A mutation in TaGW2-A increases thousand grain weight in wheat · • Functional genomics – What...
Transcript of A mutation in TaGW2-A increases thousand grain weight in wheat · • Functional genomics – What...
A mutation in TaGW2-A increases thousand grain weight in wheat
James Simmonds
Keeping up with demand
As the world population continues to rise, demands are increasing and the rate of yield advances are slowing
Global wheat production has failed to meet demand in 10 of the last 14 years (USDA http://www.ers.usda.gov)
The discovery of genes that beneficially impact on yield and yield components and their incorporation into breeding programs is required to address food insecurity
Targeting Grain Size
Yield can be broken down into three major components that are fixed successively through the season
Spikes per surface area
Grain number per spike
grain weight (TGW)
grain filling reproductive stage vegetative stage
Adapted from Slafer and Rawson, 1994
Plants m2 Tiller/plant Tiller survival
Spikelets/spike
Yield
Spike fertility
• spikes per surface area
• grain number per spike
• grain weight
TILLING: Targeting Induced Local Lesions IN Genomes
TILLING requires:-
Population of (EMS) mutagenised plants
High throughput screen to identify mutations in a gene of interest
•a reverse-genetics approach • requires knowledge of gene sequence of your gene of interest • non-transgenic
Reverse Genetics
Studying a candidate gene........
Uses • Functional genomics – What function does the gene have? • Test hypotheses- Which of these genes is responsible for my phenotype? • Translation between species – Testing how genes from model species function in a crop species? • Develop novel alleles – Identify an allelic series gain insight into function
Reverse Genetics
TILLING: Targeting Induced Local Lesions IN Genomes
GW2 negatively regulates grain size
• RING-type E3 ubiquitin ligase (GW2) negatively regulates cell division; (23.4% wider) Song et al 2007 Nature Genetics
Wheat
• Several recent association studies in wheat with contrasting results Su et al 2011 TAG, Yang et al 2012 TAG, Zhang et al 2013 Euphytica
• RNAi of TaGW2 in wheat have also shown contradictory results (+/- regulator) Bednarek et al 2012 JXB, Hong et al 2014 Func Int Genomics
GW2 negatively regulates grain size ?
>Genomic DNA
AGTGTTACTACAATTGGATTGTGTCTGCAATTCTGTTACATTTTATCATTATCTCAAAATTTCTACATGAATTTGTCGAATGCAAAGATGGACATTATATTATAGGAGTT
TCTGTTATTTAGCACTTCTACCATGTCCCGAGTTTTTTAACTTGTTAATAAGATTCTCCTAATTTGGGAACCACTGTAATTTCCCCTGTCCTAAAAAATGCATGTTTTTT
TTTCTTAATTGTAGTACTACCCAAGCCTTAACCGATCAAAATGTTGCTCGAAAGGGATATGTACAGGTAATGTATCTGTCCTACTAGCTACTACCAGTGATTGTGTGTTA
CTTGTTAGGTGCAAATTTCCTTACATGTCTTGTTTGGTATTTTGCAGAGTGCTTTCTTCAAATGAAACCAACTCATACTGCTCGACCTACACAGTATCCTTCATACCATC
TCTGTTCTTGTTTCAAATATCCTGTATTGGTAAGTAATGTATGGGCCTTGTCAATTCTCACGGTAACACTTAACCAATAAAGATGCCCATTCTGCAAAACCCCCAACTAT
GCTGTGGAGTATCGTGGTGTAAAGACAAAGGAGGAAAGGAGCATAGAGCAATTTGTAAGTCTTATTCCCTAATGTGTTTGTTTTTGTGTTGATATTAGAAAGCCAAATTC
ATTTACTTTATCTTGTATAAATTTTGTTACAGGAAGAACAGAAAGTCATTGAAGCACAGATGAGGGTGCGGCAGCAAGCACTTCAAGACGAAGAGGATAAGATGAAAAGA
AAACAGAGTAGGTGCTCTTCTAGCAGAACAATCGCTCCAACAACAGAAGTGGAGTATCGAGATATTTGCAGCACATCCTATTCAGGTCTGCACTAGATACGACAAATGTA
CACATTTAATAATGTCAATTTTTCTGTAGTTTAATCTGATAACTTACAATTTACTATGTTCGTTGCAGTGCCATCGTACCAATGTACCCAGCAAGAAACTGAATGTTGTT
CGTCTGAGCCTTCATGTTCTGCTCAGGCTAACATGCGGTCTTTCCATTCTAGGCATACTCGGTATGTTGTTTTATGTTTTATGTTCCATCATACTTTACCGAAGCTCATA
TTGTTGGACAAATTCATTTTAGCAAGAAAATCCATATGCCATTCGTACCAACTGTTCCAAAAGGCTATATACTACACATTAGATGACAGCTACTCTAAAAGCAGGGAGTA
TCTGAAGCATAAAGTACTAGCCATTGGATTAAATGTAGATAACAATGACTGACCATTGA
TaGW2 A genome TILLING
We identified a mutation in the splice acceptor site of exon 5
Mutant Line Sequence
Wild type
TILLING
mutant
…. leading to a premature stop codon
What is the effect on phenotype?
After a single backcross to Kronos we check phenotype to assess function
TaGW2-1_Amutant_FAM GAAGGTGACCAAGTTCATGCTGCTTCAATGACTTTCTGTTCTTCT
TaGW2-1_Awt_VIC GAAGGTCGGAGTCAACGGATTGCTTCAATGACTTTCTGTTCTTCC
TaGW2-2_Aspecific_C AGAGCAATTTGTAAGTCTTATTCC
WS 1-2
Testing for phenotype
Tracking the mutation with a mutant specific KASPAr
Gw2 Increases TGW through wider and longer grains
***
*
* ***
***
*** ***
Production of NILs (BC2 & BC4) The original TILLING line will be segregating for various other mutations Near Isogenic Line were developed to validate the effect of gw2-A in a homogenous background
Kronos NILs confirm F2/F3 results
***
Kronos - tetraploid Average 7.6% increase in TGW
**
***
Kronos NILs confirm F2/F3 results
***
***
***
Production of 6X NILs
How does the effect translate in hexaploid wheat?
Effect maintained in hexaploid NILs
***
Paragon Average 10.2% increase in TGW
***
***
Effect maintained in hexaploid NILs
***
***
***
Will this convert to yield?
Replicated yield trial of the BC2 NILs sown in the winter – yield data due summer 2015 BC4 NILs sown in replicated 1m bulk plots for analysis of morphometric properties and multi site field trials 2015/16 To access material contact :- [email protected] (cc [email protected])
Song et al (2007) Nature Genetics 39
3 mm
1 2 3 4 5 6 7 8 9 10 11 12 RING-
protein
Diploid rice : single copy
3 mm
1 2 3 4 5 6 7
A genome
1 2 3 4 5 6 7 1 2 3 4 5 6 7
B genome D genome
GW-A GW-B GW-D
Hexaploid Wheat : multiple brakes
in silico TILLING
Forward Genetics
With exome capture of 4X and 6X TILLING populations discovering mutations will become a lot more straightforward! TILLING in an afternoon!
From phenotype to mutation....
A powerful forward genetic resource
Phenotypic screen of mutants in the field
Cross-reference to EMS catalogue
Identify putative functional variants (in silico)
Validate in segregating F2 and NILs
TGW Variation Cadenza pop_ Field
Cadenza
Mutant line with the largest TGW showing a 34% increase compared to Cadenza WT
Now it may be possible to uncover which mutations are causing these increases
Preliminary analysis indicates we have a line with a HOM GW2_D STOP mutation in the top 5 for grain width
Wide variation in TGW (and other traits) in 2014
TGW Variation Kronos pop
Kronos
116 lines with larger TGW than Kronos Mutant line with the largest TGW showing a 24% increase compared to Kronos WT
Good variation in TGW
JIC Field 2015
Kronos M4 population – Winter sown 985 sequenced mutants
Cadenza M4 population – Spring sown 1720 mutants (1200 being sequenced)
Contact [email protected] (cc [email protected]) to visit the plots
1m single row per mutant line
Summary
• Using TILLING we identified a splice acceptor site mutation in TaGW2-A which leads to increases in TGW in tetraploid (7%) and hexaploid wheat (10%)
• The increase is due to grains being both wider and longer supports previous studies that GW2 is a negative regulator of grain size
• Field trials for yield evaluation underway
• in silico TILLING will provide a powerful resource to ‘rapidly’ access and combine alleles in wheat
• Kronos and Cadenza TILLING populations can be used for forward genetic screens
Cristobal Uauy
Peter Scott
Teresa Mestre
Max Bush
Mario Caccamo
Sarah Ayling
Christine Fosker
Paul Bailey
Leah Clissold
Ricardo Ramirez-Gonzalez
Andy Phillips Jorge Dubcovsky
Ksenia Krasileva (TGAC)
Hans Vasquez-Gross
Alicia del Blanco
Acknowledgements