Ar

FES

ARRAA

KWDV

1

tlWhisASvce

ars(1sa

0d

Journal of Virological Methods 178 (2011) 87– 93

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods

jou rn al h om epage: www.elsev ier .com/ locate / jv i romet

DNA-based West Nile virus replicon elicits humoral and cellular immuneesponses in mice

ei Cao1, Xiao-Feng Li1, Xue-Dong Yu, Yong-Qiang Deng, Tao Jiang, Qing-Yu Zhu,-De Qin ∗, Cheng-Feng Qin ∗

tate Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Epidemiology and Microbiology, 20 Dongda Street, Fengtai District, Beijing 100071, China

rticle history:eceived 12 March 2011eceived in revised form 13 August 2011ccepted 17 August 2011vailable online 24 August 2011

a b s t r a c t

While self-replicating, non-infectious subgenomic flavivirus replicons have been described, most of themare RNA transcripts under the control of an Sp6 or T7 promoter. In this study, using West Nile virus (WNV)as a model, a series of DNA-based reporter replicons under the control of a minimal cytomegalovirus(CMV) immediate-early promoter were constructed, and functional analysis showed that these reporter

eywords:est Nile virus (WNV)

NA-based repliconaccine

replicons replicate efficiently in mammalian cells. When the DNA-based WNV replicon was used toimmunize mice, NS1-specific IgG antibodies and anti-WNV neutralizing antibodies were both induced.Additionally, immunization with this DNA-based WNV replicon induced high levels of lymphocyte prolif-eration and enhanced the secretion of IFN-�. These results suggest that this type of DNA-based repliconcan induce humoral and cellular immune responses in mice, indicating that this type of DNA-basedreplicon may serve as a useful platform for vaccine development and protein expression.

. Introduction

West Nile virus (WNV), a member of the genus Flavivirus withinhe family Flaviviridae, causes diseases ranging from mild fever toethal meningitis or encephalitis in infected individuals. In nature,

NV is transmitted primarily in a bird–mosquito–bird cycle, butumans and other mammals are infected occasionally by the bite of

nfected mosquitoes. WNV has spread across the globe and poses aerious threat to public health. Since its first introduction into Northmerica in 1999, WNV has caused annual outbreaks in the Unitedtates with thousands of severe human infections. Although severaleterinary vaccines have been licensed, a vaccine is not availableurrently to prevent WNV infections in humans (Posadas-Herrerat al., 2010).

WNV harbors a plus-sense single-stranded RNA genome ofpproximately 11 kb. This genomic RNA contains a single openeading frame encoding a polyprotein that is cleaved into threetructural proteins (C, prM, and E) and 7 nonstructural proteinsNS1, NS2a, NS2b, NS3, NS4a, NS4b, and NS5) (Chambers et al.,990). The structural proteins form the virion particle, and the non-

tructural proteins, together with the untranslated regions (UTRs)t the genome ends, are responsible for genome replication.

∗ Corresponding authors. Fax: +86 10 63898239.E-mail addresses: qinede@sohu.com (E.-D. Qin), qincf@bmi.ac.cn (C.-F. Qin).

1 These authors contributed equally to this work.

166-0934/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2011.08.018

© 2011 Elsevier B.V. All rights reserved.

Replicons are self-replicating subgenomic RNAs derived fromviral genome. They retain the ability to replicate but lack theessential genes encoding the viral structural proteins and are thusunable to package into live virus particles. These non-infectiousreplicons are useful tools for studying viral replication, for antivi-ral screening and for the delivery of foreign genes (Scholle et al.,2004; Ng et al., 2007; Yun et al., 2007). Many replicons have beendeveloped from flaviviruses, including Kunjin virus (Khromykh andWestaway, 1997), dengue virus (Pang et al., 2001; Alvarez et al.,2005; Suzuki et al., 2007; Ng et al., 2007; Mosimann et al., 2010),tick-borne encephalitis virus (Gehrke et al., 2003; Hayasaka et al.,2004), yellow fever virus (Corver et al., 2003), Japanese encephali-tis virus (Yun et al., 2007), Omsk hemorrhagic fever virus (Yoshiiand Holbrook, 2009) and WNV (Shi et al., 2002; Scholle et al., 2004;Rossi et al., 2005; Maeda et al., 2008). Most of these replicons areunder the control of an SP6 or T7 promoter and have to be preparedby in vitro transcription before they can be used.

DNA-based replicons under the control of a cytomegalovirus(CMV) promoter have been described and shown to be effectivein both cell culture and animal models (Johnson et al., 2007). TheseDNA-based replicons have many advantages over RNA-based repli-cons. First, DNA-based replicons are in the form of plasmids andcan be transfected directly into eukaryotic cells without in vitrotranscription (Varnavski et al., 2000). Second, these replicons are

comparably stable and can be taken up efficiently by the host(Huang et al., 2009). Third, DNA replicons can induce strong cyto-toxic T cell responses and enhance interferon � (IFN-�) secretionprofiles (Rattanasena et al., 2011). A series of DNA-based WNV

88 F. Cao et al. / Journal of Virological Methods 178 (2011) 87– 93

Table 1Oligonucleotide primers used in this study.

Primera Sequence (5′–3′)b Positionc Restrictionsites

CMV-5UTR-F ACATCTACGTATTAGTCATCGCTATTACC SnaBI5UTR-R CGAGATCTTCGTGCTAAGAAACAG 73–965UTR-C-F GAAGATCTCGATGTCTAAGAAAC 87–109C99-R TAGTCTACGACGCGTCGACTGCAGAACCAATGCATGCTCCGCCG 385–393 MluI (bold)

NsiI (italic)E26-NS1-F CGAACGCGTGCTCGTGACAGGTCCATA 2392–2409 MluINS2A-R CAAGCATCTCAGCCCGGGTGTTAACAG 4006–4032 XmaINS5-F TCACTAGGTACCGCAAAGAGGCCATCATCGAAG 7751–7783 KpnINS5-R AGCTTTGTTTAAACGGCGCGCTTGGCGCGCCTTACAGTACTGTGTCCTC 10,381–10,398 PmeI (bold)

AscI (italic)3UTR-F ATTGTTTAAACATACTTTATCAATTGTAAATAGAC 10,399–10,422 PmeI3UTR-R AGATCCTGTGTTCTCGCACCACCAGCCACCATT 10,996–11,028HDVr-SV40-F GAGAACACAGGATCTGGCCGGCATGGTCCCAGCCTCCTCGCTGGtGCC 11,014–11,028 KasI�d

HDVr-SV40-R GTATAGGGCGGCGCCTACAATCCATGCCAACCCGTTCCATGTGCT KasIeGFP-F CCAATGCATGCCACCATGGTGAGCAAG NsiIeGFP-2A-R ATCGACGCGTAGGACCAGGGTTACTTTCAACGTCACCAGCAAGCTTTAGTAGGTCGAAGTTCTTGTACAGCTCGT

CCATGCCGAGAGTGATMluI

Rluc-F CCAATGCATGCCACCATGGCTTCGAAAGTT NsiIRluc-2A-R ATCGACGCGTAGGACCAGGGTTACTTTCAACGTCACCAGCAAGCTTTAGTAGGTCGAAGTTGATAGATCTTT

GTTCATTTTTGAGAACTCGCTCMluI

3′RT-F AGGACCTGGCTGTTTGAGAAT 9625–96453′RT-R AATATGCTGTTTTGTTGTGGTGT 10,908–10,930

a F, viral genomic sense; R, complementary sense...t C to

ra

2

2

bcacc(bc

2

mbfipus

2

WWpeyCCup

b Viral sequences are underlined. Italicized sequences represent the 2A sequencec The number represents the base position in the genome of WNV strain Chin-01d Kas I� represents the knockout of a KasI site in the replicon sequence by a silen

eplicons were constructed and characterized functionally in vitrond in vivo.

. Materials and methods

.1. Cells and virus

Baby hamster kidney (BHK21) cells were maintained in Dul-ecco’s modified Eagle’s media (DMEM; Invitrogen, Carlsbad, CA)ontaining 8% fetal bovine serum (FBS) and 100 U/ml of penicillinnd 100 �g/ml of streptomycin. Isolated primary mouse spleno-ytes were cultured in RPMI-1640 media containing 10% FBS. Allells were maintained at 37 ◦C in 5% CO2. WNV strain Chin-01GenBank accession number: AY490240) stock was prepared in therains of suckling mice, and the titer was determined on BHK21ells by a standard plaque-forming assay (Li et al., 2010).

.2. Plasmid construction

All of the molecular constructs were prepared using standardolecular biology techniques, and their sequences were confirmed

y restriction digest analysis and sequencing. All of the PCR ampli-cations for subsequent cloning were performed using LA Taq DNAolymerase (TaKaRa, Dalian, China). The sequences of the primerssed for the construction of various WNV replicon vectors and con-tructs are shown in Table 1.

.2.1. DNA-based WNV repliconA DNA fragment comprising nucleotides 3268–11,028 of the

NV genome was obtained from a full-length infectious clone ofNV (Li et al., 2010) by digestion with ApaI and NotI. The resulting

roduct was cloned into the plasmid pWNIIrep-REN-IB (Piersont al., 2006), which had been digested using the same enzymes,ielding the plasmid pWNrep-1. A PCR fragment containing the

MV promoter was obtained from pWNIIrep-REN-IB using primersMV-5UTR-F and 5UTRR. This fragment was then engineered to bepstream of the 5′UTR of WNV genome by overlapping PCR usingrimers 5UTR-C-F and C99-R. The resulting product was digested

T substitution.

with SnaBI and MluI and ligated to a MluI–XmaI fragment contain-ing nucleotides 2392–4032 of the WNV genome (obtained fromthe cDNA of the WNV genome by PCR using primers E26-NS1-Fand NS2A-R), resulting in the product consisting of the CMV pro-moter, 5′UTR and the sequence encoding the first 99 aa of C proteinand the last 26 aa of E protein as well as part of the NS proteinsof WNV. This product was then cloned into the pWNrep-1 plas-mid, which had been digested with SnaBI and XmaI, to generateplasmid pWNrep-2. A DNA fragment containing the hepatitis deltavirus ribozyme (HDVr) sequence followed by the simian virus 40(SV40) polyadenylation sequence was obtained from pWNIIrep-REN-IB by PCR using primers HDVr-SV40-F and HDVr-SV40-R. Thisproduct was fused downstream of the 3′UTR by overlapping PCRusing primers 3UTR-F and 3UTR-R. This resulting product was thendigested with PmeI and KasI, ligated to a KpnI–PmeI fragment com-prising nucleotides 7763–10,398 of the WNV genome (obtainedfrom the cDNA of WNV genome by PCR using primers NS5F andNS5R), and introduced into KpnI–KasI digested pWNrep-2, yieldingthe final plasmid pWNrep.

2.2.2. DNA-based WNV reporter repliconsDNA fragments encoding the 2A protease of foot-and-mouth

disease virus (FMDV) fused immediately downstream of thesequence encoding either the enhanced green fluorescent pro-tein (eGFP) or Renilla luciferase (Rluc) were amplified from thepEGFP-N1 vector (using the primer set eGFP-F and eGFP-2A-R)and pWNIIrep-REN-IB (using the primer set Rluc-F and Rluc-2A-R), respectively. The resulting products were cloned into pWNrepusing NsiI and MluI sites, resulting in the plasmids pWNrep/eGFPand pWNrep/Rluc, respectively. To construct the negative controlpWNrep/Rluc�NS5 (Jones et al., 2005), which contained a deletionof the NS5 gene of WNV, pWNrep/Rluc was digested with BstXIto remove nucleotides 5987–9179 by standard molecular cloningtechniques.

2.2.3. pcDNA/NS1In order to obtain WNV NS1 antigens for evaluating the immune

response in mice, the pcDNA/NS1 plasmid encoding the full length

ogical

N(ar

2

woU

2

wwcp

2fmaLm

2

6Gswt3go

2

nmtitnbnbfntataiB

2

WNB

F. Cao et al. / Journal of Virol

S1 protein of WNV was constructed based on the pcDNA3.1 vectorInvitrogen, Carlsbad, USA). The full-length of NS1 gene was clonednd introduced into pcDNA3.1 digested with BamHI and XbaI. Theesulting plasmid pcDNA/NS1 was confirmed by DNA sequencing.

.3. Transfection of the DNA-based replicons

Approximately 80% confluent monolayers of BHK21 cells in 12-ell plates were transfected with 1.6 �g of pWNrep, pWNrep/eGFP

r pWNrep/Rluc by using Lipofectamine 2000 (Invitrogen, Carlsbad,SA) according to the manufacturer’s instructions.

.4. Reporter gene assay

Various amounts of transfected cells were seeded into a 12-ell plate. Transient expression of eGFP in the transfected cellsas visualized by fluorescence microscopy. The eGFP-expressing

ells were imaged at different time points (0, 24, 30, and 48 h)ost-transfection.

For luciferase assay, the transfected cells were harvested at 12,4, 36, 48 and 60 h post-transfection. Triplicate wells were seededor each time point. Luciferase activity assays were initiated by

ixing 10 �l of prepared cell extract with 50 �l of Rluc substrate,nd measured using a single-tube luminometer by using the Renillauciferase Assay system (Promega, Madison, USA) according to theanufacturer’s instruction.

.5. RT-PCR

Total RNA was extracted from the replicon-transfected cells at0 h post-transfection using an RNeasy Mini Kit (Qiagen, Hilden,ermany) according to the manufacturer’s protocol. Template-pecific RT-PCR was then performed in two steps. The RT reactionsere carried out using the 3′RT-R primer. PCR was performed using

he 3′RT-F and 3′RT-R primers (Table 1) for the detection of WNV′UTR fragment. The PCR products were separated on a 1% agaroseel and visualized by ethidium bromide staining under an ultravi-let lamp.

.6. Animal immunization

Group of female BALB/c mice (4 weeks old, n = 10) were immu-ized with the DNA-based WNV replicon pWNrep (100 �g perouse) in the quadriceps muscles using a WJ-2002 gene pulse

ransfer apparatus (Scientz, NingBo, China). Control groups weremmunized following the same protocol with either the empty vec-or plasmid (pVec, n = 10) or the phosphate buffered saline (PBS,

= 10). Following the first immunization, the mice were given aooster immunization every 2 weeks for a total of three immu-izations. Serum samples for further testing were collected by tailleeding 7 days after each immunization and pooled to be usedor indirect immunofluorescence assay (IFA) and plaque reductioneutralization test (PRNT). Thirteen weeks after the first immuniza-ion, mice were sacrificed, and the spleens of 3 mice were removedseptically for in vitro splenocytes culture to be used to evaluatehe cellular response. All animal experiments were approved bynd performed according to the guidelines of the Animal Exper-ment Committee of the State Key Laboratory of Pathogen andiosecurity.

.7. IFA

IFAs were used to measure the levels of IgG antibodies againstNV NS1 in the sera of immunized mice. To prepare the WNV

S1-expressing antigen slides, pcDNA/NS1 was transfected intoHK21 cells. Briefly, a series of two-fold dilutions of the pooled

Methods 178 (2011) 87– 93 89

sera were incubated at 37 ◦C for 1 h on the prepared NS1 anti-genic slides. Then, FITC-conjugated goat anti-mouse IgG in Evansblue was added, and the slides were incubated at 37 ◦C for another30 min. After 3 washes with PBS, the slides were observed using afluorescence microscope.

2.8. PRNT

Standard PRNT assays were performed to determine the levelof neutralizing antibodies against WNV in the sera of immunizedmice. Briefly, all pooled sera from each group were diluted serially2-fold from 1:10, heat-inactivated at 56 ◦C, and assayed on BHK21cells. Each sample was incubated with 150 PFU of WNV solution at37 ◦C for 1 h, and the infected cells were then washed and overlaidwith 2% low-melting-point agarose in 2× DMEM media supple-mented with 4% FBS. The plaques were stained with crystal violetand were counted after 4–6 days of incubation at 37 ◦C with 5% CO2.The neutralizing antibody titer is expressed as the reciprocal of theendpoint serum dilution that reduced the challenge virus plaquecounts by 50% based on the back titration.

2.9. Preparation of stimulating antigen

When NS1 protein was expressed efficiently in pcDNA/NS1transfected BHK21 cells and identified with IFA, the transfectedcells were harvested with trypsinization at 48 h post transfection,diluted with RPMI-1640, then centrifugated at 1000 rpm for 5 min.After lysing the cells by freeze-thawing the cell precipitate 3 times,2 �l of 0.1 mM phenylmethanesulfonyl fluoride was added. At last,the cell lysates were adjusted to a working concentration with RPMI1640 containing 10% FBS for lymphocyte proliferation test.

2.10. Lymphocyte proliferation test

For the lymphocyte proliferation test, spleens from the immu-nized mice were excised 13 weeks after the first immunizationand ground with the plunger from a 10 ml syringe through a200-mesh cell grinder into a petri dish with 5 ml Tris–NH4Cl (pH7.2). The splenocytes were adjusted to a working concentration of1 × 106 cells/ml in RPMI-1640. Then, 100 �l of lymphocytes wasplated in triplicate into the wells of a 96-well plate, stimulatedwith WNV NS1 stimulating antigen or with concanavalin A (ConA,positive control), and incubated at 37 ◦C in a 5% CO2 incubatorfor 72 h. Non-stimulated splenocytes were assayed as negativecontrol. Afterward, 20 �l of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)was added to each well, and the plates were incubated foranother 2 h. The OD490 was read on a microplate reader (Beckman,Munchen, German), and the stimulation index (SI) was calculatedas previously described (Chu et al., 2007).

2.11. IFN-� assay

IFN-� secretion by sensitized splenocytes was assessed as pre-viously described (Huang et al., 2009). Briefly, the lymphocyteswere collected as above, seeded into a 12-well plate, and thenco-incubated with the WNV NS1 protein. Splenocytes stimulatedwith ConA were assayed as the positive control, and unstimulatedsplenocytes were assayed as the negative control. After 72 h ofincubation, the cell supernatants were subjected to a commercial

enzyme-linked immunosorbent assay (ELISA) (ExCell, Shanghai,China) according to the manufacturer’s instructions. The OD490 ofeach sample was determined on a microplate reader. Each samplewas assayed in triplicate.

90 F. Cao et al. / Journal of Virological Methods 178 (2011) 87– 93

Fig. 1. Construction of the DNA-based WNV replicons. (A) Schematic representations of the pWNrep, pWNrep/eGFP, pWNrep/Rluc and pWNrep/Rluc�NS5 plasmids. Allstructural elements are arranged sequentially downstream of the CMV promoter. Dotted box indicates the deleted region of the WNV genome. “ ” indicates the HindIIIr The fow ctivel

2

at

3

3r

ltsie

stccaopa6t

a

estriction site. (B) Identification of DNA-based WNV replicons by enzyme digestion.

ere digested with Hind III and analyzed by DNA electrophoresis (lanes 1–4), respe

.12. Statistical analysis

GraphPad Prism and Student’s t-test were used to graph andnalyze data, respectively. p values less than 0.05 were consideredo indicate statistical significance.

. Results

.1. Construction and characterization of DNA-based WNVeplicons

In this study, a series of subgenomic replicons of the WNVineage I strain Chin-01 were constructed successfully under theranscriptional control of a CMV promoter (Fig. 1A). The nucleotideequences of these plasmids were confirmed by DNA sequenc-ng, and the lengths of the replicons were confirmed by restrictionndonuclease digestion (Fig. 1B).

It was demonstrated that the level of reporter gene expres-ion is correlated with the level of genome replication in cellsransfected with a viral replicon (Puig-Basagoiti et al., 2005). Toharacterize the replication activity of DNA-based WNV repli-ons in mammalian cells, the replication of pWNrep/eGFP wasssayed in BHK21 cells. As shown in Fig. 2A, green fluorescence wasbserved in the pWNrep/eGFP-transfected cells at different timesost-transfection. The highest number of positive cells appearedt 30 h after transfection, with some cells remaining positive until

0 h post-transfection. As expected, no fluorescence is observed inhe mock-transfected cells.

Replicon pWNrep/Rluc was transfected into BHK21 cells,nd the luciferase activity was measured at different times

ur replicon plasmids (pWNrep, pWNrep/eGFP, pWNrep/Rluc and pWNrep/Rluc�NS5)y.

post-transfection. The replication-defective repliconpWNrep/Rluc�NS5 was simultaneously transfected into BHK21cells as a negative control. The time course of Rluc activity isshown in Fig. 2B. The first peak occurred at 24 h post-transfection,followed by a rapid decrease until the second peak appeared at60 h post-transfection. For the pWNrep/Rluc�NS5-transfected cells,the luciferase activity reached a peak at 12 h post-transfection andthen declined rapidly to background level due to a deficiency inreplication, as expected (Fig. 2B).

The replication of all of the DNA-based WNV replicons at 60 hpost-transfection was confirmed by RT-PCR using primers specificfor WNV 3′UTR. A PCR-amplified product of the expected size wasobtained from cells transfected with pWNrep/Rluc but not fromthose transfected with pWNrep/Rluc�NS5 (Fig. 2C). These resultsindicate that DNA-based WNV replicons can replicate efficientlyand express foreign proteins in mammalian cells.

3.2. Antibody response induced by the DNA-based WNV replicon

To analyze further the potential of DNA-based replicons as vac-cine candidates, mice were immunized with pWNrep, and theantibody response was measured by IFA and PRNT. Flavivirus NS1protein has been demonstrated to be one of the protective antigens(Chung et al., 2006), thus the IgG antibody response against WNVNS1 was determined firstly by IFA. As expected, a high titer of IgGantibodies was observed 13 weeks after immunization with pWN-

rep (1:160), while no NS1-specific antibody (<1:10) was observedin the control groups (pVec and PBS).

The titer of neutralizing antibodies against WNV in the seraof mice was then assayed using a standard PRNT. As shown in

F. Cao et al. / Journal of Virological Methods 178 (2011) 87– 93 91

Fig. 2. Characterization of DNA-based WNV replicons. (A) BHK21 cells transfected with pWNrep/eGFP were observed at 0, 24, 30 and 60 h (from left to right) post-transfection.(B) The expression of Rluc over time in the replicon-transfected cells was indicated by an Rluc activity assay. BHK21 cells were transfected with equimolar amounts ofplasmids pWNrep/Rluc and pWNrep/Rluc�NS5. Luciferase activity value was measured in a single-tube luminometer by using a Renilla luciferase assay kit. (C) Detection ofR /Rluc�

R ” reprw

Ftdtddc

3r

b

FSlt(

NA replication by RT-PCR. Cytoplasmic RNA from the pWNrep/Rluc- and pWNrepT-PCR. RNA extracted from mock-transfected cells was used as a control (Cont); “+eight of the DNA fragment is indicated at the left of the panel.

ig. 3, the primary immunization with 100 �g of pWNrep inducedhe production of anti-WNV neutralizing antibodies (1:19). After 3oses of immunization, the neutralizing antibody titer increasedo 1:55 finally. As expected, WNV-specific antibodies were notetected in sera from the pVec- or PBS-treated mice. These resultsemonstrate that immunization with a DNA-based WNV repliconan induce humoral immune response against WNV in mice.

.3. Cellular immune response induced by the DNA-based WNV

eplicons

To characterize the cell-mediated immune response inducedy pWNrep, mice were killed 13 weeks after the primary

ig. 3. Neutralizing antibody response induced by the DNA-based WNV replicon.erum samples (pooled from mice immunized with pWNrep, pVec and PBS were col-ected at the indicated time points after the primary immunization) were subjectedo PRNT to determine the neutralizing antibody titers. No neutralizing antibody<1:10) was detected for the pVec and PBS groups.

NS5-transfected cells (lanes 1 and 2, respectively) was amplified by 3′UTR-specificesents the positive control, and “−” represents the negative control. The molecular

immunization, and the splenocyte proliferation-based MTT assaywas performed by ELISA. Distinct proliferation was observed insplenocytes from the pWNrep-immunized group, yielding an SI of8.9, which is much higher than that of the pVec and PBS groups(Fig. 4A). IFN-� secreted by activated splenocytes from each groupwas further examined by ELISA. The IFN-� concentration from thepWNrep group was higher than that from the pVec and PBS groups(p < 0.01) (Fig. 4B). These results indicate that immunization withthe pWNrep replicon induces lymphocyte proliferation and IFN-�production in mice.

4. Discussion

The construction and potential applications of DNA-basedsubgenomic replicons of WNV, which allow efficient in vitro orin vivo replication of subgenomic and foreign gene RNAs from thecorresponding plasmid DNAs are described. Humoral and cellularimmune responses against WNV are induced by the DNA-basedWNV replicons.

RNA-based flavivirus replicons have been described previously,and they provided a useful starting point for the construction ofDNA-based replicons. Previous studies on Kunjin virus have indi-cated that the first 20 codons of the C protein are essential for afunctional RNA-based replicon (Khromykh and Westaway, 1997).The C-terminal 24 residues of the E protein are known to function asa signal sequence for the NS1 protein (Jones et al., 2005). Thus, theDNA-based WNV replicons constructed in this study retained theC99 and E26 sequences. HDVr and the SV40 polyadenylation signalwere also included downstream of the 3′UTR in these DNA-based

WNV replicons to facilitate the replication of a “DNA-launched”replicon (Pierson et al., 2006). A replicon with a deletion of NS5was employed as a negative control in this study, based on thework of other groups that have introduced the GDD → GND muta-

92 F. Cao et al. / Journal of Virological

Fig. 4. Cellular immune response induced by the DNA-based WNV replicon. (A)Splenocytes were examined for specific proliferative responses to WNV NS1 pro-tein by ELISA. The pWNrep-immunized group showed a statistically significantlyhigher response than the pVec-immunized group (*p < 0.01) and the PBS-immunizedgroup (**p < 0.01). (B) IFN-� secreted by NS1-stimulated splenocytes was assayed byErg

t1

ctwocTbtlu

cvfrAcavfie

sedN2

LISA. The pWNrep-immunized group showed a statistically significantly differentesponse versus both the pVec-immunized group (*p < 0.05) and the PBS-immunizedroup (**p < 0.01).

ion in the NS5 gene (Alcaraz-Estrada et al., 2010; Khromykh et al.,998).

The DNA-based WNV replicons constructed in this study repli-ated efficiently and expressed foreign proteins successfully. Theime course of Rluc activity in cells transfected with pWNrep/Rlucas similar to that in cells transfected with an RNA-based replicon

r with WNV viral-like particles (VLPs), consisting of 2 peaks indi-ating different stages of translation (Puig-Basagoiti et al., 2005).hese DNA-based replicons in the form of plasmids are very sta-le, and in contrast to the traditional RNA-based replicon system,here is no need to produce RNA in vitro prior to transfection. DNA-aunched WNV replicons undoubtedly simplify and improve thetility of the WNV replicon for further applications.

Flavivirus replicons are useful tools for understanding the repli-ation of viruses and have been explored for antiviral screening andaccine development. High-throughput antiviral-screening assaysor WNV and dengue virus based on cells harboring a reportereplicon have been developed (Lo et al., 2003; Qing et al., 2010).

series of chimeric vaccines and single-round infectious parti-le (SRIP) vaccines with a flavivirus replicon as a backbone havelso been developed. ChimeriVax-WN02, a YF17D/WN chimericaccine based on a YF17D replicon, has been evaluated success-ully in non-human primates (Monath et al., 2006). RepliVAX WNs a novel single-cycle WNV vaccine under development (Widmant al., 2010).

Previously, immunization with flavivirus NS1 has been demon-trated to elicit a protective humoral immune responses (Chung

t al., 2006). However, the mechanism of protection is poorlyefined. A study using monoclonal antibodies demonstrated thatS1-specific antibodies of a given IgG subclass (e.g. mouse IgGa) are recognized by activating Fc-� receptors (mouse Fc-�R

Methods 178 (2011) 87– 93

I or IV) resulting in phagocytosis and clearance of the infectedcell (Diamond et al., 2008). Our results showed that IgG anti-body anti-NS1 was induced in the pWNrep-immunized mice.Most importantly, neutralizing antibody was also induced in thepWNrep-immunized mice. Previously, immunization with NS1protein was shown to induce neutralizing antibody and protectagainst yellow fever virus in monkeys (Schlesinger et al., 1986).Falconar (2008) demonstrated that anti-NS1 monoclonal antibod-ies could neutralize different dengue virus serotypes due to sharedepitopes within the E protein. Flavivirus NS1 is highly conserved,so the neutralizing antibodies in the pWNrep-immunized mice aremost probably induced by epitopes in this protein. Whatever themechanism of neutralization in this particular case, it deserves fur-ther investigation.

Additionally, the NS1 protein is also reported to induce bothantibody-dependent cellular cytotoxicity and complement fixingactivity (Lieberman et al., 2007). Peptide epitopes processed fromNS proteins may be recognized by CD8+ or CD4+ T lymphocyteswhich can function as cytotoxic T cell and eliminate cells infectedwith virus (Mathew et al., 1996). The splenocytes from pWNrep-immunized mice exhibited lymphocyte proliferation and IFN-�production, further demonstrating that expressed NS proteins fromDNA-based WNV replicon can induce T cell memory and CTLsresponse. Synthesis of double-stranded RNA during KUN RNA repli-cation is known to facilitate the production of immune-enhancingcytokines and to activate protein kinase-dependent antigen pre-sentation pathways (Varnavski et al., 2000). Thus, cellular immuneresponses that play important roles in protection against viralinfection are probably induced by a DNA-based WNV replicon.

In summary, a series of DNA-based WNV replicons was con-structed and characterized functionally, and immunization withthe DNA-based replicons was shown to induce humoral and cel-lular immune responses in mice. These findings provide a usefulplatform for further study and have potential to facilitate the devel-opment of flavivirus replicons for use in vaccine development andantiviral screening.

Acknowledgments

This work was supported by the National Natural Science Foun-dation of China (Nos. 30972613 and 31000083) and the MajorSpecial Program of National Science and Technology of China (No.2009ZX10004-015 and No. 2008ZX10004-015). We would like tothank Dr. Robert W. Doms (University of Pennsylvania School ofMedicine, USA) for providing the WNIIrep-REN-IB plasmid andShun-Ya Zhu for invaluable assistance with cell culture.

References

Alcaraz-Estrada, S.L., Manzano, M.I.M., Angel, R.M.D., Levis, R., Padmanabhan, R.,2010. Construction of a dengue virus type 4 reporter replicon and analysis oftemperature-sensitive mutations in non-structural proteins 3 and 5. J. Gen. Virol.91, 2713–2718.

Alvarez, D.E., De Lella Ezcurra, A.L., Fucito, S., Gamarnik, A.V., 2005. Role of RNAstructures present at the 3′UTR of dengue virus on translation, RNA synthesis,and viral replication. Virology 339, 200–212.

Chambers, T.J., Hahn, C.S., Galler, R., Rice, C.M., 1990. Flavivirus genome organization,expression, and replication. Annu. Rev. Microbiol. 44, 649–688.

Corver, J., Lenches, E., Smith, K., Robison, R.A., Sando, T., Strauss, E.G., Strauss, J.H.,2003. Fine mapping of a cis-acting sequence element in yellow fever virus RNAthat is required for RNA replication and cyclization. J. Virol. 77, 2265–2270.

Chu, J.H., Chiang, C.C., Ng, M.L., 2007. Immunization of flavivirus West Nile recom-binant envelope domain III protein induced specific immune response andprotection against West Nile virus infection. J. Immunol. 178, 2699–2705.

Chung, K.M., Nybakken, G.E., Thompson, B.S., Engle, M.J., Marri, A., Fremont, D.H.,

Diamond, M.S., 2006. Antibodies against West Nile virus nonstructural pro-tein NS1 prevent lethal infection through Fc gamma receptor-dependent and-independent mechanisms. J. Virol. 80, 1340–1351.

Diamond, M.S., Pierson, T.C., Fremont, D.H., 2008. The structural immunology ofantibody protection against West Nile virus. Immunol. Rev. 225, 212–225.

ogical

F

G

H

H

J

J

K

K

L

L

L

M

M

M

M

N

F. Cao et al. / Journal of Virol

alconar, A.K., 2008. Monoclonal antibodies that bind to common epitopes on thedengue virus type 2 nonstructural-1 and envelope glycoproteins display weakneutralizing activity and differentiated responses to virulent strains: implica-tions for pathogenesis and vaccines. Clin. Vaccine Immunol. 15, 549–561.

ehrke, R., Ecker, M., Aberle, S.W., Allison, S.L., Heinz, F.X., Mandl, C.W., 2003. Incor-poration of tick-borne encephalitis virus replicons into virus-like particles by apackaging cell line. J. Virol. 77, 8924–8933.

ayasaka, D., Yoshii, K., Ueki, T., Iwasaki, T., Takashima, I., 2004. Sub-genomic repli-cons of tick-borne encephalitis virus. Arch. Virol. 149, 1245–1256.

uang, Q., Yao, Q., Fan, H., Xiao, S., Si, Y., Chen, H., 2009. Development of a vaccinevector based on a subgenomic replicon of porcine reproductive and respiratorysyndrome virus. J. Virol. Methods 160, 22–28.

ohnson, R.E., Beard, C., Montefiori, D.C., Thompson, J.M., Kraus, A.A., Kraus, M.L.,Shabman, R.S., Moran, T.P., Fluet, M.E., Whitmore, A.C., Ljungberg, K., 2007.Increased immunogenicity of a DNA-launched Venezuelan equine encephalitisvirus-based replicon DNA vaccine. J. Virol. 370, 22–32.

ones, C.T., Patkar, C.G., Kuhn, R.J., 2005. Construction and applications of yellowfever virus replicons. Virology 331, 247–259.

hromykh, A.A., Westaway, E.G., 1997. Subgenomic replicons of the flavivirus Kun-jin: construction and applications. J. Virol. 71, 1497–1505.

hromykh, A.A., Kenney, M.T., Westaway, E.G., 1998. Trans-complementation of fla-vivirus RNA polymerase gene NS5 by using Kunjin virus replicon-expressingBHK cells. J. Virol. 72, 7270–7279.

i, X.F., Jiang, T., Yu, X.D., Deng, Y.Q., Zhao, H., Zhu, Q.Y., Qin, E.D., Qin, C.F., 2010.RNA elements within the 5′UTR of West Nile virus genome are critical for RNAsynthesis and viral replication. J. Gen. Virol. 91, 1218–1223.

ieberman, M.M., Clements, D.E., Ogata, S., Wang, G., Corpuz, G., Wong, T., Martyak,T., Gilson, L., Coller, B.A., Leung, J., Watts, D.M., Tesh, R.B., Siirin, M., Rosa, A.T.,Humphreys, T., Weeks-Levy, C., 2007. Preparation and immunogenic propertiesof a recombinant West Nile subunit vaccine. Vaccine 25, 414–423.

o, M.K., Tilgner, M., Shi, P.Y., 2003. Potential high-throughput assay for screeninginhibitors of West Nile virus replication. J. Virol. 77, 12901–12906.

aeda, J., Takagi, H., Hashimoto, S., Kurane, I., Maeda, A., 2008. A PCR-based protocolfor generating West Nile virus replicons. J. Virol. Methods 148, 244–252.

athew, A., Kurane, I., Rothman, A.L., Zeng, L.L., Brinton, M.A., Ennis, F.A., 1996.Dominant recognition by human CD8+ cytotoxic T lymphocytes of dengue virusnonstructural proteins NS3 and NS1.2a. J. Clin. Invest. 98, 1684–1691.

onath, T.P., Liu, J., Kanesa-Thasan, N., Myers, G.A., Nichols, R., Deary, A., McCarthy,K., Johnson, C., Ermak, T., Shin, S., Arroyo, J., Guirakhoo, F., Kennedy, J.S., Ennis,F.A., Green, S., Bedford, P., 2006. A live, attenuated recombinant West Nile virusvaccine. Proc. Natl. Acad. Sci. U.S.A. 103, 6694–6699.

osimann, A.L.P., Borba, L., Bordignon, J., Manson, P.W., Santos, C.N.D., 2010. Con-struction and characterization of a stable subgnomic replicon system of aBrazilian dengue virus type 3 strain (BR DEN3 290-02). J. Virol. Methods 163,

147–152.

g, C.Y., Gu, F., Phong, W.Y., Chen, Y.L., Lim, S.P., Davidson, A., Vasudevan, S.G., 2007.Construction and characterization of a stable subgenomic dengue virus type 2replicon system for antiviral compound and siRNA testing. Antiviral Res. 76,222–231.

Methods 178 (2011) 87– 93 93

Pang, X., Zhang, M., Dayton, A.I., 2001. Development of dengue virus type 2 repliconscapable of prolonged expression in host cells. BMC Microbiol. 1, 18.

Pierson, T.C., Sánchez, M.D., Puffer, B.A., Ahmed, A.A., Geiss, B.J., Valentine, L.E., Alta-mura, L.A., Diamond, M.S., Doms, R.W., 2006. A rapid and quantitative assayfor measuring antibody-mediated neutralization of West Nile virus infection.Virology 346, 53–65.

Posadas-Herrera, G., Inoue, S., Fuke, I., Muraki, Y., Mapua, C.A., Khan, A.H., Parquet,M.C., Manabe, S., Tanishita, O., Ishikawa, T., Natividad, F.F., Okuno, Y., Hasebe,F., Morita, K., 2010. Development and evaluation of a formalin-inactivatedWest Nile Virus vaccine (WN-VAX) for a human vaccine candidate. Vaccine 28,7939–7946.

Puig-Basagoiti, F., Deas, T.S., Ren, P., Tilgner, M., Ferguson, D.M., Shi, P.Y., 2005. High-throughput assays using a luciferase-expressing replicon, virus-like particles,and full-length virus for West Nile virus drug discovery. Antimicrob. AgentsChemother. 49, 4980–4988.

Qing, M., Liu, W., Yuan, Z., Gu, F., Shi, P.Y., 2010. A high-throughput assay usingdengue-1 virus-like particles for drug discovery. Antiviral Res. 86, 163–171.

Rattanasena, P., Anraku, I., Gardner, J., Le, T.T., Wang, X.J., Khromykh, A.A., Suhrbier,A., 2011. Prime-boost vaccinations using recombinant flavivirus replicon andvaccinia virus vaccines: an ELISPOT analysis. Immunol. Cell Biol. 89, 426–436.

Rossi, S.L., Zhao, Q., O’Donnell, V.K., Mason, P.W., 2005. Adaptation of West Nile virusreplicons to cells in culture and use of replicon-bearing cells to probe antiviralaction. Virology 331, 457–470.

Schlesinger, J.J., Brandriss, M.W., Cropp, C.B., Monath, T.P., 1986. Protection againstyellow fever in monkeys by immunization with yellow fever virus nonstructuralprotein NS1. J. Virol. 60, 1153–1155.

Scholle, F., Girard, Y.A., Zhao, Q., Higgs, S., Mason, P.W., 2004. Trans-packaged WestNile virus-like particles: infectious properties in vitro and in infected mosquitovectors. J. Virol. 78, 11605–11614.

Shi, P.Y., Tilgner, M., Lo, M.K., 2002. Construction and characterization of subgenomicreplicons of New York strain of West Nile virus. Virology 296, 219–233.

Suzuki, R., de Borba, L., Duarte dos Santos, C.N., Mason, P.W., 2007. Construction ofan infectious cDNA clone for a Brazilian prototype strain of dengue virus type1: characterization of a temperature-sensitive mutation in NS1. Virology 362,374–383.

Varnavski, A.N., Young, P.R., Khromykh, A.A., 2000. Stable high-level expression ofheterologous genes in vitro and in vivo by noncytopathic DNA-based Kunjin virusreplicon vectors. J. Virol. 74, 4394–4403.

Widman, D.G., Ishikawa, T., Giavedoni, L.D., Hodara, V.L., Garza, M., Montalbo, J.A.,Rosa, A.P.T., Tesh, R.B., Patterson, J.L., Carrion Jr., R., Bourne, N., Mason, P.W.,2010. Evaluation of RepliVAX WN, a single-cycle flavivirus vaccine, in a non-human primate model of West Nile virus infection. Am. J. Trop. Med. Hyg. 82,1160–1167.

Yoshii, K., Holbrook, M.R., 2009. Sub-genomic replicon and virus-like particles of

Omsk hemorrhagic fever virus. Arch. Virol. 154, 573–580.

Yun, S.I., Choi, Y.J., Yu, X.F., Shin, Y.H., Ju, Y.R., Kim, S.Y., Lee, Y.M., 2007. Engineer-ing the Japanese encephalitis virus RNA genome for the expression of foreigngenes of various sizes: implications for packaging capacity and RNA replicationefficiency. J. Neurovirol. 13, 522–535.