A Lactobacillus-derived biosurfactant inhibits biofilm formation of

human pathogenic Candida albicans biofilm producers

L. Fracchia1,2, M. Cavallo

1,2, G. Allegrone

1,2, and M.G. Martinotti

1,2

1Department of Chemical, Food, Pharmaceutical and Pharmacological Sciences, University of Eastern Piedmont, Via

Bovio 6, 28100, Novara, Italy. 2Drug and Food Biotechnology Center, Via Bovio 6, 28100, Novara, Italy.

Fifteen lactic-acid bacteria, isolated from fresh fruits and vegetables produced biosurfactants in the mid-exponential phase

(5 hours). Twelve isolates were genotipically identified to belong to the genus Lactobacillus. Among these, the

Lactobacillus sp. CV8LAC, isolated from cabbage, showed the largest oil spreading halo. Extracted CV8LAC

biosurfactant reduced the water surface tension from 70.92 mN/m to 47.68 mN/m and its CMC was 106 µg/mL. The

CV8LAC biosurfactant significantly (p<0.05) inhibited the adhesion of two Candida albicans pathogenic biofilm-

producer strains (CA-2894 and DSMZ 11225) in pre-coating and co-incubation experiments. In pre-coating assays,

biofilm formation of the strain CA-2894 was reduced by 82% at concentration of 312.5 µg/ml and that of DSMZ 11225 by

81% at 625 µg/ml. In co-incubation assays, biofilm formation of CA-2894 and DSMZ 11225 was inhibited by 70% at

160.5 µg/well and by 81% at 19.95 µg/well, respectively. No inhibition of both C. albicans planktonic cells was observed,

thus indicating that the biosurfactant displayed anti-biofilm formation but not antimicrobial activity.

Keywords Lactobacillus sp. CV8LAC; biosurfactant; Candida albicans; biofilm

1. Introduction

Probiotic bacteria, such as lactobacilli, are well known to have a positive effect on the maintenance of human health [1-

3]. These bacteria, which constitute an important part of natural microbiota, are recognized as potential interfering

bacteria by producing various antimicrobial agents such as organic acids, hydrogen peroxide, carbon peroxide, diacetyl,

low molecular weight antimicrobial substances, bacteriocins, and adhesion inhibitors, such as biosurfactants [3]. In

particular, lactobacilli have long been known for their antimicrobial activity and capability to interfere with the

pathogens adhesion on epithelial cells of urogenital and intestinal tracts [4-6], and for their anti-biofilm production on

catheter devices [7] and voice prostheses [8, 9]. The mechanisms of this interference have been demonstrated to

include, among others, the release of biosurfactants [10-12].

Biosurfactants have recently become an important product of biotechnology for industrial and medical applications

[13-15]. Adsorption of biosurfactants to a substratum surface modifies its hydrophobicity, interfering in the microbial

adhesion and desorption processes [16]; in that sense, the release of biosurfactants by probiotic bacteria in vivo can be

considered as a defence weapon against other colonizing strains in the urogenital and gastrointestinal tracts [17] and on

medical devices. Biosurfactants produced by lactobacilli, in fact, have been shown to reduce adhesion of pathogenic

micro-organisms to glass [18], silicone rubber [19], surgical implants [20] and voice prostheses [8, 9]. Consequently,

previous adsorption of biosurfactants can be used as a preventive strategy to delay the onset of pathogenic biofilm

growth on catheters and other medical insertional materials, reducing the use of synthetic drugs and chemicals [16, 21,

22].

Candida species are of increasing concern as causative agents of fungal biofilm related infections on prosthesis in

odontoiatry and otorinolaringoiatry [23-25]. Development of new technologies based on the control of the Candida spp.

biofilm growth is, thus, foreseen as a major breakthrough in medicine and will have a strong impact in the clinical

practice and preventive medicine. Many lactobacilli are known to inhibit the growth of Candida spp. in different ways,

such as competition for adhesion sites or production of different antagonistic metabolites which inhibit its growth [26,

27] however, the specific role of lactobacilli-produced biosurfactant on Candida albicans biofilm has been rarely

investigated [28, 12].

The aim of this study was to determine the anti-biofilm capability of a biosurfactant produced by a Lactobacillus sp.,

isolated from cabbage, against two pathogenic strains of C. albicans biofilm producers.

2. Materials and Methods

2.1 Collection of samples and lactic acid bacteria isolation

Three cucumbers and one head of lettuce were collected from different local markets of Novara in Italy, seven apples,

one cabbage and five pears were directly obtained from a producer of biological fruit and vegetable in a rural area of

_______________________________________________________________________________________

Piedmont, Italy. All samples were collected aseptically in sterile poly-bags kept in an ice-box, and transported to the

laboratory for lactic acid bacteria isolation. Samples were thoroughly washed with sterile water and blended with a

sterile blender (Carlo Erba, Italy) for one minute. Ten grams of each sample were homogenised in a stomacher (Easy

Mix, AES Laboratoire, Bruz, France) with 90 ml of 0.85% (w/v) sterile physiological saline and incubated for one hour

at 28°C at 120 rpm. Samples were then serially diluted (10-1

to 10-8

) in saline and 150 µl were plated onto Man Rogosa

and Sharpe (MRS) (Oxoid, Italy) for lactic acid bacteria (LAB) isolation, and Rogosa Agar (Oxoid, Italy) for

lactobacilli. Plates were incubated under anaerobic conditions in an AnaeroGenTM

Compact system (Oxoid, Italy) at

28°C up to 7 days. After 24 h and, daily, up to 7 days, colonies with different morphology, colour and dimension were

selected with the help of a stereomicroscope (Nikon SMZ200) and isolated. Purity of the isolates was checked by

streaking again and sub-culturing on fresh agar plates of the isolation media, followed by microscopic examinations.

Purified strains of LAB were stored in MRS broth with 15% (v/v) glycerol at -80°C.

2.2 Phenotypic characterization

To select all the presumptive isolates under the scope of present study, initially, conventional methods of identification

based on morphological, cultural, and biochemical characteristics were followed [29]. Isolates were Gram-stained to

select for Gram-positives and to study cell morphology. Catalase and oxidase tests were also performed. Finally, CO2

production from glucose was evaluated by means of the Hot-loop test [30] on strains resulted catalase and oxidase

negative.

2.3 Genotypic characterization

Total genomic DNA was extracted enzimatically from 800 µL samples of 24 h cultures grown in MRS broth at 28°C

according to the method of Campoccia et al. [31]. The strain Lactobacillus delbrueckii subsp. delbrueckii 20074

obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany) was

used as reference strain. The extracted DNA was quantified spectrophotometrically according to the method of

Sambrook et al. [32]. In order to select members of the genus Lactobacillus, two PCR were performed with genus-

specific primers targeting the 16S rRNA genes with the conditions described by Roopashri and Varadaraj [33] and by

Byun et al. [34]. PCR amplifications were performed in an automated DNA thermal Cycler (Applied Biosystem 2720)

following the conditions as detailed in Table 1. The synthesized primers used in this study were obtained from Sigma

Genosys, UK. The PCR products were run in 1% agarose gels containing 0.4 µg/mL ethidium bromide in Tris Borate

EDTA buffer pH 8.00 (TBE buffer) (Sigma-Aldrich) for 1.5 h at 80 V and documented in Gel Documentation System

(ChemiDocTM

XRS System, Biorad). The isolates that failed to exhibit amplification of the specific 16S rRNA product

were discarded, while the others were further characterized by RAPD-PCR, in order to determine their genetic diversity.

RAPD-PCR analysis was carried out by means of the random primer M13 (5’-GAGGGTGGCGGTTCT-3’) and the

amplification conditions described by Schillinger et al. [35]. The PCR products were run in 1.8% agarose gels

containing 0.4 µg/mL ethidium bromide in TBE buffer for 3 h at 60 V. RAPD-PCR profiles were analyzed by means of

the GelCompar II program package (version 5.1; Applied Maths, Kortrijk, Belgium). Profiles were normalized using the

molecular weight markers on each gel as a reference. The similarity matrix was calculated using the Dice formula and

the clustering method was UPGMA (Unweighted Pair Group Method With Arithmetic Averages).

The Lactobacillus sp. CV8LAC was further characterized by sequencing the total 16S rRNA gene (Colony PCR

Project Report, U.S.A.) and the sequence analyzed by means of the Ribosomal Database Project [36].

Table 1 Nucleotide sequence of specific PCR primers and conditions for targeted genes among microbial cultures.

Microbial culture Target gene Primers sequence / PCR conditions Amplicon size

(bp)

Lactobacillus spp. 16S rRNA F 5’ GGAACTCAGACACGGTCCAT 3’

R 5’ TACGGATTCCACCGCTAAAC 3’

95°C 3’; 35 cycles of 94°C 40 s; 46°C 40 s; 72°C

2’; final one cycle of 72°C 15’ [33]

385

Lactobacillus spp. 16S rRNA LactoF 5’ TGGAAACAGRTGCTAATACCG 3’

LactoR 5’ GTCCATTGTGGAAGATTCCC 3’

95°C 15’; 30 cycles of 95°C 15 s, 62°C 60 s, 72°C

60 s; final one cycle 72°C 7’ [34]

231–233

2.4 Surface activity

To select the isolates showing the highest surface activity, bacteria were cultivated in 100-mL flasks containing 20 mL

MRS broth at 28°C in static conditions for 20 hours. At 5 and 20 h, 1 mL of the culture broths were centrifuged at

8,000×g for 10 min and the supernatants filter sterilized. Surface activity was measured by the oil spreading assay [37]

_______________________________________________________________________________________

by using 20 µL of Motor Oil 10 W-40 (Selenia, Italy) previously deposited onto the surface of 20 mL of distilled water

in a Petri dish (90 mm in diameter) to form a thin membrane. Twenty microlitres of each bacterial supernatant were

gently put onto the centre of the oil membrane. Diameters of clearly formed oil displaced circle were measured.

2.5 Growth curve and biosurfactant production of Lactobacillus sp. CV8LAC

Two-hundred millilitres of modified MRS broth without Tween 80®

were inoculated with 100 µL of an overnight

subculture of Lactobacillus sp. CV8LAC to obtain an inoculum density of about 1.0×106 CFU/mL. Bacterial growth

was followed with time by viable count on MRS agar and by reading the optical density at 600 nm at regular time

intervals up to 30 h. Bacterial counts were expressed as Log10CFU/mL. Simultaneously, biosurfactant production was

estimated by the oil spreading method (see Paragraph 2.4).

2.6 Biosurfactant production and extraction

For biosurfactant production, a seed culture was prepared by transferring a single colony of the CV8LAC strain from a

MRS agar culture into 20 mL of modified MRS broth without Tween 80®

and incubating overnight at 28°C in static

conditions. Thereafter, the 20 mL were inoculated in 1 L of modified MRS broth in a 5 L flask and incubated again at

28°C for 5 h in static conditions. The broth culture was then centrifuged at 8,000×g for 30 min and the supernatant was

collected. To exclude that the biosurfactant was adherent to the bacterial cell wall, bacteria separated from the

supernatant were washed three times, re-suspended in 500 µL of saline and tested by means of the oil spreading

method.

For the biosurfactant extraction, the supernatant was acidified to pH 2 with 6 N HCl, stored overnight at 4°C and

extracted three times with ethyl acetate/methanol (4:1). The organic fraction was evaporated to dryness under vacuum

condition, acetone was added to recover the raw biosurfactant. Acetone was evaporated and biosurfactant was collected

and weighted.

In order to estimate the molecular weight of the CV8LAC biosurfactant and concentrate it, a portion of the

supernatant was filter-sterilized and passed through Vivaspin 20 ultrafiltration spin columns (Sartorius) with different

cut-off (50,000 and 30,000 MW).

A preliminary analytical thin-layer chromatography (TLC) was carried out on pre-coated silica gel 60 F254 plates

(Merck Co. Inc. Damstadt, Germany). TLC plates were spotted with the extracted biosurfactant sample dissolved in

acetonitrile, and developed using acetonitrile/water, 6:3 by volume, as mobile phase.

2.7 Surface tension and critical micelle concentration

To measure the surface tension between biosurfactant solution and air, an extracted-enriched biosurfactant solution was

prepared in sterile demineralized water at 2000 µg/mL. Distilled water was used for calibration. Twenty milliliters of

biosurfactant solution were used for each measurements, carried out by means of a platinum-iridium ring tensiometer

Du Noüy (KSV Sigma 703 D); the ring was placed just below the surface of the solution, subsequently the force to

move this ring from the liquid phase to the air phase was determined in triplicate. Critical micelle concentration (CMC),

known as the concentration of surfactants above which micelles are spontaneously formed, was determined on serially

diluted biosurfactant solutions in distilled water. Surface tension of each dilution was determined in triplicate. Maximal

standard deviation associated with these surface activity measurements was 0.30 mN/m. The CMC was estimated from

the intercept of two straight lines extrapolated from the concentration-dependent and concentration-independent

sections of a curve plotted between biosurfactant concentration and surface tension values.

2.8 Biofilm production by Lactobacillus sp. CV8LAC

The capability of the strain CV8LAC to produce biofilm in different media was tested by means of the Calgary Biofilm

device (CBD, Innovotech, Edmonton, AB, Canada) as described by Harrison et al. [38]. The CBD consists of a

polystyrene lid with 96 pegs that may be fitted inside a standard 96-well microtiter plate. Each peg of the CBD has a

surface area of approximately 109 mm2.

A stock culture of Lactobacillus sp. CV8LAC stored at -80°C was streaked onto MRS agar and incubated overnight

at 28°C in anaerobic conditions. A second subculture of CV8LAC was grown again at the same conditions; then by

means of a cotton swab, some colonies from this fresh secondary subculture were picked and suspended in MRS broth

to match a 1.0 McFarland standard, corresponding to approximately 3.0×108

CFU/mL. This suspension was diluted

again 30-fold respectively in MRS broth (Oxoid, Italy), Rogosa broth (Oxoid, Italy) and LAPTg (15 g/L peptone, 10

g/L tryptone, 10 g/L yeast extract, 10 g/L glucose, and 1 mL/L Tween 80®, final pH 6.5) to create an inoculum of

approximately 1.0×107 CFU/mL for the CBD. Then, 200 µL of the bacterial inoculum were added to each well of the

microtiter plate; negative controls consisted in broth alone. The CBD peg lid was then fitted inside the microplate and

the assembled device was placed on a rotatory shaker at 150 rpm in a humidified incubator for 24 h. In parallel, in order

to verify the starting cell number in the inoculum (1.0×107 CFU/mL), serial dilutions in saline were prepared in

_______________________________________________________________________________________

microtiter plate and 20 µL of each dilution were spot plated onto each corresponding agar media. Plates were incubated

for the appropriate time and scored for cell number calculation.

After 24 h, biofilms were rinsed twice by inserting the peg lids into microtiter plates with 200 µL/well of 0.85%

saline for 2 min to remove loosely adherent cells. The lid of the CBD was then inserted into 200 µL of each

corresponding broth in the wells of a microtiter plate. Biofilms were disrupted from the peg surface using an Aquasonic

250HT ultrasonic cleaner (VWR International) set at 60 Hz for 10 min. The disrupted biofilm cells were serially diluted

in 0.85% saline, and then plated onto the corresponding agar media. Agar plates were incubated for 24 h at 28°C in

anaerobic conditions and then enumerated as above described; results were expressed as Log10CFU/peg.

2.9 Culturing and storage of Candida albicans strains

The strain Candida albicans CA-2894, isolated from human tongue, was purchased from The Belgian Co-ordinated

Collections of Microorganisms (BCCM) and the strain Candida albicans DSMZ 11225, isolated from blood, was from

The German Collections of Microorganisms and Cell Cultures (DSMZ). Strains were cultivated on Yeast Nitrogen Base

agar (YNB) (Sigma-Aldrich) and stored in the same medium added with 15% glycerol (v/v) at -80°C.

2.10 Biofilm production by Candida albicans CA-2894 and DSMZ 11225

In order to determine the best conditions for the biofilm production of the two C. albicans strains, three different

culture media, Yeast Nitrogen Base (YNB) (Sigma-Aldrich), Universal Medium for Yeast (UMY) (Medium 186,

DSMZ, Germany) and Sabouraud Dextrose Broth (SDB) (Sigma-Aldrich) were used and quantification was performed

by means of the crystal violet method [39-40]. Starting from 24 h liquid cultures in the media above mentioned, yeast

suspensions of approximately 1.0×107 CFU/mL were made. For the Candida biofilm assay, 72 wells (6 rows of 12

wells) of flat-bottomed polystyrene 96-well microtiter plates (Greiner Bio-One) were inoculated with 150 µL of each

yeast strain suspension and 24 control wells were filled with each sterile medium. After 3 h of adhesion, supernatants

(containing non-adhered cells) were removed from each well and plates were rinsed using 100 µL of saline.

Subsequently, 150 µL of each fresh media were added to wells and the plates were further incubated at 37°C for a

minimum time of 24 h at 75 rpm. For biofilm quantification and fixation, the supernatants were removed, wells were

rinsed with 100 µL of saline and 100 µL of 99% methanol was added for 15 min. Then, after supernatants removal,

plates were air-dried. One hundred microlitres of a 2% crystal violet (CV) solution was added to all the wells. After

20 min, the excess CV was removed by washing the plates with distilled water and air-dried. Finally, bound CV was

released by adding 150 µL of 33% acetic acid (Sigma-Aldrich). The absorbance was measured at 590 nm. All steps

were carried out at room temperature. Biofilm formation was analyzed at 24, 48 and 72 h. Absorbance values three

times higher than the standard deviation of the sterile control indicated a good biofilm production; inversely,

absorbance values three times lower indicated a lack of biofilm production.

2.11 Biofilm inhibition assay against Candida albicans

Biofilm inhibition assays with the extracted CV8LAC biosurfactant were performed in pre-coating and co-incubation

experiments. Briefly, in pre-coating experiments (modified from Gudiña et al. [12]), flat-bottomed polystyrene 96-well

microtiter plates were filled with 200 µL of different concentrations of CV8LAC biosurfactant (ranging from 2,500

µg/mL to 78 µg/mL) and incubated for 24 h at 37°C at 130 rpm. Control wells containing sterile water only were treated

in the same way. Biosurfactant solutions were, then, removed and the plates carefully washed twice with Phosphate

Buffer Saline (PBS) pH 7.2 to remove non-adhering biosurfactant. Aliquots of 150 µL of each C. albicans suspension in

YNB broth at the concentration of 1.0×107 CFU/mL were then added to each well and plates incubated at 37°C for 3 h

at 75 rpm. After this time, non-adherent cells were removed by gently washing twice the wells with PBS and then 150

µL of fresh YNB broth were added to wells. Plates were incubated again at 37°C for 48h at 75 rpm.

In co-incubation experiments, C. albicans inocula at the concentration of 1.0×107 CFU/mL were added to microtiter

wells together with different concentrations of the extracted biosurfactant, ranging from 160 µg/well to 2.5 µg/well (800

µg/mL to 17.5 µg/mL) and incubated for 3 hours as previously described. After this time, procedures were exactly the

same as for the pre-coating experiments except for the fact that each well was filled with fresh YNB added with the

different biosurfactant concentrations. Incubation conditions were as above. C. albicans biofilm production of both

strains was quantified by the crystal violet method described in Paragraph 2.10.

Percentages of microbial adhesion were calculated as described in Eq. (1).

% Microbial adhesionc= (Ac/A0) × 100 (1)

Where Ac represents the absorbance of the well with biosurfactant concentration c and A0 the absorbance of the control

well. This allows to estimate the percentage of microbial adhesion in relation to the control wells, which were set at

100% indicating total cells adhesion in the absence of biosurfactant.

_______________________________________________________________________________________

CV8LAC biosurfactant activity on planktonic cells of both C. albicans strains was evaluated on supernatants

removed from wells at 48 hours. Briefly, supernatants from each well were serially diluted in saline and plated onto

YNB agar. Incubation was then carried out for 48 h at 37°C. Results were expressed as Log10CFU/well.

2.12 Statistical analysis

The Student’s t test was performed when the aim was to investigate whether the difference in between the experimental

values obtained under different conditions could be considered significant.

3. Results

3.1 Phenotypic and genotypic characterization

Fifty bacterial isolates and 7 yeasts were obtained from fresh fruit and vegetable samples. In particular, 38 bacteria were

isolated from cabbage, 1 from pear, 6 from lettuce, 4 from cucumber and 1 from apple; 6 yeasts were isolated from pear

and one from apple. According to Gram-staining, 32 bacterial isolates were non spore-forming Gram-positive and

among these 14 were rods, 6 cocci and 12 ovoid cocci. All of them were considered lactic acid bacteria (LAB) based on

CO2 production and absence of catalase and oxidase.

In order to identify members of the genus Lactobacillus, a genus-specific PCR was performed on the rod shaped

bacteria. Among 14 isolates, 12 resulted in positive amplifications with both couples of primers (Figure 1) and were

further characterized by RAPD-PCR by means of the random primer M13 (Figure 2). The analysis of genetic profiles

indicated that the isolates were genetically different, with similarity lower than 75%, and were grouped in four clusters.

The isolate CV8LAC was further characterized by sequencing the complete 16S rRNA gene. Sequence alignment in the

Ribosomal Database Project [36] confirmed that it belongs to the genus Lactobacillus but, at the moment, classification

at the species level has not been done yet.

a) b)

Fig. 1 Agarose gel electrophoresis showing the Lactobacillus genus-specific PCR products amplified with primers a) R and F [33]

and b) Lacto F and Lacto R [34]. Legend: a) 1: CV1LAC, 2: CV2LAC, 3: CV3LAC, 4: CV4LAC, 5: CV5LAC, 6: CV6LAC; 7:

CV7LAC, 8: CV8LAC, 9: CV14LAC, 10: CV1I, 11: CV16I, 12: CV21I, 13: CV7T7I, 14: CV15B1, 15: L. delbrueckii, 16:

Lactococcus lactis (this study), 17: negative control. M: molecular marker b) M: molecular marker, 1: CV1LAC, 2: CV2LAC, 3:

CV3LAC, 4: CV4LAC, 5: CV5LAC, 6: CV6LAC; 7: CV7LAC, 8: CV8LAC, 9: CV14LAC, 10: CV1I, 11: CV7T7I, 12: CV15B1,

13: L. delbrueckii.

Fig. 2 Dendrogram obtained by

using RAPD patterns generated with

M13 primers from isolates

belonging to the genus

Lactobacillus. Patterns were

grouped with the unweighted pair

group method with arithmetic

averages (UPGMA). The scale

represents the percentage of

similarity among isolates.

_______________________________________________________________________________________

3.2 Surface activity

The 12 isolates belonging to the genus Lactobacillus were screened for their ability to produce biosurfactants by meansof the oil spreading test. In order to compare bacterial biosurfactant production in the two phases, the assays wereperformed on filter sterilized supernatants from 5 h (mid-exponential-phase) and 20 h (stationary-phase) of cultures. Allthe isolates showed low to high surface activity (from 0.5 to 1.5 cm) both at 5 and 20 hours of growth, with the highestvalues at 5 h (data not shown). In particular, only the isolate CV8LAC showed the highest surface activity (1.5 cm).

3.3 Growth curve and surface activity of the isolate Lactobacillus sp. CV8LAC

Growth curve of Lactobacillus sp. CV8LAC and biosurfactant surface activity were measured since the concentrationand chemical composition of biosurfactants may vary with the growth phase of the producing organism [10, 18].

In order to avoid interference of synthetic surfactants on oil spreading assays, we used a modified MRS mediumwithout Tween 80®. Compared with standard MRS broth, cell growth and biosurfactant production was not affected(data not shown). Lactobacillus sp. CV8LAC growth curve and surface activity measured by oil spreading are shown inFigure 3. An early exponential phase of one-two hours was followed by an exponential phase up to 10 h with ageneration time of about 1 h. The highest surface activity started at 5 h of growth with an oil displacement diameter of1.5 cm and this value remained more or less stable until 30 h.

a) b)

Fig. 3 Growth curve a) and biosurfactant production b) of Lactobacillus sp. CV8LAC.

3.4 Biosurfactant properties

No oil displacement was observed on the washed cell fraction, thus indicating that the biosurfactant was present only inthe supernatant. A large oil spreading halo was observed in the 50,000 MW cut-off fraction of the filter-sterilizedsupernatant obtained after concentration through Vivaspin 20 columns.

Organic extraction from supernatant yielded 1.04 g/L of a yellowish crude biosurfactant. Figure 4 shows surfacetension values of the extracted product at different concentrations; distilled water surface tension was 71.0 mN/m.CV8LAC biosurfactant at 1,280 μg/mL decreased water surface tension from 70.92 to 45.4 mN/m; then values slowlyincreased to 49.63 mN/m as the biosurfactant was diluted up to a concentration of 171.8 μg/mL. From thisconcentration, water surface tension sharply increased. The CMC value of biosurfactant CV8LAC was 106 μg/mL.

The effect of pH on the surface activity was also assessed and the surface activity was stable up to a pH of 5.0 than itincreased (data not shown).

According to a preliminary TLC analysis, two substances were detected at 254 nm UV light and other twosubstances, at minor retention factor, were visualised by spraying a specific reagent to detect sugars such as 5%anisaldehyde solution in ethanol followed by heating at 100°C.

Fig. 4 A plot of surface tension as a functionof concentrations of extracted CV8LACbiosurfactant. Maximal standard deviationassociated with these measurements was 0.30mN/m.

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Méndez-Vilas (Ed.)

832 ©FORMATEX 2010

_______________________________________________________________________________________

3.5 Biofilm production by Lactobacillus sp. CV8LAC

The capability of Lactobacillus sp. CV8LAC to produce biofilm on different media for lactobacilli is shown in Figure5. In Rogosa broth, the highest biofilm production was observed with 5.79 Log10CFU/peg at 24 h and a similar result(5.25 Log10CFU/peg) was observed in MRS broth. On the contrary, in LAPTg medium biofilm production was lowerwith a value of 2.33 Log10CFU/peg.

3.6 Biofilm production by Candida albicans CA-2894 and DSMZ 11225

The capability to produce biofilm by the human pathogenic strains Candida albicans CA-2894 and DSMZ 11225 wasevaluated on different media by the crystal violet assay (Figure 6).

Fig. 6 Biofilm production by Candida albicans CA-2894 (a) and DSMZ 11225 (b) strains on different growth media. Solid line:Yeast Nitrogen Base (YNB); dotted line: Universal Medium for Yeast (UMY); dot-dashed line: Sabouraud Dextrose broth (SDB).

Both strains showed the highest capability of biofilm production in YNB medium; in particular, after 48 h O.D.values were 0.30 and 0.25 respectively for strains CA-2894 and DSMZ 11225. Protracting incubation time up to 72 hdid not increase optical density. In UMY and SAB, both strains showed a good biofilm production, as well, after 48 hbut with O.D. values lower than those observed in YNB and respectively of 0.25 and 0.20 for CA-2894 and of 0.20 and0.18 for DSMZ 11225.

3.7 Effect of CV8LAC crude biosurfactant on biofilm formation by Candida albicans CA-2894 and DSMZ11225

The effect of pre-coating of CV8LAC biosurfactant on biofilm formation of C. albicans strains is shown in Figure 7.Results are expressed as percentage of adhesion compared to control without biosurfactant.

Pre-coating with a concentration of 312.5 µg/mL of crude CV8LAC biosurfactant significantly reduced thepercentage of cell adhesion of C. albicans CA-2894 by 82% (p<0.001) and further decreased it up to 86% at 2,500µg/mL (Figure 7a). Percentage of C. albicans DSMZ 11225 cell adhesion was significantly decreased by 81%(p<0.001) at 625 µg/mL, and further reduced to 84% at 2,500 µg/mL (Figure 7b).

Co-incubation results of CV8LAC biosurfactant and C. albicans strains are shown in Figure 8. In particular,percentage of C. albicans CA-2894 adhesion was significantly reduced by 70% (p<0.001) at 160.5 µg/well (Figure 8a)For C. albicans DSMZ 11225 too, the percentage was significantly reduced by 81% (p<0.001) at concentration of 19.95µg/well and further reduced by 86% (p<0.001) at 160.5 µg/well (Figure 8b).

Fig. 5 Biofilm production by Lactobacillus sp.CV8LAC on different growth media.

a) b)

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Méndez-Vilas (Ed.)

©FORMATEX 2010 833

_______________________________________________________________________________________

a) b)

Fig. 7 Percentage of adhesion of C. albicans CA-2894 a) and DSMZ 11225 strains b) after CV8LAC biosurfactant pre-coating.

a) b)

Fig. 8 Percentage of adhesion of C. albicans CA-2894 a) and DSMZ 11225 strains b) in the presence of CV8LAC biosurfactant.

Parallel experiments on the effects of CV8LAC biosurfactant on planktonic cells of both C. albicans strains areshown in Figure 9. CV8LAC biosurfactant did not inhibit planktonic cells of both strains thus indicating that it displaysanti-biofilm but not anti-microbial activity.

4. Discussion

In this study, 12 Lactobacillus isolates obtained from fresh fruits and vegetables produced biosurfactant when grown onMRS broth and one of them, the Lactobacillus sp. CV8LAC, obtained from cabbage and able to growth both at 28°Cand 37°C, showed the largest oil displacement. It appeared that its production was greater at the mid-exponential phaseand remained more or less stable in the stationary phase. Hence, our present observation that the maximal release ofbiosurfactant by CV8LAC is observed already in the mid-exponential phase is not fully in accordance with somereferences in the literature. Velraeds et al. [10, 18] observed that stationary phase biosurfactants were released fromLactobacillus strains in larger amounts than mid-exponential phase and had a lower and better defined CMC. Similarly,Velraeds et al. [28, 41], Walenka et al. [42] and Gudiña et al. [12], collected biosurfactants from the stationary phase.However, all the above mentioned Authors obtained biosurfactant from stationary phase Lactobacillus cells re-suspended in PBS. Surprisingly, CV8LAC produced biosurfactant only in supernatant and not when re-suspended andmaintained in PBS for biosurfactant release (data not shown).

The removal of Tween 80® from MRS did not affect cell growth and biosurfactant production (data not shown). Theextracted biosurfactant showed a CMC of 106 µg/mL, about ten times lower than that obtained by Velraeds et al. [10]from a biosurfactant produced by a Lactobacillus strain. Chemical characterization of CV8LAC biosurfactant isongoing. Preliminary results obtained by thin-layer chromatography indicates that the product is a mixture of variouscomponents, among which two are visualised by spraying a specific reagent for sugars detection. Typical biosurfactants

Fig. 9 Effect of CV8LAC biosurfactant onplanktonic cells of C. albicans CA2894 (solidline) and DSMZ 11225 strains (dotted line).

Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology A. Méndez-Vilas (Ed.)

834 ©FORMATEX 2010

_______________________________________________________________________________________

released by Lactobacillus species are named surlactin and have a glycoproteinaceus character [10, 28, 41, 43]. In

literature, release of glycosyldiglycerides as biosurfactants produced by lactobacilli has also been reported [44]. It is

also known that lactobacilli, among other species, secrete lipoteichoic acid into the culture medium during exponential

growth [45].

CV8LAC biosurfactant displayed a considerable anti-adhesive activity against two biofilm producers strains of C.

albicans. In particular, in co-incubation experiments, the biofilm formation of strain DSMZ 11225 was reduced by 81%

at the very low concentration of 19.95 µg/well (about 100 µg/mL). These results looks very encouraging since, to our

knowledge, this is the first time that a Lactobacillus biosurfactant shows such a high anti-adhesive activity against C.

albicans biofilm formation. Other biosurfactants, produced by Lactobacillus acidophilus and Lactobacillus paracasei

ssp. paracasei A20, showed lower anti-adhesive activities against C. albicans strains (adhesion reduction of about 25%

and 50%, respectively) at higher concentration [12, 28]. However, successful inhibition of C. albicans biofilm

formation has been observed by treating different materials with biosurfactants obtained by probiotics other than

lactobacilli or with probiotics suspensions (including lactobacilli). Most of these studies investigated the potential role

of probiotics and their surface-active products on silicone-rubber voice prostheses [8, 9, 19, 46, 47, 48].

Anti-adhesive activity of biosurfactant produced by lactobacilli has been described also against biofilm formation of

bacterial pathogens by preconditioning materials used in the urogenital tract or the oral cavity, glass or plastic [12, 18,

28, 41, 42]. Results obtained by our laboratory, as well, indicated the CV8LAC biosurfactant efficacy against biofilm

formation of Listeria monocytogenes, Salmonella arizonae, Escherichia coli and Staphylococcus aureus on polystyrene

and of Listeria monocytogenes on stainless steel.

Remarkably, the activity of CV8LAC biosurfactant was not related to a direct antimicrobial action, as observed by

Gudiña et al. [12], Rodrigues et al. [8, 11, 48, 49]. Similarly to what observed by Velraeds et al. [41], Rodrigues et al

[16], Vesterlund et al. [50], Walencka et al. [42] with their products, CV8LAC biosurfactant inhibited pathogen

adhesion without affecting cell growth. Thus, the way in which these surfactants influence bacterial-surface interactions

seems to be more closely related to changes in surface tension and bacterial cell-wall charge. Surfactants may affect

both cell-to-cell and cell-to-surface interactions [42]. Our results support the opinion that lactobacilli-derived

biosurfactants remarkably affect these interactions and, as a result, the surface is made less supportive for bacterial

deposition.

In conclusion, the anti-adhesive properties of the CV8LAC biosurfactant against two Candida albicans biofilm

producers suggest its potential use as an anti-adhesive product on medical devices (catheters, prosthesis, stents) to

prevent Candida albicans infections.

Acknowledgements The support by Progetto Ricerca Sanitaria Finalizzata 2008 of the Piedmont Region is gratefully

acknowledged. Technical support of Dr. Rosa Montella is acknowledged too.

References

[1] Reid G, Burton J. Use of Lactobacillus to prevent infection by pathogenic bacteria. Microbes Infect. 2002;4:319–324.

[2] Merk K, Borelli C, Korting HC. Lactobacilli—bacteria–host interactions with special regard to the urogenital tract. Int J Med

Microbiol. 2005;295:9–18.

[3] Gupta V, Garg R. Probiotics. Indian J Med Microbiol. 2009;27:202–209.

[4] Reid G, Bruce A, Smeianov V. The role of Lactobacilli in preventing urogenital and intestinal infections. Int Dairy J.

1998;8:555–562.

[5] Reid G, Bruce AW, Fraser N, Heinemann C, Owen J, Henning B. Oral probiotics can resolve urogenital infections. FEMS

Immunol Med Microbiol. 2001;30:49–52.

[6] Otero MC, Nader-Macías ME. Lactobacillus adhesion to epithelial cells from bovine vagina. Communicating Current Research

and Educational Topics and Trends in Applied Microbiology. A. Méndez-Vilas (Ed.) FORMATEX 20007, Badajoz Spain pp.

749-757.

[7] Hawthorn LA, Reid G. Exclusion of uropathogen adhesion to polymer surfaces by Lactobacillus acidophilus. J Biomed Mater

Res. 1990;24:39–46.

[8] Rodrigues L, van der Mei HC, Teixeira J, Oliveira R. Influence of biosurfactants from probiotic bacteria on formation of

biofilms on voice prostheses. Appl Environ Microbiol. 2004;70:4408–4410.

[9] Rodrigues L, van der Mei H, Banat IM, Teixeira J, Oliveira R. Inhibition of microbial adhesion to silicone rubber treated with

biosurfactant from Streptococcus thermophilus A. FEMS Immunol Med Microbiol. 2006;46:107–112.

[10] Velraeds MCM, van der Mei HC, Reid G, Busscher HJ. Physicochemical and biochemical characterization of biosurfactants

released by Lactobacillus strains. Colloids Surf B Biointerfaces. 1996;8:51–61.

[11] Rodrigues LR, Teixeira JA, van der Mei HC, Oliveira R Physicochemical and functional characterization of a biosurfactant

produced by Lactococcus lactis 53. Colloids Surf B Biointerfaces. 2006;49:79–86.

[12] Gudiña EJ, Teixeira JA, Rodrigues LR Isolation and functional characterization of a biosurfactant produced by Lactobacillus

paracasei. Colloids Surf B Biointerfaces. 2010;76:298–304.

[13] Rivardo F, Turner RJ, Allegrone G, Ceri H, Martinotti MG. Anti-adhesion activity of two biosurfactants produced by Bacillus

spp. prevents biofilm formation of human bacterial pathogens. Appl Microbiol Biotechnol. 2009;83:541–553.

[14] Martinotti MG, Rivardo F Allegrone G, Ceri H, Turner R. Biosurfactant composition produced by a new Bacillus licheniformis

strain, uses and products thereof. International patent PCT/IB2009/055334 25 November 2009.

_______________________________________________________________________________________

[15] Banat IM, Franzetti A, Gandolfi I, Bestetti G, Martinotti MG, Fracchia L, Smyth TJ, Marchant R. Microbial biosurfactants

production, applications and future potential. Appl Microbiol Biotechnol. 2010;87:427–444.

[16] Rodrigues L, Banat IM, Teixeira J, Oliveira R. Biosurfactants: potential applications in medicine. J Antimicrob Chemother.

2006;57:609–618.

[17] Van Hoogmoed CG, Van der Mei HC, Busscher HJ. The influence of biosurfactants released by S. mitis BMS on the adhesion

of pioneer strains and cariogenic bacteria. Biofouling. 2004;20:261–267.

[18] Velraeds MM, Van der Mei HC, Reid G, Busscher HJ. Inhibition of initial adhesion of uropathogenic Enterococcus faecalis by

biosurfactants from Lactobacillus isolates. Appl Environ Microbiol. 1996;62:1958–1963.

[19] Busscher HJ, Van Hoogmoed CG, Geertsema-Doornbusch GI, Van Der Kuijl-Booij M, Van Der Mei HC. Streptococcus

thermophilus and its biosurfactants inhibit adhesion by Candida spp. on silicone rubber. Appl Environ Microbiol. 1997;

63:3810–3817.

[20] Gan BS, Kim J, Reid G, Cadieux P, Howard JC. Lactobacillus fermentum RC-14 inhibits Staphylococcus aureus infection of

surgical implants in rats. J Infect Dis. 2002,185:1369–1372.

[21] Singh A, Van Hamme JD, Ward OP. Surfactants in microbiology and biotechnology: part 2. Application aspects. Biotechnol

Adv. 2007;25:99–121.

[22] Falagas ME, Makris GC. Probiotic bacteria and biosurfactants for nosocomial infection control: a hypothesis. J Hosp Infect.

2009;71:301–306.

[23] Crump JA, Collignon PJ. Intravascular catheter-associated infections. Eur. J. Clin. Microbiol. Infect. Dis. 2000;19:1–8.

[24] Douglas LJ Medical importance of biofilms in Candida infections. Rev. Iberoam. Micol. 2002;19:139–143.

[25] Kojic EM, Darouiche RO. Candida infections of medical devices. Clin. Microbiol. Rev. 2004;17:255–267.

[26] Reid G, Bruce AW, McGroarty JA, Cheng KJ, Costerton JW. Is there a role for lactobacilli in prevention of urogenital and

intestinal infections? Clin Microbiol Rev. 1990;3:335–344.

[27] Rönnqvist D, Forsgren-Brusk U, Husmark U, Grahn-Håkansson E. Lactobacillus fermentum Ess-1 with unique growth

inhibition of vulvo-vaginal candidiasis pathogens. Journal of Medical Microbiology. 2007;56:1500–1504.

[28] Velraeds MW, Van De Belt-Gritter B, Van Der Mei HC, Reid G, Busscher HJ. Interference in initial adhesion of uropathogenic

bacteria and yeasts to silicone rubber by a Lactobacillus acidophilus biosurfactant. J.Med.Microbiol. 1998;47:1081–1085.

[29] Tamang JP, Tamang B, Schillinger U, Franz CM, Gores M, Holzapfel WH. Identification of predominant lactic acid bacteria

isolated from traditionally fermented vegetable products of the Eastern Himalayas. Int J Food Microbiol. 2005;105:347-356.

[30] Sperber WH, Swan J. Hot-loop test for the determination of carbon dioxide production from glucose by lactic-acid bacteria.

Appl Environ Microbiol. 1976;31:990-991.

[31] Campoccia D, Montanaro L, Baldassarri L, An YH, Arciola CR. Antibiotic resistance in Staphylococcus aureus and

Staphylococcus epidermidis clinical isolates from implant orthopedic infections. Int J Artif Organs. 2005;28:1186-1191.

[32] Sambrook J, Fritsch E, Maniatis T. Molecular cloning: A Laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press,

1989.

[33] Roopashri AN, Varadaraj MC. Molecular characterization of native isolates of lactic acid bacteria, bifidobacteria and yeasts for

beneficial attributes. Appl Microbiol Biotechnol. 2009;83:1115–1126.

[34] Byun R, Nadkarni MA, Chhour K-L, Martin FE, Jacques NA, Hunter N. Quantitative analysis of diverse Lactobacillus species

present in advanced dental caries. J Clin Microbiol. 2004;42:3128–3136.

[35] Schillinger U, Yousif NMK, Sesar L, Franz CMAP. Use of group-specific and RAPD-PCR analyses for rapid differentiation of

Lactobacillus strains from probiotic yogurts. Current Microbiology. 2003;47:453-456.

[36] Ribosomal Database Project. RDP Release 10, Update 20. Available at: http://rdp.cme.msu.edu Accessed May 24, 2010.

[37] Morikawa M, Hirata Y, Imanaka T. A study on the structure-function relationship of lipopeptide biosurfactants. Biochimica et

Biophyica Acta. 2000;1488:211-218.

[38] Harrison JJ, Ceri H, Yerly J et al. The use of microscopy and three-dimensional visualization to evaluate the structure of

microbial biofilms cultivated in the Calgary Biofilm Device. Biol Proced Online. 2006;8:194–215.

[39] Jin Y, Yip HK, Samaranayake YH, Yau JY, Samaranayake LP. Biofilm-forming ability of Candida albicans is unlikely to

contribute to high levels of oral yeast carriage in cases of human immunodeficiency virus infection. J Clin Microbiol.

2003;41:2961-2967.

[40] Peeters E, Nelis HJ, Coenye T. Comparison of multiple methods for quantification of microbial biofilms grown in microtiter

plates. J Microbiol Methods. 2008;72:157-165.

[41] Velraeds MMC, Van der Mei HC, Reid G, Busscher HJ. Inhibition of initial adhesion of uropathogenic Enterococcus faecalis

to solid substrata by an adsorbed biosurfactant layer from Lactobacillus acidophilus. Urology. 1997;49:790-794.

[42] Walencka E, Różalska S, Sadowska B, Różalska B. The Influence of Lactobacillus acidophilus-derived surfactants on

staphylococcal adhesion and biofilm formation. Folia Microbiol. 2008;53:61–66.

[43] Gołek P, Bednarski W, Lewandowska M. Characteristics of adhesive properties of Lactobacillus strains synthesizing

biosurfactants. Pol. J. Natur. Sc. 2007;22:333-342.

[44] Gerson DF., The biophysics of microbial surfactants: growth on insoluble substrates. In N. Kosaric (Ed.). Biosurfactants-

Production, Properties, Applications. M. Dekker, New York. 1993:269-286.

[45] Pollack JH, Ntamere AS, Neuhaus FC. D-Alanyl-lipoteichoic acid in Lactobacillus casei: secretion of vesicles in response to

benzylpenicillin J. Gen. Microbiol. 1992;138:849-859.

[46] Busscher HJ, Bruinsma G, van Weissenbruch R, et al. The effect of buttermilk consumption on biofilm formation on silicone

rubber voice prostheses in an artificial throat. Eur Arch Otorhinolaryngol. 1998;255:410-413.

[47] Van der Mei HC, Free RH, Elving GJ, van Weissenbruch R, Albers FWJ, Busscher HJ. Effect of probiotic bacteria on

prevalence of yeasts in oropharyngeal biofilms on silicone rubber voice prostheses in vitro. J Med Microbiol. 2000;49: 713-718.

[48] Rodrigues L, Van der Mei HC, Teixeira J, Oliveira R. Biosurfactant from Lactococcus lactis 53 inhibits microbial adhesion on

silicone rubber. Appl Microbiol Biotechnol. 2004;66:306-311.

_______________________________________________________________________________________

[49] Rodrigues LR, Teixeira JA, Van der Mei HC, Oliveira R. Isolation and partial characterization of a biosurfactant produced by

Streptococcus thermophilus A. Colloids Surf B Biointerfaces. 2006;53:105–112.

[50] Vesterlund S, Karp M, Salminen S, Ouwehand AC. Staphylococus aureus adheres to human intestinal mucus but can be

displaced by certain lactic acid bacteria. Microbiology. 2006;152:1819–1826.

_______________________________________________________________________________________