A Distinct Oncogenerative Multinucleated Cancer Cell ... · mission of malignant cells in patients...

Tumor Biology and Immunology

A Distinct Oncogenerative Multinucleated CancerCell Serves as a Source of Stemness and TumorHeterogeneityDavid Díaz-Carballo1, Sahitya Saka1, Jacqueline Klein1, Tobias Rennkamp1,Ali H. Acikelli1, Sascha Malak1, Holger Jastrow2, Gunther Wennemuth2,Clemens Tempfer3, Inge Schmitz4, Andrea Tannapfel4, and Dirk Strumberg1

Abstract

The effects of anticancer treatments on cell heterogeneity andtheir proliferative potential play an important role in tumorpersistence and metastasis. However, little is known about de-polyploidization, cell fate, and physiologic stemness of the result-ing cell populations. Here, we describe a distinctive cell typetermed "pregnant" P1 cells found within chemotherapy-refracto-ry ovarian tumors, which generate and gestate daughter genera-tion Gn cells intracytoplasmically. Release of Gn cells occurred byejection through crevices in the P1 cell membrane by bodycontractions or using a funiculus-like structure. These eventscharacterized a not yet described mechanism of cell segregation.Maternal P1 cells were principally capable of surviving parturitionevents and continued to breed and nurture Gn progenies. Inaddition, P1 cells were competent to horizontally transmit off-springGn cells into other specific proximal cells, injecting them toreceptor R1 cells via cell–cell tunneling. This process represents a

newmechanismusedby tumor cells to invade surrounding tissuesand ensure life cycles. In contrast to the pregnant P1 cells with lowexpression of stem cell markers despite their physiologic stem-ness, the first offspring generations of daughter G1 cells expressedhigh levels of ovarian cancer stem cell markers. Furthermore,both P1 and Gn cells overexpressedmultiple human endogenousretroviral envelope proteins. Moreover, programmed death-ligand 1 and the immunosuppressive domain of the retroviralenvelope proteins were also overexpressed in P1 cells, suggestingeffective protection against the host immune system. Together,our data suggest that P1 oncogenerative cancer cells exhibit a notyet described cell biological mechanism of persistence and trans-mission of malignant cells in patients with advanced cancers.

Significance: P1 oncogenerative cell entities express low levelsof CSC markers, which are characteristic of their histologicalorigin. Cancer Res; 78(9); 2318–31. �2018 AACR.

IntroductionEmbryonic stem cells (ESC) derive from the undifferentiated

inner mass of blastocysts. As pluripotent cells, they can differen-tiate into all derivatives of the three primary germ layers (1). Adultstem cells (ASC) are undifferentiated multipotent cells with thecapacity of self-renewal and generation of fully differentiateddaughter cells. They are virtually tissue resident, help maintaincellular homeostasis, and express high levels of ABC transporters.ASCs are capable of cell transdifferentiation, that is, generatingdifferentiated cell types of other histologies. ASC transdifferentia-

tion into pluripotent stem cells (iPSC) can be induced via Yama-naka's quadriga of transcription factors (2, 3).

The source of tumor cell heterogeneity is still under debatebecause the "cell of origin" has remained elusive. However,multiple conclusive lines of evidence suggest the existence ofcancer stem cells (CSC) with characteristics that are normallyassociated with ASCs, including the capacity for long-term self-renewal and multipotency, which contributes to tumor cell het-erogeneity, a hallmark of stem cells (4, 5). Despite their localizedorigin, CSCs can disseminate to distant sites. Another ASC-likecharacteristic is the overexpression of ABC transporters and DNArepair mechanisms, which play a critical role in untreatable malig-nancies. Moreover, under therapeutic treatment conditions, differ-entiated cancer cells may change their phenotype and alter theirbiology toward a more stem-like state to ensure survival (4–6).

A common phenomenon associated with cytostatic- and irra-diation-induced cell heterogeneity is believed to be the emergenceof multinucleated giant cell entities with CSC properties (7, 8).These cells can be generated via two different mechanisms:(i) endoreplication coupled with karyokinesis - endomitosis(plasmodium formation); and (ii) syncytin-mediated cell–cellfusion (syncytium formation). Endoreplication can be seen as adeviant form of the normal mitotic cell cycle in which mitosis iscompletely suppressed. Endomitosis is an abortive from ofmitosis that does not result in cell division but leads tothe formation of multinucleated giant cells (9, 10). Anothermultinucleated cell type arises from specific cell–cell fusionevents that are chiefly mediated by the fusogenic properties of

1Institute of Molecular Oncology and Experimental Therapeutics. Division ofHaematology and Oncology, Marienhospital Herne, Ruhr University Bochum,Medical School, Herne, Germany. 2Institute of Anatomy, University of Duisburg-Essen, Medical School, Essen, Germany. 3Gynaecology and Obstetrics, Marien-hospital Herne, Ruhr University Bochum, Medical School, Herne, Germany.4Institute of Pathology, Ruhr University Bochum, Medical School, Bochum,Germany.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: David Díaz-Carballo, Institute of Molecular Oncologyand Experimental Therapeutics, Marienhospital Herne, Ruhr University Bochum,Medical School, D€ungelstr. 33, Herne 44623, Germany. Phone: 4923-2349-91092; Fax: 4923-2349-91049; E-mail:[email protected]

doi: 10.1158/0008-5472.CAN-17-1861

�2018 American Association for Cancer Research.

CancerResearch

Cancer Res; 78(9) May 1, 20182318

on November 24, 2020. © 2018 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst February 12, 2018; DOI: 10.1158/0008-5472.CAN-17-1861

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-17-1861&domain=pdf&date_stamp=2018-4-19

http://cancerres.aacrjournals.org/

envelope proteins from exogenous or endogenous retroviruses(HERV), that is, HERV-WE1 and HERV-FRD1. Cell–cell fusionvia syncytins may generate both normal (syncytium tropho-blasts during placental development) and pathologic forms, asobserved, for example, in high-grade Reed–Sternberg cells,chemoresistant tumors or after viral infection, for example,with the syncytial respiratory virus (11, 12).

Although the two mechanisms differ vastly at the physiologiclevel, the final fate of many giant cells is the reverted multi-nucleation, which leads to the generation of daughter cells, thuspromoting tumor initiation and development (8, 13). Thetheory of cellularization states that in multinucleated cells, thenuclei may have developed internal perinuclear membranepartitions facilitating the formation of new cells. This processhas been described in Drosophila melanogaster embryos (14).However, to the best of our knowledge, the molecular mech-anism behind this process has not been studied in detail incancer cells.

Here, we document a distinctive cell type termed "pregnant" P1cells found within chemotherapy-refractory ovarian tumors thatgenerate daughterG1 cells intracytoplasmically by cellularization,which, upon gestation, are released into the immediate surround-ings. Strikingly, P1 cells can inject G1 cells into specific recipientcells (R1) via cell–cell tunneling, which represents a horizontaltransmission of the entire genome between cells, resulting in newtetraploid cell entities.

P1 appears to be a distinctive tumor cell type with intriguingstem cell biology. Phenotypic characterization shows that P1express very low levels of CSC markers in spite of their stem cellbiology (15). Interestingly, this is contrasted by the first genera-tion of progeny cells, which express a distinct signature of canon-ical CSCmarkers. Contrarily, P1 cells differentially produce moretranscripts of several stem cell markers in comparison with theiroffsprings.

Both P1 and G1 cells overexpress different human endogenousretroviral (HERV) envelope proteins containing the immunosup-pressive domain (ISD; ref. 16). The programmed death-ligand1 (PD-L1) immune checkpoint was found to be overexpressedtoo, suggesting the cellsmay be able to circumvent immune attackin a way observed in both cancer and pregnancy (17). Thus, P1cells may provide a sheltered immune- and therapy-resistantenvironment to guarantee the generation and gestation of newtumor cells. These findings represent an as-yet undocumentedmechanism of conferring drug resistance and persistence tomalignant cells and may provide a target for novel therapeuticstrategies.

Materials and MethodsCell lines, patient samples, and ethical considerations

All cells were obtained from the cell and tumor bank of theMarienhospital Herne (Herne, Germany). This study wasreviewed and approved by the Ethics Committee of the RuhrUniversity of Bochum, Medical School (Herne, Germany; registernumbers: 5235-15, 5416-15, 17-6114).

Generation of 3D spheroids from single P1 and G1 cellsTo analyze P1 cell heterogeneity, we cultivated single P1 andG1

cells in hanging drops to enable clonal proliferation in nonad-herent conditions and simulate the natural tumor architecture(18). Cells of different sizes (<80 mm) were picked using a

TransferMan 4r micromanipulator (Eppendorf) and washed in25 mL DMEM. Next, the cells were placed in approximately 25 mLon a dish lid, inverted onto the PBS-filled bottom chamber, andcultured in 5% CO2, 95% humidity, 37�C until morula-likespheres had formed.

Studies on the migration capacity of P1 and G1-Gn cells byTranswell migration assay

A Transwell migration assay was used to track and quantify themigration of P1 and offspring cells. Tissue culture inserts with atranslucent 8 mm PET-membrane (Sarstedt) precoated with col-lagen types I/IV (Thermo Fisher Scientific) were used. A total of2 � 104 ovarian carcinoma cells from ascites were deposited onthe Transwell upper chamber, and DMEM containing 20% FBSwas added as a chemoattractant to the lower chamber. After 24hours, cells were fixed with TCA 10% at 4�C for one hour andstained with SRB 0.4% in 1% acetic acid for one hour. Dependingon the side of the membrane analyzed, the stained cells on theother side were removed mechanically. Migration was documen-ted using an inverted Nikon Eclipse TS100 microscope orquantified by immersing the membranes in Tris-HCl pH 10.5,measuring the dissolved proteins at 570 nm in a Tecan InfiniteM200 microtiter plate reader. Different P1/G1-Gn cell surfacestructures like CXCR4, HERV-Fc1, HERV-KISD, and EpCAM weretargeted using specific antibodies at 10 mg/mL for 24 hours tostudy their role in cell migration.

Differential expression of stem cell markers and immunecheckpoints in P1 progenies as analyzed by qPCRTotal RNA purification and cDNA synthesis. P1 progenies weregrown in hanging drops and harvested to study the expression ofCSC markers. Total RNA was dually extracted with Trizol (LifeTechnologies) and purified on RNeasy mini columns (Qiagen)according to the manufacturer's instructions (19).

Single-cell RNA isolation and cDNA amplification and real-timePCR. The REPLI-g WTA Single Cell Kit (Qiagen) was used togenerate and amplify cDNA from single cells following themanufacturer's instructions. Cells were obtained from ovarianascites and sorted in Transwell chambers after migration in FCSgradients as reflected above. Briefly, 100 cells were picked andlysed for 5 minutes at room temperature. gDNA was removedprior to the WTA process. Transcripts were amplified using ran-domandoligo-dT primers. The synthesized cDNAwas ligated andthen amplified by MDA technology, using the REPLI-g SensiPhiDNA polymerase, in an isothermal reaction for 2 hours. Theamplified cDNAwas quantifiedwith a PicoGreendsDNAReagentKit from Invitrogen. cDNA was employed for qPCR using 100 ngper reaction.

CSC markers, HERV and PDL1 expression was measured byqPCR with validated primers and probes from Integrated DNATechnologies Inc. Sequence and polarity of the primers are shownin Table 1. 100 ng of RNA was amplified in triplicate in a CFX96Real-Time System (Biorad Laboratories).

FACS analysis of cell cycle and polyploidic populationsCell-cycle distributions were analyzed combining propidium

iodide (PI; Sigma-Aldrich) staining and 5-bromo-20-deoxyur-idine (BrdUrd) incorporation, as described previously (20).BrdUrd incorporation and DNA content were measured using

The Stemness Status of Oncogenerative P1 Cells

www.aacrjournals.org Cancer Res; 78(9) May 1, 2018 2319




the CytoFLEX Research Cytometer B5-R0-V0 (Beckman CoulterBiosciences).

Immunocytochemical and IHC stainingImmunocytochemical (ICC) and IHC staining was performed

according to standard protocols (21).Primary antibodies for CSC-phenotyping as for CD24,

CD44pan, CD133, SCF, and vimentin were purchased fromCell Signaling Technology; ESA or Ep-CAM/TROP1 from R&DSystems; CD44 variants from Bio-Rad; primary antibodies forthe detection of HERV-WE1, HERV-FRD1, HERV-V3.1 fromBiorbyt and for HERV-K form BioSS. The anti-ISD was gener-ated using a 17 amino acid consensus fragment correspondingto the ISD of different envelope proteins of the HERV-K family.Conjugated secondary antibodies were purchased from CellSignaling Technology.

Preparation of ultrathin tumor sections and transmissionelectron microscopy

Samples for transmission electron microscopy were preparedaccording to our unmodified protocol (7). A Zeiss transmissionelectron microscope (EM 902A) was used applying 80 kV atmagnifications from �3,000 to �140,000. Digital images weretaken with a MegaView II slow-scan CCD camera and aITEM 5.0software (Soft Imaging Systems).

Morphologic studies of transmigrating P1 and G1-Gn cells byscanning electron microscopy

Cells on Transwell membranes were fixed using glutaralde-hyde 2.5% in PBS for 12 minutes at room temperature,maintained in PBS, and then dehydrated in increasing con-centrations of ethanol (1� in 25%, 50%, 75%, 95%, and 3� inanhydrous ethanol, 10 minutes each). The samples were sub-jected to critical point drying in a CO2 atmosphere to mini-mize shrinkage, mounted on a holder using LeitC-Tabs adhe-sive, and sputtered with gold in vacuum using an EdwardsSputter Coater S150B. Samples were scanned in a FEREM DSM982 Gemini electron microscope (Zeiss) using an electronbeam of 15 kV.

Statistical analysisAll experiments were performed at least in triplicate. Inter-

group comparison of medians was performed by ANOVA.Statistical analysis was performed with Sigma Plot 12 (SystatSoftware Inc.). Significance was accepted when P < 0.05. Elec-tron microscopy, Western blot, ICC, IHC, and video micros-copy studies were descriptive and therefore not analyzed sta-

tistically; the results shown are representative of at least threeindependent experiments.

ResultsP1 cells are endoreplicative entities with virus-like life cycles

In this study, we characterized a distinctive cell type termedpregnant ("P1") cell and hypothesized it to be the primordialgenerative cell type. Figure 1A–I and Supplementary Videos S1and S2 illustrate themorphology of P1 cells andhow they give riseto the first generation of progeny cells ("G1"). P1 are hypertrophicmono- and binucleated (in very early stages) or multinucleated(later stages) cells that can reach diameters of more than 200 mmin adherent cultures. The P1 cell type was found both in tumors ofdifferent histologies and in primary cell cultures (SupplementaryFig. S1A). In untreated patients, we found that about 1% of allcells are P1, depending on the cellularity grade of the ascites. Inpretreated andmostly chemoresistant cancers, viable P1 cells wereincreased by 2% to 3%, indicating an influence of chemother-apeutics on the selection/induction (Supplementary Fig. S1B).

The ejection of G1 from the parental P1 starts with the forma-tion of funiculus-like structures (Fig. 1B and G; SupplementaryFig. S2A and S2B) and crevices in the P1 cell membrane throughwhichG1 are released by contraction of the P1 parent cell (Fig. 1A;Supplementary Fig. S2C and S2D). The resulting local aperture isthen patched up with cellular content rich in HERV envelopeproteins (Supplementary Fig. S2C and S2D). P1 and G1-Gnultrastructure as well as the apertures left by the G1 upon ejectionfrom P1 cells are clearly discernible in tumor ultrathin sections(Fig. 1J–L; Supplementary Videos S3 and S4).

The development and cellularization of G1 cells inside P1 cellsand their subsequent release by P1 contraction represents aunique, novel form of cell division (Fig. 1; Supplementary VideosS5 and S6; Supplementary Fig. S2E andS2F). P1 cells undergo longquiescent phases, during which, they do not appear to generateand eject G1 cells (Supplementary Fig. S1A; Supplementary VideoS7). These quiescent phases vary significantly and may extend upto 6 weeks.

Another striking feature is the division of P1 cells as awhole cellentity, which appears to imply a cytokinesis-like process. Duringcell division, mitochondria accumulate around the subsequentP2-Pn de novo cytoplasm delimiting frontiers (SupplementaryFig. S3A and S3B; Supplementary Video S8).

P1 actively injects G1 cells into apparently specializedreceptor cells

Endomitotic events of G1 cells inside P1 oncogenerativecells, with subsequent karyokinesis, are common (Fig. 2A–J, red

Table 1. Real-time PCR primers and probes

Gene Accession Sense (50–30) Probe (50–30) Antisense (50–30)18s NR_003286 GGACATCTAAGGGCATCACAG GGACATCTAAGGGCATCACAG GAGACTCTGGCATGCTAACTAGc-Myc NM_001354870.1 AGAGGCTTGGCGGGAAA AGGGAGGGATCGCGCTGAGTATAA CTGCCTCTCGCTGGAATTACTAKLF4 NM_001314052.1 AGGAGCCCAAGCCAAAG TAATCACAAGTGTGGGTGGCGGTC GCCTTGAGATGGGAACTCTTNanog NG_004093.3 CAGGACAGCCCTGATTCTTC CAGTCCCAAAGGCAAACAACCCAC GTTTCTTGACCGGGACCTTOct4 NM_002701.5 TATGGGAGCCCTCACTTCA TACTCCTCGGTCCCTTTCCCTGAG TCAGTTTGAATGCATGGGAGASox2 NM_003106.3 CGGACAGCGAACTGGAG AGAGGAGAGTAAGAAACAGCATGGAGA TTTGAGCGTACCGGGTTTEpCAM NM_002354.2 GGTGATGAAGGCAGAAATGAATG CCCATCATTGTTCTGGAGGGCC TCATCGCAGTCAGGATCATAAAGHERV-Fc1 AJ507128.1 GCCTCATCAGTCCTTTCAGATT TCGCCCAGAGAATGGACAAGCAT AAACACCAGGGACAGCTTATCHERV-KISD DQ360584.1 TGTTCTAAGCTCATGAGTCTGTCT TGATCTTAGACAAACTGTCATTTGGATGGG CAGTCAGTAAACTTTGTTAATGATTGGCPDL1 AY291313.1 GCTGTCTTTATATTCATGACCTACT ACGCATTTACTGTCACGGTTCCCA TGTCATATTGCTACCATACTCTACC

Díaz-Carballo et al.

Cancer Res; 78(9) May 1, 2018 Cancer Research2320




Figure 1.

Cellularization events linked to the generation of daughter cells by oncogenerative P1 cells. A–I, P1 cells are giant cell entities with the ability to breed daughter (G1)cells intracytoplasmically. The release of G1 cells from P1 starts with the formation of crevices through which the G1 cells are ejected via mechanicalcontraction of P1's cell body, leaving an aperture that will be repaired afterward. The connection between P1 and G1 is sustained for some time by a funiculuscellularis (Fu), analogous to placental organisms. The sequence of pictures was extracted from Supplementary Video S2. J–L, Ultrathin structure of P1 andG1 in ovarian carcinoma tissues. J and K, P1 oncogenerative cell that holds several G1 progeny cells. Note the aperture left by G1 cells once released from P1 (K).The separation of G1 cells from the P1 parental cell starts with the formation of crevices through which G1 are ejected (L). Mitochondria-rich plasma isobserved in TEM image (L). These events are representative of several tumors.






Figure 2.

A P1 oncogenerative cell transmits stemness features by injecting progeny cells into selected adjacent receptor cells. A–J, Events of R1 polarization beforethe reception of a G1 cell (white arrows). In the sequence, it is possible to observe the development of a sulcus (red arrows) indicative of karyokinetic-likeprocesses. K–S, Bidirectional interaction between P1 and surrounding cells and the transmission of stemness to a R1 cell. An adjacent cell is seen to bepolarizing toward the P1 oncogenerative cell. These events are representative of several tumors.






arrows). We noticed another cell type in bidirectional interactionwith P1 and termed this second cell type as receptor cell ("R1") toaccount for its capability of accepting G1 cells. First, a R1 in closeproximity to a P1 polarizes by accumulating material in themembrane area facing the P1 cell (Fig. 2A–J, white arrows), which,in response, extends a protrusion toward the polarized R1 cellconnecting both cells. Via this protrusion, or injector, the P1 cellinoculates a G1 into R1. The resulting heterotic tetraploid entity isa "P2" cell with the same set of characteristics as the P1 polyploidancestor (Fig. 2K–S; Supplementary Video S1). Analysis of theseinjectors revealed a composition rich in actin and tubulin proteinsas described previously (7).

Replication fitness, mitochondrial fission, and thespherogenicity of P1 and G1-Gn

The proliferative status of P1 and G1-Gn cells is reflectedin Fig. 3A and B. Cyclin D2 and Poliota replicative enzymes arehighly expressed in both P1 and G1 cells. Also, proliferating cellnuclear antigen is highly expressed in P1 cells and many tetra-nuclear cells surrounding P1 (Supplementary Fig. S4A). More-over, we observed high expression of HERV envelope proteinsin different mitotic phases of G1 cells (Supplementary Fig.S4B). P1 oncogenerative cells do not show an apoptotic phe-notype (Fig. 3C). Moreover, these high replication rates aresupported by the presence of large quantities of mitochondriain both cell types (Fig. 3D).

In 3D cultures, theG1-Gnpopulations grew faster than P1 cells,as measured by the size of the spheroids, indicating replicativefitness. Moreover, P1 cells were not able to form spheres inhanging drops, resembling the growth patterns seen in highlychemotherapy-refractory ovarian cancers growing in 3D (Fig. 3E–K). This indicates that it might be P1 cells that give rise to theheterogeneous cell populations thatmake up the bulk of a tumor.In contrast, G1-Gn cells were able to form symmetrical spheres(Fig. 3F, I, and J).When the content of hanging drops fromP1 cellsand G1-Gn was placed on Transwell membranes in an FCSgradient, P1-derived cells migrated rapidly in comparison withG1-Gn spheres (Fig. 3H and K).

In an attempt to investigate the polyploidy status of theseheterokaryotic multinucleated ovarian cells, we undertook cyto-metric studies of the cell-cycle distribution using PI and BrdUrdincorporation. Small and large cells from the whole populationwere sorted, revealing high numbers of large polyploid popula-tions alongside the near diploid small cells (Fig. 3L–Q).

P1 andG1-Gn cells differentially expressCSCmarkers typical oftheir histologic origin

We found that P1 oncogenerative and G1-Gn cells do expressCSC markers differentially. P1 cells, despite their physiologicstemness, produced low levels of CSC antigens, thus presentingan example of CSC marker–low phenotypes that can initiatetumor formation. Contrarily, G1-Gn expressed high levels of CSCmarkers. The differential expression of different CSC markers(CD24, CD44 variants, CD133, ESA/TROP1, Oct-4, SCF, Nanog,and SUZ12) by P1 and G1 in a primary ovarian carcinoma isdepicted in Fig. 4A–H and Supplementary Fig. S5.

G1-Gn cells show high migration ratesWe examined cell populations containing both P1 and G1-Gn

cells on Transwell and analyzed the populations thatwere capable

of unilateral migration. More than 90% of cells that invaded thelower side of the chamber were less than 25 mm measured asplanar. Contrarily, in the upper chamber, more than 90% of cellswere greater than 25 mm in size, proving that the G1-Gn cells inparticular may have dissemination capacity via intra/extravasa-tion (Supplementary Fig. S6).

Gene expression of stem cell transcriptional factors andCSC markers is not proportionate to protein expression asanalyzed by qPCR

We studied the gene expression of pivotal stem cell tran-scription factors like Oct4, Sox2, Nanog, c-Myc, KLF4 as well asEpCAM in migrating cells. P1 and hypertrophic cells did notmigrate through an 8-mm pore membrane, whereas G1-Gn didunimpedingly. We isolated the RNA from both populationswith a high sensitive kit, which allows the isolation of RNAfrom single cells. Figure 4I shows a representative gene expres-sion pattern of both cell populations [large nonmigrating (up)and small migrating (down) cells] isolated from ovarian car-cinoma patients.

After separation of both cell types, we noted that multinu-cleated giant cells differentially produced more transcripts ofstem cell markers than their offsprings (Fig. 4I). This inverselymirrors the protein expression of these markers as seen by ICCstudies (Fig. 4A–H). Moreover, stem cell transcription factorsassociated with pluripotency like Oct4, Sox2, Nanog, and KLF4at the protein levels were found to be expressed by approxi-mately 2% of the cells in the entire population. Contrarily,c-Myc was expressed by approximately 60% of the cells (Sup-plementary Fig. S7A).

We next compared the gene expression of the above-men-tioned markers in the chemotherapy-refractory ovarian carci-noma cell model SKOV3 and cells from ovarian carcinomapatients. Interestingly, expression of Nanog and Sox2 wassignificantly higher in patients than in chemotherapy-na€�veovarian models (Fig. 4J).

To get a hint about the differential gene expression of differentstem cell markers in adherent as well as 3D cultures and tocompare this with the same markers in patient material, weemployed the SKOV3 wild-type, MDRþ, and CP-resistant cellsand detected that the multinucleated P1 cells isolated frompatients reflect similar behavior as the cells growing in 3D,especially those cells that are highly resistant to cytostatics (Sup-plementary Fig. S7B).

P1 and G1 cells express HERV envelope proteinsP1 cells expressed low levels of HERV-derived envelope pro-

teins, indicating that P1 cells do not originate from cell–cellfusion. In contrast, G1 cells were very high in HERV proteinexpression (Fig. 5), indicating that G1-Gn cells retain fusogenicproperties. Four different envelope proteins from HERVs (HERV-WE1, HERV-FRD1,HERV-V3.1, andHERV-KISD)were differentiallyexpressed in P1 and G1-Gn cells. Notably, various HERV proteinswere found to be strongly overexpressed in different mitoticphases (Supplementary Fig. S4B).

The localization of HERV envelope proteins in the perinuclearcell compartment is of particular relevance too (Fig. 5A–D).Cytometric analysis for HERV envelope proteins revealed theexpression of these viral elements to be high in ovarian cancers(Fig. 5E–H).






P1 cells express high levels of HERV-KISD and PD-L1 to ensureimmune escape

The expression of ISD as depicted in Fig. 6A is expected toconfer some immune escape capability to P1 and G1-Gn cells.

In the next step, we sought to identify a second immune escapemechanism by investigating the expression of PD-L1 (orCD274) in heterogenic tumor populations. As illustratedin Fig. 6B, P1 is the predominant cell type to overexpress

Figure 3.

Replication fitness, apoptotic status, mitochondrial fission, and the spherogenic capacity of P1 and G1 cells. A–D, Replication fitness and apoptotic statusof the oncogenerative and their offspring cells. P1 and G1-Gn cells do not express apoptotic phenotype and several replicative enzymes that denote strongreplicative events (A–C).D,Highmitochondrial fission inG1-Gn cells. E–K, 3D cultures of P1 andG1 cells display different growth patterns.E–G, I, and J, 3D culture of P1and G1 from ovarian tumor cells grown in hanging drops. P1 and G1 cells were aspirated after accutase detachment, washed in media, and resuspended in 25 mLmedia for 3D cultures. Single P1 oncogenerative cells grown in hanging drops show similar growth patterns as in 2D culture. They are able to form severalspheroids during culturing, recapitulating the adjacent colony formation. Contrarily, G1-Gn cells grow uniformly into morula-like structures. Difference in migrationpatterns of P1 (H) and G1-Gn (K) cells cultured in 3D was observed after being subjected to chemotactic gradient using Transwell chambers as visualized bySEM. L–Q, Cytometric analysis of ovarian carcinoma primary cell cultures by FACS. Cell-cycle distribution (L, N, and P) reveals that G1-Gn small cells are neardiploids (N), whereas giant cell population shows polyploid genomes (P). L, N, and P represent the BrdUrd incorporation and M, O, and Q represent theDNA content as measured by PI. Pictures are representative of 10 patient ascites analyzed.






PD-L1, which appears to be delivered to the intercellular spacein extrasomal vesicles. Immune escape mediated by ISD in P1and G1-n cells in ovarian carcinoma tumors was found veryhigh as seen in Fig. 6C. Interestingly, normal ovarian tissues donot express this protein (Fig. 6D).

In patient material, PDL-1 and EpCAMwere significantly over-expressed at the genetic level (Fig. 6E) in comparison withcytostatic-sensitive ovarian cancer cells. Expression of the ISDmotif of HERV-K was also higher than the immune checkpointPD-L1, regardless of the cells' resistance status. The relevance of

Figure 4.

P1 and G1 cells show differential expression of specific CSC markers. A–H, These pictures reflect the ICC analysis of different CSC markers in a primary ovariancarcinoma. A, Different forms of the release of G1 cells, which are predominantly CD24 positive. This same pattern is noted for CD44PAN and CD133 asobserved in B and C, respectively. Expression of CD44 variant 5 is similar in P1 and G1-Gn cells (F). This CSC expression pattern was found in several primaryovarian carcinomas. D, Ejection of a SCF-positive cell. E and F, Expression of c-Kit and Oct-4, respectively. G and H, Expression of Nanog and SUZ12, respectively.I, Genetic expression of c-Myc, KLF4, Nanog, Oct4, and Sox2 stem cell transcription factors as well as EpCAM in ovarian carcinoma cells obtained fromascites. Up represents the giant cells that are not able to migrate, whereas down represents the small highly migrating cells. J, Comparison of the expressionof CSC markers between patient material and SKOV3 ovarian carcinoma wild-type and chemotherapy-resistant models. Significant expression in patientmaterial was observed for Nanog. Experiments are representative of 10 patients analyzed.






these antigens as immunotargets lies in their capacity to inhibitthe migration of small cells as seen in Fig. 6F for EpCAM and ISD,respectively.

P1 cells undergo several replicative and cellularization eventssimultaneously

Figure 7A depicts a cartoon illustrating the major replicationevents experienced by P1 oncogenerative cells and Fig. 7B–Mrepresents each event captured individually. P1 cells spawn vastnumber of functional progenies (G1-Gn) by lateral (Fig. 7B)and crevice-mediated eclosions (Fig. 7C), which sometimesleave plicae and apertures in cell membranes (Fig. 7D andE). P1 cells have the ability to inoculate G1 cells via injectors(Fig. 7F) into adjacent polarized (Fig. 7G) receptor R1 cells (Fig.7H). G1 cells released from P1 (Fig. 7I) fuses (Fig. 7J) with R1receptor cells. The admixture of G1-R1 (Fig. 7K) forms aheterotic tetranuclear P2 cell with the same stemness character-istics as P1. Two additional forms of G1-Gn release from P1oncogenerative cells are by budding (Fig. 7L) and via funiculus-like structures (Fig. 7M).

DiscussionOncogenesis and CSCs

Several theories of oncogenesis have been put forward. In theearly 1900s, it was noted that processes of germ cell developmentand oncogenesis share similar characteristics (22). In fact, JohnBeard proposed the trophoblastic theory of cancer. More recently,Vinnitsky suggested the oncogerminative theory of tumor forma-tion after which the malignant transformation of somatic cells is

based on the activation of embryogenic programs that conferphenotypic germ cell features (23). In particular, the "oncotro-phoblastic cells" and their role in cell division, migration, host–tissue conditioning for angiogenesis, and immune tolerance seemto be of particular relevance in tumorigenesis and metastaticspread (24). Another definition, which refers to the embryonictheory of tumorigenesis, was given by Lloyd J. Old, who claimedthat cancer is somatic cell pregnancy (22).

Cell heterogeneity is a hallmark of cancer, especially in theparenchymal structures. The cells constituting a malignant tu-mor are thought to have a common origin and exhibit a rathermultipotent phenotype (25). These oncogenerative cells arehard to characterize based on a set of markers that define CSCphenotypes. Moreover, little effort has been made to determinefor how many generations after the very stem cells these CSCantigens continue to be expressed. Interestingly, some tumorshave been demonstrated to arise from CSC-negative cells (26).These reports have kindled a debate over the interpretation ofthe results and the reliability of the known CSC markers as aninstrument to identify stemness characteristics (26, 27).

P1 and Gn life cycles and cellularizationThe neosis theory introduced by Rajaraman seeks to explain the

replication mechanism of multinucleated cells. Neosis is thoughtto occur in postsenescent multinucleated cells, and it is charac-terized by karyokinesis via nuclear budding leading to aneuploidmononuclear cells with transient stem cell features, while thepolyploid mother cells die (28). Although attractive, the neosisconcept does not provide a satisfactory explanation for a fewmajor aspects of our observations: P1 oncogenerative cells do not

Figure 5.

HERV envelope proteins are widely expressed in P1 and G1 cells obtained from primary ovarian tumors. A–D, ICC analysis of the expression of HERVs. Atleast four different envelope proteins from endoretroviruses like HERV-WE1, HERV-FRD1, HERV-V3.1, and HERV-K are differentially expressed in P1 and G1-Gn cells.HERV envelope proteins are principally localized in the perinuclear cell compartments, which are rich in mitochondria. A, Release of G1 cells. The expressionof HERV-WE1, also known as syncytin 1, is similar in P1 and G1-Gn cells. B, Perinuclear distribution of the protein HERV-FRD1, also known as syncytin 2. Thelateral cell division is observable by the expression of EpCAM. In this picture, a repaired aperture is clearly recognizable. C, P1 cell separation (cytokinesis-likeevent), suggesting that P1 cells are complete, replicative entities. A dense accumulation of mitochondria in the perinuclear area (mitoplasma or mitochondrialplasma) is seen in HERV-K positive G1-Gn cells (D). E–H, Cytometric analysis of HERV expression. Ovarian cancer cells express several envelope proteinsderived from endogenous retroviruses as seen by FACS (E–H). Pictures are representative of 10 patient ascites analyzed.






necessarily die upon G1 generation. Moreover, they are notphenotypically senescent as evidenced by the lack of b-galacto-sidase expression and appear to be highly viable according to theabundant presence of antiapoptotic effectors like Bcl-2, which aremarkers of cellular fitness. Furthermore, P1 cells show a modeof cytokinesis that allows them to divide as a whole system(Supplementary Video S8), recently described as cytofission (29).

Our studies established that P1 cellsmight notmeet the currentbiological criteria of endoreplication (endomitosis and endocy-cling) in a strict sense per se (9, 10). The way P1 cells generate thefirst (i.e., proximal) daughter cell generation shows some analogyto cells "infected" (P1) by "giant viruses" (G1) that cycle through alysogenic phase without killing the host cell as described for virallife cycles. In fact, the contribution of viral proteins to multi-nucleation different from classic cell–cell fusion has beendescribed previously (20).

P1 oncogenerative cells may drive tumor evolutionEndoreplication and the resulting polyploidy is an adaptive

mode with far-reaching consequences for the evolution of many

biological systems (30). Although polyploidy may reduce overallcell fitness, it has enormous adaptive potential, as its genetic orepigenetic changes (amplification of oncogenes, new acetylation,or methylation patterns) can alter physiology, metabolism, and,finally, morphology of the cell. This leads up to new phenotypesthat contribute to tumorigenesis, drug resistance, and metastaticspread (7, 8, 31).

We found that P1 oncogenerative cells have the ability ofinoculating receptor cells (which probably represent a specializedcell type for which P1 has a "tropism") with G1 via a connectivetube or injector. This process has not been described until now, asit is an active, targeted act rather than an unspecific fusion event. Itimplies the horizontal transmission of the entire genomes, epi-genetic patterns, or amplified genes.

The mixing of genetic material (heterosis) in the same cellsystem (autopolyploidy) or among cells of divergent structure(allopolyploidy) leads to increased allelic diversity that mayresult in hybrid, more robust de novo cells that are superior tothe parental cells in terms of growth rate, robustness, etc., and theability to occupy new niches (evolutionary selection; ref. 30). The

Figure 6.

Expression of immune escape markers in P1 cells and patient paraffin sections of ovarian carcinoma. A–D, The expression of HERV-KISD in patient paraffinsections and primary ovary cells obtained from ascites (A, C, and D). The programmed death-ligand 1 (PD-L1) or CD274 in heterogenic tumor populations wasmonitored by ICC in primary ovarian carcinoma cells. A, Expression of HERV-KISD in P1 and G1-Gn cells. Parallel expression of both immune modulator proteins wasnoted in several tumors of the same histology. PD-L1 is overexpressed in P1, as observed in B. C, Expression of the HERV-KISD domain in ovarian carcinomaparaffin sections. D, Expression of the ISD domain in normal ovarian tissues. E and F, Genetic expression of EpCAM, HERV-Fc1, HERV-KISD, and PDL-1 (E). EpCAMand PDL-1 were found to be significantly overexpressed in ovarian cells isolated from ascites in comparison with wild-type SKOV3 cells (E). The influence ofblocking antibodies against CXCR4, EpCAM, HERV-Fc1, and HERV-KISD on cell migration was significant at 10 mg/mL concentration (F) using Transwell migrationassay. Migration capacity was measured by SRB proliferation assay. Pictures are representative of 10 patient ascites analyzed.






Figure 7.

Cartoon of the cellular events taking place in and around P1 oncogenerative cells. P1 cells are multinucleated giant cells that can reach up to 200 mm diameterwith nuclei of about 20 mm diameter. G1 cells are generated by P1: (i) by peripheral cell eclosion or (ii) by intracytoplasmic cell division with subsequentrelease of the daughter cells by contraction of P1 cells. An aperture or foramen remains once G1 is released. P1 have the ability to inoculate receptor (R1) cellswith G1 cells via an injector that docks to the R1 cells. Once the connection is established, the G1-daughter cell detaches from the parent cell and fuses withR1, resulting in a P2 cell with the same stemness characteristics as P1. G1 cells replicate via symmetric division, giving rise to G2-Gn cell generations that willform the mass of the tumor. A–M illustrate the events observed in this work.






mixing of genetic material between P1 and R1 represents an eventof heterosis that may lead to a more adaptive phenotype that inturn supports tumor spread and persistence.

Polyploidy and multinucleation may arise from tetraploidyintermediates. It has been demonstrated that neither a tetra-ploid condition nor centrosome or cell size anomalies or thefailure of cytokinesis lead to G0–G1 cell-cycle arrest. Thisindicates that there are no efficient checkpoint restrictions inthe cell cycle of mammalian cells to avoid tetraploidy (32).Tetraploid cells are thought to be unstable intermediates withaberrant proliferation, probably by the loss of caretaker genesof cell-cycle checkpoint controls. These cell entities are oftenwith restricted distribution but resisting eradication even in theface of antireplicative therapies. Importantly, multinucleationvia tetraploidization may lead to induced embryonic-like stem-ness as proposed by Erenpreisa and colleagues (31, 33). Intumors, endoreplication and subsequent depolyploidization isthought to protect the tumor cells from stress, thus increasingcellular fitness and contributing to the emergence of highlyresistant cancer entities (8, 13).

P1 oncogenerative cells are somatic cells in "pregnancy"generating and gestating a prole of cells intracytoplasmicallythat are cellularized into immediate surroundings, forming newcolonies. They have the capacity of a horizontal transmission ofthe entire genome to other cells, resulting in new tetraploid cellentities.

We expect the striking size difference between P1 and G1-Gncells to be of crucial importance in the metastatic spread process.Invasiveness via transendothelial migration (tumor–vessellumen–target tissue) may be different for P1 and G1-Gn cells.We hypothesize that large cells like P1will remain confined to thelocal tumor, whereas the smaller G1-Gn cells are likely to bemoremobile and therefore possess a higher metastatic potential.

The stemness status of P1 oncogenerative cellsP1 oncogenerative cells display few CSC marker characteristics

for multipotency despite their physiologic stemness as judged bytheir capacity to generate and gestate de novo cells. Interestingly,this is contrasted by the first generation of progeny cells (G1),which clearly express a signature of canonical ovarian CSC mar-kers (15, 27). Importantly, both P1 and G1-Gn express EpCAM/TROP1, a marker of trophoblastic lineage that matches the char-acteristic of oncotrophoblastic cells. Although Oct-4A (one of theessential stem cell transcriptional factors, among c-Myc, Sox2, andKLF4)was expressed in P1 cells to some extent, this alone does notqualify for pluripotency. c-Myc is thought to be another essentialstem cell transcriptional factor, but is also upregulated in severaltumors. Thus, the quadriga of stem cell transcriptional factors thatleads to pluripotency is not complete. This indicates a rathermultipotent phenotype (1, 4).

In general, the presence of pluripotent cells in tumors hasremained obscure. The existence of such cells implies at leasttheoretically, that such pluripotent CSCs may simultaneouslytransdifferentiate into tumors of dissimilar histologies. This pos-sible scenario is not supported by clinical evidence, because suchtumors are uncommon. Biologically speaking, a pluripotent cellhas a particular signature amidst the expression of some factorsnecessary for development and maintenance of this quality.Normal cells can be reprogrammed to totipotent stem cells usingthe Yamanaka cocktail stem cell transcriptional factors simulta-neously (2). Interestingly, efforts directed toward reprogramming

cancer cells into stem cells of higher orders have resulted innormal cells (34).

Our studies revealed a significant discrepancy in the levels ofmRNA–protein pairs of specific stem cell markers, whichdemands a further explanation. On the one hand, we knowthat multinucleated oncogenerative cells are highly polyploid.Polyploid cells commonly show a near-global mRNA increasethat is proportional to overall genome content and partiallydriven by epigenetic regulations. The increase in mRNA tran-scripts observed for several stem cell factors seems to be not arequirement for P1 cells, because it does not lead to proteinsynthesis. But, what could be the fate of this overabundantmRNA? We hypothesize that (i) P1 cells may translocatemRNA transcripts to de novo G1 cells during cellularizationto drive their development, or (ii) that in these cells thetranslational/posttranslational events are the dominant factorscontrolling protein turnover and abundance for the analyzedtranscripts (35, 36). The first assumption may explain the highexpression of CSC markers, provided that robust proteinsynthesis in G1-Gn cells is robust. The latter may explain thelow expression of CSC markers at the protein level observed inP1 cells. On the other hand, the offspring of P1 cells are nearlydiploid and therefore expected to have a more regular tran-scriptome with less genetic redundancy (30). G1-Gn de novocells express much higher levels of CSC markers at the proteinlevel than P1. This divergence supports the view that these newcells are initially primed to face the conditions they are aboutto encounter.

Genome-wide correlations betweenmRNA and protein expres-sion levels are notoriously inconsistent in human cancers. In fact,only some40%of the cellular protein levels can be predicted frommRNA measurements (37). Recently, van Velthoven and collea-gues described the balance between synthesis and degradation oftranscripts in quiescent muscle stem cells (36).

Tumor immune escape may be facilitated by endoretroviralelements

One of the central tenets of the immune system is the activesurveillance for malignant transformation and elimination ofcancer cells but cancer cells present "self" antigens, and as aconsequence, autoreactive immune cells are usually eliminated.On the other hand, tumors generate an immunosuppressivemicroenvironment that prevents their infiltration by immunecells.

Interestingly, all P1 and G1-Gn cells overexpress some endog-enous retroviral proteins, in particular, HERV-coded envelopeproteins that are mostly intact. HERV-WE1 and FRD1 are keyfusogenic factors that mediate syncytial assembly, a collateraleffect attributed to a number of different viruses (38, 39). Thisraises questions as to the role of the reactivation of endogenousretroviral elements and its implication in cancer development andmetastatic spread (40, 41). In this context, HERV envelope pro-teins may contribute to multinucleation by virtue of their fuso-genic properties and, as self-antigens, help mask tumor cellsagainst immune attack in a virus-like fashion (42, 43). Interest-ingly, HERV elements were overexpressed in mitotic cells indifferent phases of cell division, indicating an important role inthese populations. Of note is the biological function of the ISDintroduced by viral envelope proteins, whichmay help the tumorescape the immune response (16). This means that blocking ISDmaybe killing two birdswith one stone, first by staging a powerful






anticancer immune response, and second by killing ISD-richtumor cells directly (44).

Our data show that P1 cells are high in PD-L1 expression,which, together with the presence of ISD introduced by the HERVproteins, may help to ensure tumor escape from immunologicsurveillance.

Another critical observation is that perinuclear mitochondri-al fission activity and crowding is extremely high in both P1 andG1-Gn cells and especially the latter, which are particularly richin mitochondria. The dense perinuclear mitochondrial massseen in G1-Gn appears to form a plasmatic shield or mito-plasm, which delimits the G1 cell boundaries. Their highmitochondrial content, together with their small size, couldexplain the very high dividing rates and distinct infiltrationpotential of G1-Gn, as this process places enormous energyrequirements on the cells (19, 45).

In conclusion, the identification and description of P1oncogenerative cells and G1-Gn daughter cells in ovariancancer sheds new light on tumorigenesis and tumor persist-ence and may open up new avenues for targeted cancer thera-pies in the future.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: D. Díaz-Carballo, A. TannapfelDevelopment of methodology: D. Díaz-CarballoAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): D. Díaz-Carballo, S. Saka, J. Klein, T. Rennkamp,A.H. Acikelli, H. Jastrow, C. Tempfer, I. SchmitzAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): D. Díaz-Carballo, H. Jastrow, G. Wennemuth,I. SchmitzWriting, review, and/or revision of the manuscript: D. Díaz-Carballo,S. Malak, H. Jastrow, G. Wennemuth, C. Tempfer, D. StrumbergAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): A. Tannapfel, D. StrumbergStudy supervision: D. StrumbergOther (final approval): D. Strumberg

AcknowledgmentsThe authors want to thank to Marienhospital Herne from the Elisabeth

Group for supporting this investigation. Special thanks to the staff of theGynaecology Department for the coordination of samples collection. Thisinvestigation was supported by grants afforded by institutional funds fromMarienhospital Herne.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received July 10, 2017; revised November 20, 2017; accepted February 6,2018; published first February 12, 2018.

References1. MartelloG, SmithA. Thenature of embryonic stemcells. AnnuRevCellDev

Biol 2014;30:647–75.2. Schmidt R, Plath K. The roles of the reprogramming factors Oct4, Sox2 and

Klf4 in resetting the somatic cell epigenome during induced pluripotentstem cell generation. Genome Biol 2012;13:251.

3. Scott EW. Stem cell reviews and reports. Adult stem cells and tissueregeneration section. Stem Cell Rev 2017;13:2.

4. Aponte PM, Caicedo A. Stemness in cancer. Stem cells, cancer stemcells, and their microenvironment. Stem Cells Int 2017;2017:5619472.

5. van Niekerk G, Davids LM, Hattingh SM, Engelbrecht A-M. Cancer stemcells. A product of clonal evolution? Int J Cancer 2017;140:993–9.

6. L�opez-L�azaro M. The migration ability of stem cells can explain theexistence of cancer of unknown primary site. Rethinking metastasis.Oncoscience 2015;2:467–75.

7. Diaz-CarballoD,GustmannS, JastrowH,Acikelli AH,DammannP,Klein J,et al. Atypical cell populations associated with acquired resistance tocytostatics and cancer stem cell features. The role of mitochondria innuclear encapsulation. DNA Cell Biol 2014;33:749–74.

8. Puig P-E, Guilly M-N, Bouchot A, Droin N, Cathelin D, Bouyer F,et al. Tumor cells can escape DNA-damaging cisplatin through DNAendoreduplication and reversible polyploidy. Cell Biol Int 2008;32:1031–43.

9. Fox DT, Duronio RJ. Endoreplication and polyploidy. Insights into devel-opment and disease. Development 2013;140:3–12.

10. Lee HO, Davidson JM, Duronio RJ. Endoreplication: polyploidy withpurpose. Genes Dev 2009;23:2461–77.

11. Larsson L-I, Bjerregaard B, Wulf-Andersen L, Talts JF. Syncytin and cancercell fusions. Scientific World Journal 2007;7:1193–7.

12. Rengstl B, Newrzela S, Heinrich T,Weiser C, Thalheimer FB, Schmid F, et al.Incomplete cytokinesis and re-fusion of small mononucleated Hodgkincells lead to giant multinucleated Reed-Sternberg cells. Proc Natl Acad SciU S A 2013;110:20729–34.

13. Erenpreisa J, Salmina K, Huna A, Kosmacek EA, Cragg MS, Ianzini F, et al.Polyploid tumour cells elicit paradiploid progeny through depolyploidiz-ing divisions and regulated autophagic degradation. Cell Biol Int 2011;35:687–95.

14. Morgan DO. "Specialization of Cytokinesis in Animal Development." InCell Cycle: Principles of Control, 170–1. London: Publisher: New SciencePress Ltd, 2007.

15. Ottevanger PB. Ovarian cancer stem cells more questions than answers.Semin Cancer Biol 2017;44:67–71.

16. Denner J. Immunosuppressive properties of retroviruses. Eur J Immunol2016;46:253–5.

17. Robainas M, Otano R, Bueno S, Ait-Oudhia S. Understanding the role ofPD-L1/PD1 pathway blockade and autophagy in cancer therapy. OncoTargets Ther 2017;10:1803–7.

18. Weihua Z, Lin Q, Ramoth AJ, Fan D, Fidler IJ. Formation of solidtumors by a single multinucleated cancer cell. Cancer 2011;117:4092–9.

19. Díaz-Carballo D, Klein J, Acikelli AH, Wilk C, Saka S, Jastrow H, et al.Cytotoxic stress induces transfer of mitochondria-associated humanendogenous retroviral rna and proteins between cancer cells. Oncotarget2017;8:95945–64.

20. Patel D, Incassati A, Wang N, McCance DJ. Human papillomavirus type16 E6 and E7 cause polyploidy in human keratinocytes and up-regulationof G2-M-phase proteins. Cancer Res 2004;64:1299–306.

21. Diaz-Carballo D, Acikelli AH, Klein J, Jastrow H, Dammann P, Wyga-nowski T, et al. Therapeutic potential of antiviral drugs targeting chemo-refractory colorectal adenocarcinoma cells overexpressing endogenousretroviral elements. J Exp Clin Cancer Res 2015;34:81.

22. Old LJ. Cancer is a somatic cell pregnancy. Cancer Immun 2007;7:19.23. Vinnitsky VB. Oncogerminative hypothesis of tumor formation. Med

Hypotheses 1993;40:19–27.24. Vinnitsky V. The development of a malignant tumor is due to a desperate

asexual self-cloning process in which cancer stem cells develop the abilityto mimic the genetic program of germline cells. Intrinsically DisorderedProteins 2014;2:e29997. doi: 10.4161/idp.29997.

25. Prasetyanti PR, Medema JP. Intra-tumor heterogeneity from a cancer stemcell perspective. Mol Cancer 2017;16:41.

26. Huang S-D, Yuan Y, Tang H, Liu X-H, Fu C-G, Cheng H-Z, et al. Tumorcells positive and negative for the common cancer stem cell markersare capable of initiating tumor growth and generating both progenies.PLoS One 2013;8:e54579.






27. Abbaszadegan MR, Bagheri V, Razavi MS, Momtazi AA, SahebkarA, Gholamin M. Isolation, identification, and characterization ofcancer stem cells. A review. J Cell Physiol 2017;232:2008–18.

28. Rajaraman R, Rajaraman MM, Rajaraman SR, Guernsey DL. Neosis–aparadigm of self-renewal in cancer. Cell Biol Int 2005;29:1084–97.

29. Niu N, Zhang J, Zhang N, Mercado-Uribe I, Tao F, Han Z, et al. Linkinggenomic reorganization to tumor initiation via the giant cell cycle.Oncogenesis 2016;5:e281. doi: 10.1038/oncsis.2016.75.

30. Comai L. The advantages and disadvantages of being polyploid. Nat RevGenet 2005;6:836–46.

31. Erenpreisa J, Cragg MS. MOS, aneuploidy and the ploidy cycle of cancercells. Oncogene 2010;29:5447–51.

32. Wong C, Stearns T. Mammalian cells lack checkpoints for tetraploidy, aber-rant centrosome number, and cytokinesis failure. BMC Cell Biol 2005;6:6.

33. Salmina K, Jankevics E, Huna A, PerminovD, Radovica I, Klymenko T, et al.Up-regulation of the embryonic self-renewal network through reversiblepolyploidy in irradiated p53-mutant tumour cells. Exp Cell Res 2010;316:2099–112.

34. Lang J-Y, Shi Y, Chin YE. Reprogramming cancer cells. Back to the future.Oncogene 2013;32:2247–8.

35. Jiang Q, Crews LA, Holm F, Jamieson CHM. RNA editing-dependentepitranscriptome diversity in cancer stem cells. Nat Rev Cancer 2017;17:381–92.

36. van Velthoven CTJ, de Morree A, Egner IM, Brett JO, Rando TA. Transcrip-tional profiling of quiescent muscle stem cells in vivo. Cell Rep2017;21:1994–2004.

37. Maier T, G€uell M, Serrano L. Correlation of mRNA and protein in complexbiological samples. FEBS Lett 2009;583:3966–73.

38. Gonzalez-CaoM, Iduma P, Karachaliou N, SantarpiaM, Blanco J, Rosell R.Human endogenous retroviruses and cancer. Cancer Biol Med 2016;13:483–8.

39. Soygur B, Sati L. The role of syncytins in human reproduc-tion and reproductive organ cancers. Reproduction 2016;152:R167–78.

40. Ohnuki M, Tanabe K, Sutou K, Teramoto I, Sawamura Y, Narita M, et al.Dynamic regulation of human endogenous retroviruses mediates factor-induced reprogramming and differentiation potential. Proc Natl Acad SciU S A 2014;111:12426–31.

41. Santoni FA, Guerra J, Luban J. HERV-H RNA is abundant in humanembryonic stem cells and a precise marker for pluripotency. Retrovirology2012;9:111.

42. Blinov VM, Krasnov GS, Shargunov AV, Shurdov MA, Zverev VV. Mechan-isms of retroviral immunosuppressive domain-induced immune modu-lation. Mol Biol 2013;47:707–16.

43. Izsvak Z, Wang J, Singh M, Mager DL, Hurst LD. Pluripotency and theendogenous retrovirus HERVH. Conflict or serendipity? Bioessays 2016;38:109–17.

44. Codd AS, Kanaseki T, Torigo T, Tabi Z. Cancer stem cells as targets forimmunotherapy. Immunology 2018;153:304–14.

45. Farnie G, Sotgia F, Lisanti MP. High mitochondrial mass identifies a sub-population of stem-like cancer cells that are chemo-resistant. Oncotarget2015;6:30472–86.






2018;78:2318-2331. Published OnlineFirst February 12, 2018.Cancer Res David Díaz-Carballo, Sahitya Saka, Jacqueline Klein, et al. Source of Stemness and Tumor HeterogeneityA Distinct Oncogenerative Multinucleated Cancer Cell Serves as a

Updated version

10.1158/0008-5472.CAN-17-1861doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2018/02/10/0008-5472.CAN-17-1861.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/78/9/2318.full#ref-list-1

This article cites 44 articles, 7 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/78/9/2318.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/78/9/2318To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-17-1861

http://cancerres.aacrjournals.org/content/suppl/2018/02/10/0008-5472.CAN-17-1861.DC1

http://cancerres.aacrjournals.org/content/78/9/2318.full#ref-list-1

http://cancerres.aacrjournals.org/content/78/9/2318.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/78/9/2318


A Distinct Oncogenerative Multinucleated Cancer Cell ... · mission of malignant cells in patients...

Documents

Transcript of A Distinct Oncogenerative Multinucleated Cancer Cell ... · mission of malignant cells in patients...