paris: INRA; p. 473.

Ren Z, Harris AJ, Dikow RB, Ma E, Zhong Y, Wen J. 2017.Another look at the phylogenetic relationships and inter-continental biogeography of eastern Asian-NorthAmerican Rhus gall aphids (Hemiptera: Aphididae:Eriosomatinae): evidence from mitogenome sequencesvia genome skimming. Molecular Phylogenetics andEvolution. 117:102–110.

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S.2011. MEGA5: molecular evolutionary genetics analysisusing maximum likelihood, evolutionary distance, and max-imum parsimony methods. Molecular Biology andEvolution. 28:2731–2739.

Tsai PH, Tang C. 1946. The classification of the Chinese gallaphids with description of three genera and six species fromMeitan, Kweichow. Transactions of the Royal EntomologySociety of London. 97:405–418.

Yang Z, Chen X, Feng Y, Chen H. 2009. Morphology of the antennalsensilla of Rhus gall aphids (Hemiptera: Aphidoidea:Pemphiginae): a comparative analysis of five genera. Zootaxa.2204:48–54.

Zhang HC, Qiao GX, Zhang GX. 2006. A study on diversity ofaphid’s galls in Pemphigidae. Acta Zootaxonomica Sinica.31:48–54.

Annales de la Société entomologique de France (N.S.) 521