"A Disintegrin And Metalloprotease-17 Dynamic interaction sequence" (CANDIS) – the sweet tooth for the human interleukin-6 receptor

Stefan Düsterhöft‡, Katharina Höbel‡, Mirja Oldefest‡, Juliane Lokau‡, Georg H. Waetzig§, Athena Chalaris‡, Christoph Garbers‡¶, Jürgen Scheller¶, Stefan Rose-John‡, Inken Lorenzen‡1, Joachim

Grötzinger‡1,2

 

‡Institute of Biochemistry, Christian-Albrechts-University, Olshausenstr. 40, 24098 Kiel, Germany.

§CONARIS Research Institute AG, Schauenburgerstr. 116, 24118 Kiel, Germany.

¶Institute of Biochemistry and Molecular Biology II, Medical Faculty, Heinrich-Heine-University, Universitätsstr. 1, 40225 Düsseldorf, Germany.

*Running title: CANDIS Conserved ADAM-SeventeeN Dynamic Interaction Sequence

Key words: ADAM ADAMTS, Metalloprotease, Interleukin, Shedding, Peptids, Peptide interaction, Protein-protein interaction, Membrane protein, Circular dichroism (CD), Enzyme inactivation, Redox regulation, Protein isomerase CAPSULE: Background: A Disintegrin And Metalloprotease-17 (ADAM17) releases many proinflammatory media-tors. Results: The Conserved ADAM-SeventeeN Dynamic Interaction Sequence (CANDIS) mediates effective substrate binding and is controlled by the disulfide-regulated conformation of the preceding membrane-proximal domain (MPD). Conclusion: CANDIS together with the MPD represents a novel key regulatory element. Significance: Molecular details of a novel kind of regulation.

Abstract

A Disintegrin And Metalloprotease-17 (ADAM17) is a major sheddase involved in the regulation of a wide range of biological processes. Key substrates of ADAM17 are the interleukin-6 receptor (IL-6R) and tumour necrosis factor-α (TNF-α . The extracellular region of ADAM17 consists of a pro-, a catalytic, a disintegrin and a membrane-proximal domain (MPD) as well as a small stalk region. This study demonstrates that this juxtamembrane segment is highly conserved, α-helical and involved in IL-6R binding. This process is regulated by the structure of the preceding MPD, which acts as molecular switch of ADAM17 activi-ty operated by a protein-disulfide isomerase. Hence, we have termed the conserved stalk region “Con-served ADAM-SeventeeN Dynamic Interaction Sequence” (CANDIS). Finally, we identified the region in IL-6R, which binds to CANDIS. In con-trast to the type-I transmembrane proteins the IL-6R and IL-1RII, CANDIS does not bind the type-II transmembrane protein TNF-α, demonstrating fun-

damental differences in the respective shedding by ADAM17.

Introduction

The type-I transmembrane protein A Disintegrin And Metalloprotease-17 (ADAM17)3 is a key pro-tease, which is involved in the regulation of a wide variety of biological processes. The cleavage of cell surface proteins by ADAM17, the so-called ecto-domain shedding, constitutes a rapid and irreversi-ble regulatory switch. On the one hand, ADAM17 is involved in physiological and protective process-es in development, regeneration and immune re-sponses, which is illustrated by the perinatal lethali-ty of ADAM17 deficient mice (1) as well as by the compromised regenerative capabilities of hypo-morphic ADAM17 mice (2). On the other hand, ADAM17 is associated with uncontrolled inflam-mation and cancer progression, as evidenced by studies using conditional knock-out mice (3-5). The broad range of biological processes, which are in-fluenced by ADAM17 is reflected by the wide vari-ety of more than 75 substrates which are shed by

http://www.jbc.org/cgi/doi/10.1074/jbc.M114.557322The latest version is at JBC Papers in Press. Published on April 30, 2014 as Manuscript M114.557322

Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

2

this enzyme. These substrates belong to diverse groups like growth factors, adhesion molecules, pro-inflammatory cytokines as well as cytokine receptors (5) and include proteins like vascular cell adhesion molecule-1 (6), L-selectin (7), tumour necrosis factor- (TNF-) (8,9), TNF- receptor I (TNFRI) (10), the interleukin-1 receptor (IL-1R) II (10) and the interleukin-6 receptor (IL-6R) (11).

The shedding process not only provides a possi-bility for down-regulation of cell surface proteins, but also for initiating or inhibiting autocrine or paracrine signaling via soluble proteins like agonis-tic cytokines or (ant)agonistic soluble cytokine re-ceptors; for example, shedding of proTNF-α leads to the generation of the actual proinflammatory, soluble cytokine. Cleavage of the TNFRI decreases the TNF- sensitivity of cells expressing the respec-tive receptor, such as monocytes, macrophages and hepatocytes (12-14). In addition, the soluble TNFRI ectodomain acts as an antagonist of TNF- signal-ing mediated by its membrane-bound form. Both effects result in immunosuppressive and anti-apoptotic properties of TNFRI shedding (13,14). In clear contrast, shedding of IL-6R leads to the gen-eration of an agonist of IL-6 mediated signaling, the soluble IL-6R (sIL-6R). In contrast to membrane-bound IL-6R, which is associated with regenerative processes, the sIL-6R bears mainly proinflammato-ry properties (15-17).

ADAM17 and ADAM10 are atypical members of the ADAM family, because their extracellular region comprises the following domains: a pro-, a catalytic-, a disintegrin- and a membrane-proximal domain (MPD) as well as a small stalk region (18-20). In contrast, typical members of the ADAM family comprise a cysteine-rich and EGF-like do-main instead of the MPD (20). According to its type-I transmembrane protein topology, the extra-cellular part of ADAM17 ends in a single trans-membrane region and a cytoplasmic tail (20).

The mechanisms of regulation of ADAM17 shedding activity are yet to be fully elucidated (21,22). Of the non-catalytically active extracellular domains, the disintegrin domain is known to inter-act with integrins, resulting in a steric hindrance and inactivation of ADAM17 (23-26). Stimulation leads to the dissociation of the inactive complex, resulting in a catalytically active protease (24,25).

In addition, the disintegrin domain of ADAM17 has been suggested to act as a scaffold. In this struc-tural model, the extracellular part adopts a C-shaped structure, placing the MPD in close proximity to the catalytic domain (18,27); this model implies a key role for the MPD in the regulation of ADAM17 activity. Accordingly, the MPD is involved in sub-strate recognition, multimerisation and regulation of ADAM17 (10,18,19,28-34). The MPD exists in two

isoforms and acts as a molecular switch in ADAM17: one isoform is open and elongated, cor-responds to the active enzyme and allows the mole-cule to be flexible; the second isoform is rigid and compact, and corresponds to the inactive form (19). The two isoforms differ in their disulfide-bond pat-tern, and the protein disulfide isomerase (PDI) con-trols ADAM17 activity by converting the flexible active MPD into the rigid inactive one (19). There-by two disulfide bounds undergo a specific isomeri-sation. This process changes the affected disulfide pattern from a sequential arrangement (C600-C630 and C635-C641), which is present in the elongated structure, to an overlapping pattern (C600-635 and C630-641), which exists in the compact structured MPD and is associated with the inactive enzyme (19).

A small stalk region between MPD and trans-membrane region is highly conserved, even be-tween humans and Drosophila melanogaster. Here, we show that binding of the IL-6R, but not TNF-α, which are both key ADAM17 substrates, is mediat-ed by this small -helical juxtamembrane segment, which we termed “Conserved ADAM-SeventeeN Dynamic Interaction Sequence” (CANDIS). Fur-thermore, we demonstrate that the substrate binding property of CANDIS is modulated by the MPD, which is switched by PDI.

Experimental Procedures

In silico methods - The sequential alignment was performed with ClustalW2. For secondary structure prediction, the method of Rost and Sander (35) as well as “HELIQUEST” (36) were used.

Modelling - The model structure of the CANDIS helix was built using the software WHATIF (37).

CD spectroscopy - Circular dichroism measure-ments were carried out with a Jasco-J-720-CD spec-tropolarimeter (Japan Spectroscopic Corporation, Easton, MD) as described in (38). All peptides were solved in 50 mM sodium phosphate buffer (pH 7.4) and the measurements were performed at 20 °C in a 0.01 cm quartz cuvette.

Coupling of antibodies and peptides to NHS-activated sepharose - Murine anti-PC antibody (HPC4), murine nonsense antibody (noAB) or pep-tides were coupled to NHS-activated Sepharose 4 Fast Flow (GE Healthcare, Munich, Germany) ac-cording to the manufacturer’s instructions. For pep-tide-coated beads, the following peptides were used:

CANDIS (peptide b) = RVQDVIERFWDFIDQLS_GSGSGK,

pA10 = VDADGPLARLKKAIFSP_ GSGSGK, control peptide (cp) =

DQWRVVQIEFDIDLFRS_ GSGSGK.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

3

For empty beads, the coupling procedure was performed only with PBS. All peptides were pur-chased from Biosyntan GmbH (Berlin, Germany) or peptides&elephants GmbH (Potsdam, Germany).

Pull-down experiments with peptide-coated beads - Cells transiently expressing human IL-6R, human IL-6R variants or MPD17plusCANDIS-GPI were harvested and lysed in 1 ml lysis buffer (50 mM Tris (pH 7.5), 200 mM NaCl, 2 mM EDTA, 1% Triton X-100, 5% glycerol and complete prote-ase inhibitor mixture without EDTA (Roche Ap-plied Science, Mannheim, Germany)). Peptide-coated beads (CANDIS, pA10 and cp, and empty beads were pre-washed with lysis buffer plus 5% bovine serum albumin (BSA). For the pull-down experiments, the lysate was divided into 200 µl aliquots and 800 µl lysis buffer was added to each aliquot. This mixture was incubated with 30 µl bead suspension (CANDIS-, cp-, pA10-coated beads or empty beads) for 30 min on ice. After incubation, five washing steps with lysis buffer were per-formed.

Cell culture and transfection - ADAM17ex/ex mouse embryonic fibroblasts (mEFs) (2) and HEK293 cells were cultured in Dulbecco’s modi-fied Eagle’s medium (DMEM) high-glucose with 10 % foetal calf serum (FCS), streptomycin (100 mg/l) and penicillin (60 mg/l) (all from PAA La-boratories, Cölbe, Germany) in a humidified incu-bator (37° C, 5% CO2).

For pull-down and co-immunoprecipitation ex-periments, 4 x 106 HEK293 cells were seeded in 10-cm culture dishes. After 24 h, a premixed solution of 8 µg DNA and 20 µl polyethylenimine (1 mg/ml) in 500 µl DMEM was added for transient transfec-tion. Cells were harvested 48 h after transfection.

For ADAM17 activity assays, 4 x 105

ADAM17ex/ex mEF cells were seeded in 6-well plates. After 24 h, transfection was performed with 4 µg DNA using TurboFect (Thermo Fisher Scien-tific Biosciences/Fermentas, St. Leon-Rot, Germa-ny) according to manufacturer’s instructions. The activity assays were performed 24 h after transfec-tion.

Co-immunoprecipitation - Before co-immunoprecipitation, beads were preincubated with 1 ml lysis buffer supplemented with 5% BSA and 5 mM CaCl2. HEK293 cells transiently co-expressing HE-ADAM17 and TIMP3 or wild-type ADAM17 and TIMP3, respectively, were lysed in 1 ml lysis buffer plus 5 mM CaCl2. The lysates were divided into two parts, and the same amounts of lysate were incubated with 30 µl HPC4- or noAB-coated beads (see above) for 30 min on ice. After incubation, the beads were washed five times with lysis buffer plus 5 mM CaCl2.

Expression plasmids of tagged ADAM17 plas-mids - To N-terminally tag murine pro-TNF-α with a 3*FLAG epitope, a pcDNA4TO-FLAG (N) vec-tor was created by designing an oligonucleotide encoding the 3*FLAG epitope (MMDYKDHDGDYKDHDIDYKDDDDK) and inserting it in the pcDNA4TO plasmid via the HindIII and NotI restriction sites. The cDNA en-coding the murine proTNF-α was amplified from murine spleen cDNA and subsequently cloned in the pcDNA4TO-FLAG (N) vector via NotI and XhoI restriction sites.

The human IL-1RII contains a myc-tag between signal peptide and the mature IL-1RII as described previously (28).

Western blotting - Western blot experiments were performed as described previously (29). For detection of the human IL-6R and its deletion vari-ants as well as chimeras V and X, we used the monoclonal murine antibody 4-11 (39); for human IL-6R chimeras I and IX, the monoclonal murine anti-myc antibody 9E10; for TIMP3, the monoclo-nal rabbit anti-TIMP3 antibody D74B10 (Cell Sig-naling Technology, Frankfurt, Germany); and for PC-tagged ADAM17 variants, the monoclonal anti-PC antibody HPC4. Together with HPC4, 4 mM CaCl2 was added to the antibody and washing buff-ers.

Construction of plasmids coding for human IL-6R deletion variant human IL-6RΔE317_Q332 - The human IL-6R deletion variant IL-6RΔE317_Q332 was cloned via splicing by over-lapping extension PCRs and cloned with a 5’ KpnI site and a 3’ NotI site into pcDNA3.1 as described previously (40).

Construction of plasmids coding for IL-6R, IL-11R and chimeras thereof - Expression plasmids for human IL-6R have already been described (39,41). The coding sequence for the human IL-11R, N-terminally fused with a myc-tag, was purchased from Life Technologies/GeneArt (Regensburg, Germany) and cloned into the pcDNA3.1 vector via a 5’ KpnI site and a 3’ NotI site. The creation of cytokine receptor chimeras was performed accord-ing to Garbers et al. (41). In brief, sequences of human IL-6R and human IL-11R were aligned, and borders between the individual domains were as-signed. All chimeras were constructed using stand-ard cloning procedures. To create chimera I, the stalk region of the human IL-11R (T317_A370) was replaced by its counterpart from human IL-6R (T316_P365). Chimera V was generated by replac-ing the human IL-6R stalk region (T316_P365) by the IL-11R stalk (T317_A370). In chimera IX, the ten amino acid residues directly before the trans-membrane domain of the IL-11R (D361_A370) were replaced by the analogous region of the

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

4

human IL-6R (V356_P365), and vice versa in chi-mera X. All chimeras were cloned into pcDNA3.1 using a 5’ KpnI site and a 3’ NotI site.

Human IL-6R ectodomain shedding assays in HEK293 cells and data analysis - Ectodomain shedding assays and their analysis for human IL-6R have been described in detail previously (40,41). In brief, HEK293 cells were transiently transfected and stimulated for 2 h with 100 nM PMA or dime-thylsulfoxide (DMSO) as a control. Where indicat-ed, cells were pretreated for 30 min with the metal-loprotease inhibitor marimastat (10 µM). Superna-tant was collected, cleared from debris by centrifu-gation, transferred into fresh tubes and stored at -20 °C for ELISA analysis (see below). To compare shedding of the different human IL-6R constructs, the amount of soluble wild-type human IL-6R gen-erated after PMA stimulation was set to 100%, and all other values were calculated in relation to this reference value.

Enzyme-linked immunosorbent assay (ELISA) - An ELISA specific for the human IL-6R was per-formed using the monoclonal antibody 4-11 (39) as capture antibody and biotinylated Baf227 (R&D Systems, Wiesbaden, Germany) as detection anti-body as described previously (39-41).

Construction of plasmids coding for ADAM17p10 - CANDIS was exchanged in PC-tagged full-length human ADAM17 with the corre-sponding peptide of human ADAM10 (see Figure 1C) by overlapping PCR using primer with respec-tive overhangs as in the construction of HE-ADAM17.

ADAM17 activity assay using alkaline phospha-tase tagged (AP) substrates and data analysis - ADAM17 activity was measured as described earli-er (28). ADAM17ex/ex mEFs were transfected with either wild-type ADAM17, HE-ADAM17, ADAM17p10 or peGFP together with N-terminally alkaline phosphatase-tagged IL-1RII (AP-IL-1RII) (28) in a ratio of 1:5. One day after transfection, the transfection medium was replaced by DMEM high-glucose. Cells were either left untreated, stimulated with 100 nM PMA or stimulated with PMA and treated with 50 μM of the metalloprotease inhibitor GM6001 (Merck Chemicals/Millipore, Schwalbach, Germany). Two hours later, the supernatants and cells were harvested. Cell pellets were lysed and AP activity in the lysates and cell supernatants was measured as described earlier (28) using p-nitrophenylphosphate (Sigma-Aldrich, Taufkirchen, Germany) as substrate. To determine shedding ac-tivity, the absorptions at 405 nm of supernatants were divided by those of the corresponding cell lysates. The ratios were normalized against the re-spective sample treated with PMA and marimastat. To exclude residual shedding activity of

ADAM17ex/ex mEFs, the values of the mock-transfected samples were subtracted from those of wild-type, HE-ADAM17 and ADAM17p10 sam-ples. Afterwards, shedding activity of the PMA treated wild-type ADAM17 sample were set to 100 %. Student’s t-test was performed using the online tool at http://www.physics.csbsju.edu/stats/t-test.html.

HEK293 cells were cotransfected with extracel-lular AP tagged substrates (human IL-1RII or hu-mane TNF-α) and an empty vector (mock) or PDIA6 expression vector (thermo scientific, USA) in a ratio 1:10. The activity assay were performed as described for ADAM17ex/ex mEFs, with the ex-ceptions that instead of 50 µM GM6001 10 μM of the metalloprotease inhibitor marimastat was used and after normalization of the ratios shedding activ-ity of the PMA treated mock samples were set to 100 %.

Visualization of the catalytic domain of ADAM17 - To visualize the catalytic domain of ADAM17 (PDB ID: 1BKC), the program PyMOL (42) was used.

Exchange of amino acid residue E406H and H415E in PC-tagged ADAM17 - PC-tagged full-length ADAM17 was used as template to generate the HE-ADAM17 mutein sequence by overlap ex-tension PCR. The template was separated into two halves with the cut at the site of the intended muta-tion. The 5’ half was generated using a forward primer annealing on the N-terminal end of native murine ADAM17 (GGGGTACCATGAGGCGGCGTCTCC) and a reverse primer bearing the first mutation (CTGCTCCAAAATTATGTCCCAAATGATGAGTTGTAACCAGGTCAGCTTCC); the second half was produced using a forward primer bearing the second mutation and overlapping partially with the first product (GGGACATAATTTTGGAGCAGAAGAAGACCCTGATGGGCTAGCAGAATGTGCC) and a re-verse primer annealing on the C-terminal end of ADAM17 (CGGGATCCGCACTCTGTCTCTTTGCTGTCAACTCG). After purification, both products were mixed in a 1:1 ratio and amplified by the flanking N-terminal and C-terminal primer. The resulting construct bears an exchange in amino acid residues E406H and H415E and was cloned in pcDNA3.1 (Life Technologies, Darmstadt, Germany).

Flow cytometry analysis - For flow cytometry analysis, ADAM17ex/ex mEF cells (2) were trans-fected either with wild-type ADAM17 or with HE-ADAM17. Staining and analysis were performed as described earlier (29), with the exception that mon-oclonal antibodies directed against the extracellular part of murine ADAM17 were used.

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

5

PDI-affected co-immunoprecipitation - HEK293 cells transiently expressing human IL-6R, MPD17plusCANDIS-GPI or HE-ADAM17 were harvested and lysed with 1 ml lysis buffer plus 5 mM CaCl2. HPC4-coated beads (60 µl) were washed with lysis buffer supplemented with 5% BSA and 5 mM CaCl2 and incubated with MPD17plusCANDIS-GPI or HE-ADAM17 lysates for 30 min on ice. After incubation, the beads were washed with PBS pH 7.4 and the suspension was divided into two parts, which were either treated with 10 µM reduced PDI in PBS or with PBS only for 15 min at room temperature. The reduced PDI was prepared as described earlier (19). After anoth-er washing step with lysis buffer plus 5 mM CaCl2, both aliquots of beads were incubated with the hu-man IL-6R lysate for 30 min on ice. After incuba-tion, the beads were washed five times with lysis buffer plus 5 mM CaCl2.

Analysis of the band intensity of Western blots - For quantifying the PDI-treated co-immunoprecipitations, the intensities of the human IL-6R bands and the ADAM17 construct bands were measured with the program ImageJ (43). The human IL-6R values were divided by the ADAM17 construct measurement values for each sample to obtain ratios. Within one experimental setting with a PDI- and a PBS-incubated sample, the ratios of both samples were divided through the ratio of the PBS-incubated sample.

Results

An unusually conserved region in the stalk re-gion of ADAM17 - ADAM17 is a multi-domain membrane bound protease; its extracellular part contains a pro-, a catalytic-, a disintegrin- and a membrane-proximal domain (MPD). The MPD is connected to the transmembrane region by a short stalk of 29 amino acid residues (Fig. 1A). A com-parison of the respective amino acid sequences of ADAM17 from different species revealed that the first 14 amino acid residues of this juxtamembrane region are highly conserved (Fig. 1B). Notably, such high conservation does not exist in case of ADAM10, the closest relative of ADAM17.

Since the 14 amino acid residues directly adja-cent to the MPD of ADAM17 are that highly con-served and do not belong to the MPD (19), we hy-pothesized that this segment might be important for the functionality of ADAM17. A secondary struc-ture prediction revealed that these amino acid resi-dues form an -helix. This feature suggests that this juxtamembrane segment of ADAM17 might be important for protein-protein interactions. There-fore, we named this region CANDIS (“Conserved ADAM-SeventeeN Dynamic Interaction Se-quence”). In order to validate the structure predic-

tion, we examined the secondary structure of two CANDIS peptides by CD spectroscopy. The first peptide contained 24 amino acid residues corre-sponding to the wild-type sequence (peptide a), whereas the second peptide contained only the re-gion predicted to be -helical fused C-terminally to a flexible linker (peptide b). A corresponding pep-tide of ADAM10 (pA10) and a randomized se-quence of CANDIS (cp) were used as controls. Both CANDIS peptides showed CD-spectra typical for an -helical conformation (Fig. 1C). In contrast, spectra of both control peptides represented ran-dom-coil structures. In case of peptide a, the -helical content and/or stability seemed even more pronounced compared to peptide b. These findings confirmed that CANDIS formed an α-helix.

CANDIS binds to the IL-6R and IL-1RII, but not to TNF- - For the human IL-6R and IL-1RII, the MPD of ADAM17 has been described to be in-volved in ligand recognition (28). In this particular study, the MPD was linked by a glycosylphosphati-dylinositol (GPI) anchor to the plasma membrane (Fig. 2A). Since this MPD17 construct contained CANDIS, we changed its name to MPD17plusCANDIS-GPI, and our next question was whether CANDIS alone is able to recognize the human IL-6R. For this experiment, CANDIS, the corresponding peptide of ADAM10 (pA10), and a randomized control peptide (cp) were fused C-terminally to a linker sequence (GSGSGK) and coupled to Sepharose beads (Fig. 2B). These beads were used to pull down the IL-6R from lysates of HEK293 cells transiently transfected with IL-6R cDNA. The resulting Western blots clearly demon-strated that CANDIS bound to the IL-6R, whereas the control peptides (pA10 and cp) did not (Fig. 2C). These results indicate that CANDIS is suffi-cient for binding of the IL-6R.

Since the IL-6R is a type-I membrane protein, we investigated whether CANDIS is able to bind a second type-I transmembrane protein, the IL-1RII as well as the type-II transmembrane protein proTNF-α. For this purpose, a pull-down experi-ment with cell lysates of IL-1RII-, proTNF-α‐and IL-6R-expressing cells was conducted (Fig. 2D). This experiment clearly showed that CANDIS in-teracted specifically with the type-I transmembrane molecules, the IL-1RII and IL-6R, but not with the type-II transmembrane protein proTNF-α.

Binding site of CANDIS in the IL-6R - As CANDIS was identified as an IL-6R binding mod-ule of ADAM17, our next aim was to identify the CANDIS binding site in the humane IL-6R. While IL-6R is described to be a substrate of ADAM17, IL-11R is not. Chimeras of the human IL-6R and human IL-11R were generated to identify the

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

6

CANDIS binding site within the IL-6R. To deter-mine whether the stalk region of IL-6R is needed for CANDIS binding, we generated chimera I (IL-11R with the stalk of the IL-6R) and chimera V (vice versa, Fig. 3A). Using CANDIS and control peptides coupled to sepharose beads, chimera I and V were analysed with respect to their CANDIS binding properties. The resulting Western blot anal-ysis revealed that the stalk region of the IL-6R was essential for CANDIS binding, because chimera I (consisting of IL-11R with the stalk of IL-6R) was specifically pulled down by CANDIS, whereas chimera V (consisting of IL-6R with the stalk of IL-11R) was not (Fig. 3B)

Next, the requirement of the membrane-proximal region of IL-6R, containing the cleavage site of ADAM17, for CANDIS binding was ana-lysed. The cleavage site of ADAM17 in the human IL-6R is located C-terminally of Q357 (44). Chime-ra IX and X were cloned (Fig. 3A). Chimera IX contained the sequence of IL-11R with the mem-brane-proximal region of IL-6R (exchange of D361-A370 of IL-11R to V356-P365 of IL-6R). Accordingly, chimera X contained the IL-6R with the membrane-proximal region of the IL-11R (vice versa to chimera IX). Pull-down experiments with these chimeras revealed that the ADAM17 cleavage site and the membrane-proximal region of the IL-6R had no influence on CANDIS binding, as chi-mera X (IL-6R with membrane-proximal region of IL-11R) was pulled down by CANDIS, whereas chimera IX (IL-11R with the membrane-proximal region of IL-6R) was not (Fig. 3B).

To further narrow down the CANDIS interaction site of the IL-6R, we used IL-6R stalk region dele-tion variants (Fig. 3C), which were recently de-scribed (40). The variant IL-6R∆A333_V362 (∆30) comprised a deletion of the ADAM17 cleavage site as well as of the C-terminal part of the stalk region. As shown in Fig. 3D, IL-6R∆A333_V362 (∆30) was specifically pulled down by CANDIS beads, but not by control beads indicating that the CANDIS binding site was not in the deleted part C-terminally adjacent to the ADAM17 cleavage site. In contrast, a deletion variant IL-6R∆E317_T352 (∆36) lacking the N-terminal part of the stalk region did not bind to CANDIS (Fig. 3D). Taken together, these results suggested that CANDIS binds directly adjacent to domain 3 within amino acid residues E317–Q332 of the IL-6R stalk region (Fig. 3E).

To verify this finding, amino acid residues E317–Q332 were deleted in another IL-6R mutein, resulting in IL-6R∆E317_Q332 (∆16) (Fig. 4A). CANDIS pull-down experiments clearly demon-strated that this variant, in contrast to wild-type IL-6R, did not bind to CANDIS (Fig. 4B). Subsequent-ly, we investigated whether binding of CANDIS to

IL-6R had an influence on the eligibility of IL-6R as a substrate for ADAM17. For this purpose, the mutein IL-6R∆E317_Q332 (∆16) and wild-type IL-6R were transiently transfected into HEK293 cells, which endogenously expressed ADAM17. Two days later, ADAM17 activity was stimulated by the addition of phorbol-12-myristate-13-acetate (PMA), and the shed IL-6R in the supernatant was measured by enzyme-linked immunosorbent assay (ELISA). Intriguingly, shedding of the IL-6R deletion variant without the CANDIS binding site [IL-6R∆E317_Q332 (∆16)] was significantly reduced compared to the wild-type IL-6R (Fig. 4C). These data suggest that, even though shedding is not com-pletely abolished, binding of ADAM17 to IL-6R via CANDIS occurs in the region E317–Q332 of the receptor and is essential for efficient shedding of the IL-6R by ADAM17.

To confirm the impact of CANDIS in ADAM17 shedding activity, we exchanged CANDIS in the wild-type molecule with the corresponding peptide of ADAM10, thereby generating a chimera called ADAM17p10. Afterwards its shedding ability was analysed. To this end, mouse embryonic fibroblasts from hypomorphic ADAM17 mice (ADAM17ex/ex

mEFs) were used, which showed a reduction in ADAM17 expression of about 95% (2). Since all trials to transfect AP-tagged human IL-6R into these cells failed, human AP tagged IL-1RII was used as substrate. Nevertheless, the obtained data clearly show that the shedding activity of the chi-meric ADAM17p10, lacking CANDIS, is signifi-cantly reduced compared to wild-type ADAM17 (Fig. 4D).

IL-6R binding to the MPD-CANDIS region can be inhibited by PDI - ADAM17 enzymatic activity is down-regulated by the action of cell-surface lo-cated PDI (19,33). In this context, the MPD of ADAM17 acts as a molecular switch (19). There-fore, we investigated whether the inhibitory effect of PDI was due to blocked access of the juxtamem-brane CANDIS to its substrate as a consequence of the structural change in the extracellular part of ADAM17. As PDI activity is influenced by prote-ase inhibitors, the first attempts to precipitate wild-type ADAM17 with human IL-6R failed due to protease activity and self-digestion. To prevent this, we constructed an ADAM17 variant (Fig. 5), which is catalytically inactive, but retains an almost native architecture in its active site. As ADAM17 is a member of the metzincin superfamily, it contains a Zn2+ ion in its active site, which is coordinated by three histidine residues in the conserved „HEXXHXXGXXHD“-motive, the glutamic acid residue in this motive acts as a catalytic base (20). In order to obtain an inactive ADAM17 variant, we used an approach, which was already applied to

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

7

create an inactive matrix metalloprotease 9 mutein being still able to bind its inhibitor, the tissue in-hibitor of metalloproteases (TIMP)-1 (45). To ob-tain a corresponding mutein of ADAM17, the active site of C-terminally PC-tagged murine ADAM17 was altered by site directed mutagenesis of E406H and H415E (Fig. 5A), which changed the „HEXXHXXGXXHD“-motive into a “HHXXHXXGXXED”-motive and resulted in a variant termed HE-ADAM17. The successful ex-pression of HE-ADAM17 on the cell surface was verified by flow cytometry (Fig. 5B).

Next, the enzymatic activities of HE-ADAM17 and wild-type ADAM17 were compared. ADAM17ex/ex mEFs were co-transfected with N-terminally alkaline phosphatase (AP)-tagged IL-1RII as an ADAM17 substrate and either wild-type ADAM17 or HE-ADAM17. One day after transfec-tion, the shedding activity of the cells was tested by stimulation with PMA and detection of the released IL-1RII ectodomain (Fig. 5C). The HE-ADAM17 mutein did not show any shedding activity, neither unstimulated nor after PMA stimulation. In con-trast, cells transfected with wild-type ADAM17 displayed significant release of IL-1RII ectodomain after PMA stimulation (Fig. 5C). To ensure that differences in the ADAM17 activity assay were not due to variations in the expression levels of the transfected cells, all lysates of the assay were exam-ined by Western blot, demonstrating that the ex-pression levels of wild-type ADAM17 and the HE mutein were comparable (Fig. 5D).

TIMP3 is a natural inhibitor of ADAM17 and binds directly to the active site of the enzyme. To test our hypothesis that the histidine/glutamic acid (HE) exchange led to a virtually unaltered active site architecture despite the loss of function, the HE mutein’s ability to bind to TIMP3 was analysed in co-immunoprecipitation experiments. For this pur-pose, C-terminally PC-tagged ADAM17 or HE-ADAM17 were co-transfected with TIMP3 and, after cell lysis, immunoprecipitated via their PC tag. The following Western blot analyses showed that both wild-type ADAM17 and HE-ADAM17 inter-acted with TIMP3 in a comparable manner (Fig. 5E). As the HE-ADAM17 was inactive, but still able to bind an interaction partner with its active site, this mutein was used to study the interaction of ADAM17 with the IL-6R in terms of the PDI-catalyzed inactivation of ADAM17.

To test whether PDI abrogates recognition of the IL-6R by ADAM17, co-precipitation experiments were performed. HEK293 cells were transiently transfected with IL-6R or HE-ADAM17. HE-ADAM17-expressing cells were lysed, and HE-ADAM17 was bound to Sepharose beads via its C-terminal PC-tag. These beads were either incubated

with reduced PDI in PBS or in PBS without PDI as a control. Afterwards, the beads were incubated with cell lysates of HEK293 cells expressing IL-6R. The amount of IL-6R bound to the bead-coupled HE-ADAM17 was analyzed by Western blotting. In contrast to the non-PDI treated samples, PDI pre-treatment prevented binding of IL-6R to HE-ADAM17 (Fig. 6A and B). These results clearly indicate that the structural change in the extracellu-lar part of ADAM17, mediated by PDI, abrogates IL-6R recognition.

Since the PDI-catalysed structural change occurs in the MPD, further experiments were conducted using MPD17plusCANDIS-GPI instead of HE-ADAM17 (see Fig. 2A). This construct contained the MPD and the juxtamembrane CANDIS, but no additional domains of ADAM17. As shown in Fig. 6A and 4B, binding of MPD17plusCANDIS-GPI to IL-6R was also prevented by pretreatment of MPD17plusCANDIS-GPI with PDI. These results suggest that PDI treatment, which converts the open flexible MPD to its closed rigid structure (19), is sufficient to abrogate IL-6R recognition by CANDIS. This effect is most likely due to an abro-gated access of CANDIS to IL-6R due to steric hindrances by the closed MPD. Taken together, the MPD of ADAM17 acts as switch within the mole-cule, and this switch abrogates IL-6R recognition by a specific juxtamembrane α-helical segment, CANDIS, and is controlled by PDI.

As previous experiments demonstrated that ex-ogenous PDI or overexpression of PDIA6 reduces shedding of proheparin-binding epidermal growth factor (33) and humane IL-6R (19, supplementary information), an intriguing question was whether this is also the case with IL-1RII or TNF-α. Hence, we performed ADAM17 shedding assays using extracellular alkaline phosphatase-tagged IL-1RII and TNF-α. Interestingly, shedding of both sub-strates by ADAM17 is significantly reduced by overexpression of PDIA6 (Fig. 6C). These results suggest that, although TNF-α is not accessed by CANDIS, the PDI-mediated structural change in the MPD of ADAM17 is sufficient to abrogate shed-ding by the inactivation of ADAM17.

Discussion

ADAM17 is a major sheddase of various sub-strates which are involved in regeneration processes and immune responses. An uncontrolled release of growth factors, cytokines and cytokine receptors catalyzed by the enzyme has to be prevented to minimize the risk of cancer progression and auto-immune diseases. In contrast, the absence or reduc-tion of growth factor release from the cell surface by ADAM17 diminishes regenerative processes (2). Hence, ADAM17 activity has to be tightly and

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

8

efficiently controlled. Accordingly, activated ADAM17 is rapidly switched off by a PDI-mediated structural change of ADAM17’s MPD (19,33). Intriguingly, this off-switch changes the flexible, elongated MPD structure into a compact, rigid one (19). So far, it was completely unknown how this structural change modulated ADAM17 activity. In the present study, we demonstrate for the first time how shedding of the IL-6R, one of the most important substrates of ADAM17, is con-trolled by the enzyme, and which amino acids are crucial for the particular enzyme-substrate interac-tion, in both, in ADAM17 as well as in the IL-6R.

Directly adjacent to the MPD of ADAM17, we discovered a unique highly conserved region of 14 amino acid residues with an α-helical character. Although this region displays secondary structure elements, it seems not to belong to a distinct do-main. The fact that the MPD folded properly in a single monomeric protein (19) underscores the find-ing that CANDIS is not a part of the MPD. Interest-ingly, a CANDIS-like region is not present in ADAM10, the closest structural relative of ADAM17. Even though the two proteases share some substrates, there are significant differences. For example, ADAM17 always needs an activation step (21,22), whereas ADAM10 can also be consti-tutively active. Accordingly, the activation and regulation of both proteases are different (21,22). In addition, the cleavage sites of ADAM10 and ADAM17 in the human IL-6R, a substrate of both proteases, are not identical (40). Furthermore, the mode of substrate recognition appears to be quite different, as ADAM17’s CANDIS binds to the hu-mane IL-6R, but the corresponding region of ADAM10 does not.

Previous reports demonstrated species-specific differences with respect to IL-6R shedding. Where-as human IL-6R is efficiently shed by human as well as by murine ADAM17, murine IL-6R is pro-cessed to a lesser extent (41,46). These findings support our results, as human and murine CANDIS are identical. In contrast, the CANDIS-binding re-gion of the human IL-6R shows only 38% identity to the corresponding region in the murine IL-6R. As the overall identity between human and murine IL-6R is also relatively low (54%), it is not surprising that they are recognized and processed in different ways.

To identify the exact CANDIS binding site in the human IL-6R, deletion variants of the receptor human IL-6R and IL-6R/IL-11R chimeras were used. Pull-down experiments with these proteins allowed to narrow down the CANDIS binding site in the stalk region of the IL-6R to the sequence E317SRSPPAENEVSTPMQ332. These amino acid residues are located directly adjacent to the C-

terminal domain (domain 3) in the extracellular part of the IL-6R. In contrast to CANDIS, this region in the IL-6R has definitely no α-helical character. The importance of this region for binding and effective shedding by ADAM17 was proven by an IL-6R deletion variant lacking exactly this sequence [IL-6R∆E317_Q332 (∆16)]. In these experiments, PMA was used to stimulate shedding, as PMA does not activate IL-6R shedding by ADAM10, but only by ADAM17 (21,41). The IL-6R variant lacking the CANDIS binding site was shed significantly less than wild-type IL-6R. A comparable result was obtained performing the reciprocal experiment, in which we used an ADAM17 chimera containing the sequence of ADAM10 corresponding to CANDIS (ADAM17p10) and tested it in an IL-1RII shedding assay (Fig. 5D). The residual shedding in the ab-sence of CANDIS suggested that the affinity of ADAM17 to substrates like human IL-6R and IL-1RII is strongly increased, but not absolutely con-trolled, by CANDIS. This is reasonable, as no ma-jor structural changes in the IL-6R∆E317_Q332 (∆16) compared to the wild-type IL-6R are to be expected. The reduced, but not abrogated, shedding of IL-6R∆E317_Q332 (∆16) clearly shows that the substrate-binding site of CANDIS is not identical with the ADAM17 cleavage site.

After identification of CANDIS as key binding site of ADAM17 for the IL-6R, its link to the MPD, the molecular off-switch of ADAM17, was studied. ADAM17 activity is blocked by a conformational change from an elongated, open MPD to a compact, closed conformation mediated by PDI through di-sulfide isomerisation (19). Our results suggest that this structural change indeed blocks access of the juxtamembrane CANDIS to ADAM17 substrates and, thus, blocks ADAM17 activity. Juxtamem-brane segments appear to be central regulatory units within membrane proteins. Thereby, these α-helical regions are switched by structural changes and are needed for appropriate regulation of the full-length molecule. A juxtamembrane segment in the epi-dermal growth factor receptor (EGFR) has recently been described to be a crucial part in the activation of this receptor (47,48). Although this intracellular EGFR element is neither functionally nor structural-ly related to the extracellular CANDIS, these two examples put the focus on such juxtamembrane regions as a novel and very important class of struc-tural regulatory elements.

Taken together, we show that CANDIS is re-sponsible for IL-6R binding of ADAM17 and that the CANDIS binding site of the IL-6R is different from its ADAM17 cleavage site. In turn, IL-6R binding by CANDIS is abrogated by the PDI-mediated conformation switch of ADAM17’s MPD. In accordance, shedding of human IL-6R is

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

9

blocked by overexpression of PDIA6 (19). As CANDIS also binds to the IL-1RII, it is not surpris-ing that overexpression of PDIA6 also reduces its shedding, most likely due to an enhanced inactiva-tion rate of ADAM17. Although this effect does not seem to be as strong as in the case of IL-6R, one should keep in mind that HEK293 cells express PDIA1 as well as PDIA6. Both enzymes are well known to be located on the cell surface (33,49-55). Hence, the effect observed in PDIA6 overexpres-sion experiments will be an additive effect on en-dogenously active PDIs. In contrast, the finding that PDIA6 reduces TNF-α shedding to the same extent as that of IL-1RII was surprising. Hence, inactiva-tion of ADAM17 by PDIs seems to be independent of the topology of the substrates and mediated due to the structural change of the MPD. This abrogates substrate accessibility by CANDIS, but potentially also restricts access to the catalytic site. To clarify this point in detail, a next step will be to solve the structure of either full-length ADAM17 or its ecto-domain in the presence or absence of PDI and ulti-mately with or without different ADAM17 sub-strates to reveal the true shape of the ectodomain and its access to its substrates.

CANDIS seems to be essential for binding of transmembrane type-I proteins like human IL-6R and IL-1RII, but other substrates like the trans-membrane-type II protein proTNF-α might be ac-cessed by ADAM17 in different ways. This is in accordance with the finding that full-length ADAM17 is able to precipitate TNF-α 56 , whereas MPD17plusCANDIS (28) and CANDIS alone are not (Fig 2D). These data suggest that at least two different modes of interactions exist, which depend on the topology of the substrates. As ADAM17 has more than 75 known substrates, to study the interaction modes of various classes of substrates and to categorize them will be a chal-lenge, but can provide important insights into the action and control of ADAM17 and signaling pro-teases in general.

As ADAM17 generates two of the most im-portant initiators of immune responses, namely TNF-α and the soluble (s)IL-6R, ADAM17 is a key factor in the pathophysiology of autoimmune and chronic diseases (5,17,57). Hence, ADAM17 bears a high potential as therapeutic target. Until now, there are no successful treatments with specific ADAM17 inhibitors (58). One main reason is that small molecule inhibitors lack specificity and also inhibit related proteases of the MMP and ADAM family (58). To overcome this difficulty, Tape et al. developed an ADAM17 antibody which binds to extracellular parts of the enzyme, thereby inhibiting shedding activity (34). This antibody is a potential therapeutic, since it displays promising results in

respect of tumour growth in an in vivo ovarian can-cer model (58), which points out that antibodies might be promising therapeutic options. In line, the knowledge about specific interaction sites and ac-tions of MPD and CANDIS for different types of substrates could open the field for specific thera-peutic interventions by using specific blocking anti-bodies.

An inhibition of regeneration is most likely problematic in autoimmune diseases and chronic inflammation. Importantly, proTNF-α and IL-6R show regenerative properties in their membrane bound form and are converted by shedding into pro-inflammatory mediators (5,17,57). In line with these findings, treatment of chronic inflammatory diseases like rheumatoid arthritis and inflammatory bowel diseases by long-term blockade of TNF-α signaling can be associated with dangerous side effects, such as an increased risk of infection, the development of autoimmune diseases and malignity (57). This may be due to the fact that a complete blockade of TNF-α signaling also affects the regen-erative, immunoprotective signaling transmitted by TNFRII and proTNF-α, and not only the pro-inflammatory signals mediated by TNFRI and solu-ble TNF-α (57). Similarly, a complete blockade of IL-6 signaling is unfavorable, as membrane-bound IL-6R is known to be involved in regenerative re-sponse and defense of bacterial infections, whereas the sIL-6R mediates the pathological inflammatory responses (15-17). Hence, it might be advantageous to selectively block the generation of sIL-6R, as a selective blockade of sIL-6R showed therapeutic potentials in many models of acute and chronic inflammation (16,17). A selective blockade of sIL-6R generation, without affecting TNF-αand mem-brane bound IL-6R signaling cascades, could be probably achieved by CANDIS-binding antibodies or single Fv fragments, suggesting that these mole-cules might be promising and exciting tools to se-lectively block pro-inflammatory processes and still permit regenerative activities of this cytokine.

REFERENCES

1. Peschon, J. J., Slack, J. L., Reddy, P., Stocking, K. L., Sunnarborg, S. W., Lee, D. C., Russell, W. E., Castner, B. J., Johnson, R. S., Fitzner, J. N., Boyce, R. W., Nelson, N., Kozlosky, C. J., Wolfson, M. F., Rauch, C. T., Cerretti, D. P., Paxton, R. J., March, C. J., and Black, R. A. (1998) An Essential Role for Ectodomain Shedding in Mammalian Development. Science (New York, N.Y 282, 1281-1284

2. Chalaris, A., Adam, N., Sina, C., Rosenstiel, P., Lehmann-Koch, J., Schirmacher, P., Hartmann, D., Cichy, J., Gavrilova, O.,

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

10

Schreiber, S., Jostock, T., Matthews, V., Hasler, R., Becker, C., Neurath, M. F., Reiss, K., Saftig, P., Scheller, J., and Rose-John, S. (2010) Critical role of the disintegrin metalloprotease ADAM17 for intestinal inflammation and regeneration in mice. J Exp Med 207, 1617-1624

3. Horiuchi, K., Kimura, T., Miyamoto, T., Takaishi, H., Okada, Y., Toyama, Y., and Blobel, C. P. (2007) Cutting edge: TNF-alpha-converting enzyme (TACE/ADAM17) inactivation in mouse myeloid cells prevents lethality from endotoxin shock. J Immunol 179, 2686-2689

4. Pruessmeyer, J., and Ludwig, A. (2009) The good, the bad and the ugly substrates for ADAM10 and ADAM17 in brain pathology, inflammation and cancer. Seminars in cell & developmental biology 20, 164-174

5. Scheller, J., Chalaris, A., Garbers, C., and Rose-John, S. (2011) ADAM17: a molecular switch to control inflammation and tissue regeneration. Trends Immunol 32 380-387

6. Garton, K. J., Gough, P. J., Philalay, J., Wille, P. T., Blobel, C. P., Whitehead, R. H., Dempsey, P. J., and Raines, E. W. (2003) Stimulated shedding of vascular cell adhesion molecule 1 (VCAM-1) is mediated by tumor necrosis factor-alpha-converting enzyme (ADAM 17). The Journal of biological chemistry 278, 37459-37464

7. Venturi, G. M., Tu, L., Kadono, T., Khan, A. I., Fujimoto, Y., Oshel, P., Bock, C. B., Miller, A. S., Albrecht, R. M., Kubes, P., Steeber, D. A., and Tedder, T. F. (2003) Leukocyte migration is regulated by L-selectin endoproteolytic release. Immunity 19, 713-724

8. Black, R. A., Rauch, C. T., Kozlosky, C. J., Peschon, J. J., Slack, J. L., Wolfson, M. F., Castner, B. J., Stocking, K. L., Reddy, P., Srinivasan, S., Nelson, N., Boiani, N., Schooley, K. A., Gerhart, M., Davis, R., Fitzner, J. N., Johnson, R. S., Paxton, R. J., March, C. J., and Cerretti, D. P. (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385, 729-733

9. Moss, M. L., Jin, S. L., Milla, M. E., Bickett, D. M., Burkhart, W., Carter, H. L., Chen, W. J., Clay, W. C., Didsbury, J. R., Hassler, D., Hoffman, C. R., Kost, T. A., Lambert, M. H., Leesnitzer, M. A., McCauley, P., McGeehan, G., Mitchell, J., Moyer, M., Pahel, G., Rocque, W., Overton, L. K., Schoenen, F., Seaton, T., Su, J. L., Becherer, J. D., and al., e. (1997) Cloning of a disintegrin

metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 385, 733-736

10. Reddy, P., Slack, J. L., Davis, R., Cerretti, D. P., Kozlosky, C. J., Blanton, R. A., Shows, D., Peschon, J. J., and Black, R. A. (2000) Functional analysis of the domain structure of tumor necrosis factor-alpha converting enzyme. The Journal of biological chemistry 275, 14608-14614

11. Müllberg, J., Dittrich, E., Graeve, L., Gerhartz, C., Yasukawa, K., Taga, T., Kishimoto, T., Heinrich, P. C., and Rose-John, S. (1993) Differential shedding of the two subunits of the interleukin-6 receptor. FEBS Lett 332, 174-178

12. Santos, D. O., Lorre, K., de Boer, M., and Van Heuverswyn, H. (1999) Shedding of soluble receptor for tumor necrosis factor alpha induced by M. leprae or LPS from human mononuclear cells. Nihon Hansenbyo Gakkai Zasshi 68, 185-193

13. Bell, J. H., Herrera, A. H., Li, Y., and Walcheck, B. (2007) Role of ADAM17 in the ectodomain shedding of TNF-alpha and its receptors by neutrophils and macrophages. J Leukoc Biol 82, 173-176

14. Chanthaphavong, R. S., Loughran, P. A., Lee, T. Y., Scott, M. J., and Billiar, T. R. (2012) A role for cGMP in inducible nitric-oxide synthase (iNOS)-induced tumor necrosis factor (TNF) alpha-converting enzyme (TACE/ADAM17) activation, translocation, and TNF receptor 1 (TNFR1) shedding in hepatocytes. The Journal of biological chemistry 287, 35887-35898

15. Rose-John, S., Scheller, J., Elson, G., and Jones, S. (2006) Interleukin-6 Biology is Coordinated by Membrane-Bound and Soluble Receptors: Role in Inflammation and Cancer. J Leuk Biol 80, 227-236

16. Scheller, J., Chalaris, A., Schmidt-Arras, D., and Rose-John, S. (2011) The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochimica et biophysica acta 1813, 878-888

17. Jones, S. A., Scheller, J., and Rose-John, S. (2011) Therapeutic strategies for the clinical blockade of IL-6/gp130 signaling. J Clin Invest 121, 3375-3383

18. Janes, P. W., Saha, N., Barton, W. A., Kolev, M. V., Wimmer-Kleikamp, S. H., Nievergall, E., Blobel, C. P., Himanen, J. P., Lackmann, M., and Nikolov, D. B. (2005) Adam meets Eph: an ADAM substrate recognition module acts as a molecular switch

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

11

for ephrin cleavage in trans. Cell 123, 291-304

19. Düsterhöft, S., Jung, S., Hung, C. W., Tholey, A., Sönnichsen, F. D., Grötzinger, J., and Lorenzen, I. (2013) Membrane-proximal domain of a disintegrin and metalloprotease-17 represents the putative molecular switch of its shedding activity operated by protein-disulfide isomerase. J Am Chem Soc 135, 5776-5781

20. Takeda, S. (2009) Three-dimensional domain architecture of the ADAM family proteinases. Seminars in cell & developmental biology 20, 146-152

21. Le Gall, S. M., Bobé, P., Reiss, K., Horiuchi, K., Niu, X. D., Lundell, D., Gibb, D. R., Conrad, D., Saftig, P., and Blobel, C. P. (2009) ADAMs 10 and 17 Represent Differentially Regulated Components of a General Shedding Machinery for Membrane Proteins such as TGF{alpha}, L-Selectin and TNF{alpha}. Molecular biology of the cell 20, 1785-1794

22. Le Gall, S. M., Maretzky, T., Issuree, P. D., Niu, X. D., Reiss, K., Saftig, P., Khokha, R., Lundell, D., and Blobel, C. P. (2010) ADAM17 is regulated by a rapid and reversible mechanism that controls access to its catalytic site. J Cell Sci 123, 3913-3922

23. Bax, D. V., Messent, A. J., Tart, J., van Hoang, M., Kott, J., Maciewicz, R. A., and Humphries, M. J. (2004) Integrin alpha5beta1 and ADAM-17 interact in vitro and co-localize in migrating HeLa cells. The Journal of biological chemistry 279, 22377-22386

24. Saha, A., Backert, S., Hammond, C. E., Gooz, M., and Smolka, A. J. (2010) Helicobacter pylori CagL activates ADAM17 to induce repression of the gastric H, K-ATPase alpha subunit. Gastroenterology 139, 239-248

25. Göoz, P., Dang, Y., Higashiyama, S., Twal, W. O., Haycraft, C. J., and Gooz, M. (2012) A disintegrin and metalloenzyme (ADAM) 17 activation is regulated by alpha5beta1 integrin in kidney mesangial cells. PLoS One 7, e33350

26. Trad, A., Riese, M., Shomali, M., Hedeman, N., Effenberger, T., Grötzinger, J., and Lorenzen, I. (2013) The disintegrin domain of ADAM17 antagonises fibroblastcarcinoma cell interactions. Int J Oncol 42, 1793-1800

27. Takeda, S., Igarashi, T., Mori, H., and Araki, S. (2006) Crystal structures of VAP1 reveal ADAMs' MDC domain architecture

and its unique C-shaped scaffold. The EMBO journal 25, 2388-2396

28. Lorenzen, I., Lokau, J., Düsterhoft, S., Trad, A., Garbers, C., Scheller, J., Rose-John, S., and Grötzinger, J. (2012) The membrane-proximal domain of A Disintegrin and Metalloprotease 17 (ADAM17) is responsible for recognition of the interleukin-6 receptor and interleukin-1 receptor II. FEBS Lett 586, 1093-1100

29. Lorenzen, I., Trad, A., and Grötzinger, J. (2011) Multimerisation of A disintegrin and metalloprotease protein-17 (ADAM17) is mediated by its EGF-like domain. Biochemical and biophysical research communications 415, 330-336

30. Milla, M. E., Leesnitzer, M. A., Moss, M. L., Clay, W. C., Carter, H. L., Miller, A. B., Su, J. L., Lambert, M. H., Willard, D. H., Sheeley, D. M., Kost, T. A., Burkhart, W., Moyer, M., Blackburn, R. K., Pahel, G. L., Mitchell, J. L., Hoffman, C. R., and Becherer, J. D. (1999) Specific sequence elements are required for the expression of functional tumor necrosis factor-alpha-converting enzyme (TACE). The Journal of biological chemistry 274, 30563-30570

31. Li, X., and Fan, H. (2004) Loss of ectodomain shedding due to mutations in the metalloprotease and cysteine-rich/disintegrin domains of the tumor necrosis factor-alpha converting enzyme (TACE). The Journal of biological chemistry 279, 27365-27375

32. Wang, Y., Herrera, A. H., Li, Y., Belani, K. K., and Walcheck, B. (2009) Regulation of mature ADAM17 by redox agents for L-selectin shedding. J Immunol 182, 2449-2457

33. Willems, S. H., Tape, C. J., Stanley, P. L., Taylor, N. A., Mills, I. G., Neal, D. E., McCafferty, J., and Murphy, G. (2010) Thiol isomerases negatively regulate the cellular shedding activity of ADAM17. Biochem J 428, 439-450

34. Tape, C. J., Willems, S. H., Dombernowsky, S. L., Stanley, P. L., Fogarasi, M., Ouwehand, W., McCafferty, J., and Murphy, G. (2011) Cross-domain inhibition of TACE ectodomain. Proc Natl Acad Sci U S A 108, 5578-5583

35. Rost, B., and Sander, C. (1993) Prediction of protein secondary structure at better than 70% accuracy. Journal of molecular biology 232, 584-599

36. Gautier, R., Douguet, D., Antonny, B., and Drin, G. (2008) HELIQUEST: a web server to screen sequences with specific

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

12

alpha-helical properties. Bioinformatics 24, 2101-2102

37. Vriend, G. (1990) WHAT IF: a molecular modeling and drug design program. J Mol Graph 8, 52-56

38. Oldefest, M., Nowinski, J., Hung, C. W., Neelsen, D., Trad, A., Tholey, A., Grötzinger, J., and Lorenzen, I. (2013) Upd3 - An ancestor of the four-helix bundle cytokines. Biochemical and biophysical research communications 436, 66-72

39. Chalaris, A., Rabe, B., Paliga, K., Lange, H., Laskay, T., Fielding, C. A., Jones, S. A., Rose-John, S., and Scheller, J. (2007) Apoptosis is a natural stimulus of IL6R shedding and contributes to the pro-inflammatory trans-signaling function of neutrophils. Blood 110, 1748-1755

40. Baran, P., Nitz, R., Grötzinger, J., Scheller, J., and Garbers, C. (2013) Minimal interleukin 6 (IL-6) receptor stalk composition for IL-6 receptor shedding and IL-6 classic signaling. The Journal of biological chemistry 288, 14756-14768

41. Garbers, C., Janner, N., Chalaris, A., Moss, M. L., Floss, D. M., Meyer, D., Koch-Nolte, F., Rose-John, S., and Scheller, J. (2011) Species Specificity of ADAM10 and ADAM17 Proteins in Interleukin-6 (IL-6) Trans-signaling and Novel Role of ADAM10 in Inducible IL-6 Receptor Shedding. The Journal of biological chemistry 286, 14804-14811

42. DeLano, D. L. (2002) The PyMOL Molecular Graphics System, DeLano Scientific, Palo Alto, CA, USA.

43. Schneider, C. A., Rasband, W. S., and Eliceiri, K. W. (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-675

44. Müllberg, J., Schooltink, H., Stoyan, T., Gunther, M., Graeve, L., Buse, G., Mackiewicz, A., Heinrich, P. C., and Rose-John, S. (1993) The soluble interleukin-6 receptor is generated by shedding. Eur J Immunol 23, 473-480

45. Roderfeld, M., Weiskirchen, R., Wagner, S., Berres, M. L., Henkel, C., Grötzinger, J., Gressner, A. M., Matern, S., and Roeb, E. (2006) Inhibition of hepatic fibrogenesis by matrix metalloproteinase-9 mutants in mice. Faseb J 20, 444-454

46. Arndt, P. G., Strahan, B., Wang, Y., Long, C., Horiuchi, K., and Walcheck, B. (2011) Leukocyte ADAM17 regulates acute pulmonary inflammation. PLoS One 6, e19938

47. Arkhipov, A., Shan, Y., Das, R., Endres, N. F., Eastwood, M. P., Wemmer, D. E., Kuriyan, J., and Shaw, D. E. (2013) Architecture and membrane interactions of the EGF receptor. Cell 152, 557-569

48. Endres, N. F., Das, R., Smith, A. W., Arkhipov, A., Kovacs, E., Huang, Y., Pelton, J. G., Shan, Y., Shaw, D. E., Wemmer, D. E., Groves, J. T., and Kuriyan, J. (2013) Conformational coupling across the plasma membrane in activation of the EGF receptor. Cell 152, 543-556

49. Bi, S., Hong, P. W., Lee, B., and Baum, L. G. (2011) Galectin-9 binding to cell surface protein disulfide isomerase regulates the redox environment to enhance T-cell migration and HIV entry. Proc Natl Acad Sci U S A 108, 10650-10655

50. Cho, J., Kennedy, D. R., Lin, L., Huang, M., Merrill-Skoloff, G., Furie, B. C., and Furie, B. (2012) Protein disulfide isomerase capture during thrombus formation in vivo depends on the presence of beta3 integrins. Blood 120, 647-655

51. Kaiser, B. K., Yim, D., Chow, I. T., Gonzalez, S., Dai, Z., Mann, H. H., Strong, R. K., Groh, V., and Spies, T. (2007) Disulphide-isomerase-enabled shedding of tumour-associated NKG2D ligands. Nature 447, 482-486

52. Söderberg, A., Hossain, A., and Rosen, A. (2013) A protein disulfide isomerase/thioredoxin-1 complex is physically attached to exofacial membrane tumor necrosis factor receptors: overexpression in chronic lymphocytic leukemia cells. Antioxid Redox Signal 18, 363-375

53. Swiatkowska, M., Szymanski, J., Padula, G., and Cierniewski, C. S. (2008) Interaction and functional association of protein disulfide isomerase with alphaVbeta3 integrin on endothelial cells. FEBS J 275, 1813-1823

54. Xiao, G., Chung, T. F., Pyun, H. Y., Fine, R. E., and Johnson, R. J. (1999) KDEL proteins are found on the surface of NG108-15 cells. Brain Res Mol Brain Res 72, 121-128

55. Kim, K., Hahm, E., Li, J., Holbrook, L. M., Sasikumar, P., Stanley, R. G., Ushio-Fukai, M., Gibbins, J. M., and Cho, J. (2013) Platelet protein disulfide isomerase is required for thrombus formation but not for hemostasis in mice. Blood 122, 1052-1061

56. Itai, T., Tanaka, M., and Nagata, S. (2001) Processing of tumor necrosis factor by the membrane-bound TNF-alpha-

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

13

converting enzyme, but not its truncated soluble form. Eur J Biochem 268, 2074-2082

57. Van Hauwermeiren, F., Vandenbroucke, R. E., and Libert, C. (2011) Treatment of TNF mediated diseases by selective inhibition of soluble TNF or TNFR1. Cytokine Growth Factor Rev 22, 311-319

58. Richards, F. M., Tape, C. J., Jodrell, D. I., and Murphy, G. (2012) Anti-tumour effects of a specific anti-ADAM17 antibody in an ovarian cancer model in vivo. PLoS One 7, e40597

Footnotes

* This study was supported by the Deutsche For-schungsgemeinschaft (SFB 877, A6, Z2 and Z3, and GA 2048/1-1 to CG) and the Excellence Cluster 306 'Inflammation at Interfaces'. 1 These authors share senior authorship. 2To whom correspondence should be addressed: Tel: 49-431-880-1686; Fax: 49-431-880-5007; E-mail: jgroetzinger@biochem.uni-kiel.de. 3Abbreviations used are: ADAM17, A Disintegrin And Metalloprotease-17; ADAM17ex/ex mEFs ,

mouse embryonic fibroblast from hypomorphic ADAM17 mice; AP, alkaline phosphatase; BSA, bovine serum albumin; CANDIS, Conserved ADAM-SeventeeN Dynamic Interaction Sequence; CD, circular dichroism; cp, control peptide; D3, domain 3; DMEM, Dulbecco’s modified Eagle’s medium; DMSO, dimethylsulfoxide; ELISA, en-zyme-linked immunosorbent assay; FCS, foetal calf serum; GPI, glycophosphatidylinositol; IL-6R, in-terleukin-6 receptor; IL-11R, interleukin-11 recep-tor; IL-1RII, interleukin-1 receptor II; MPD, mem-brane-proximal domain; noAB, nonsense antibody; pA10, peptide of ADAM10 corresponding to CANDIS; PDI, protein disulfide isomerase; PMA, phorbol-12-myristate-13-acetate; TIMP, tissue in-hibitor of metalloproteases; TM, transmembrane helix; TNF-tumour necrosis factor-; TNFRI, tumour necrosis factor-receptor I.

Acknowledgment - The authors thank Jessica Schneider and Jonas Hiesener for their excellent technical assistance and Ahmad Trad for providing the monoclonal antibody directed against the extra-cellular part of ADAM17.

Figure Legends

FIGURE 1: CANDIS: a unique and highly conserved α-helical region within ADAM17. A, Schemat-ic representation of the domain structure of ADAM17. ADAM17 starts N-terminally with its pro-domain (PD), followed by a catalytic domain (CD), a disintegrin domain (DD), a membrane-proximal domain (MPD) and CANDIS within the stalk in its extracellular region. B, Sequential alignment of CANDIS. CANDIS sequences from Homo sapiens (Human), Mus musculus (Mouse), Danio rerio (Danio), Dro-sophila melanogaster (Droso) and Daphnia pulex (Daphnia) were aligned. Red bar, predicted α-helical region; stars, identical residues; bars, similar residues (MPD: membrane-proximal domain; TM: trans-membrane region). C, CD spectra and sequences of CANDIS and control peptides. Both peptides corre-sponding to CANDIS (peptide a: black; peptide b: blue) displayed α-helical spectra. In contrast, both control peptides pA10 (red) and cp (green) showed no α-helical character. FIGURE 2: CANDIS interacts with the ADAM17 substrate IL-6R. A, Schematic drawing of a GPI-anchored membrane-proximal domain of human ADAM17 (MPD17plusCANDIS-GPI). The stalk region encompasses CANDIS as well as a PC- and a myc-tag (29). B, Sequences of peptides which were coupled to Sepharose beads. The first peptide contains CANDIS, the second contains the corresponding sequence of ADAM10 (pA10), and the third peptide contains a randomized sequence of CANDIS (control peptide, cp). C, Western blot analysis of the precipitation of the IL-6R by the peptides coupled to Sepharose beads. D, Pull-down of humane IL-1RII, murine TNF-α (Flag-tagged) and human IL-6R by CANDIS or control peptide (cp) revealed that CANDIS interacts specifically with the IL-6R and IL-1RII, but not with proTNF-α, as shown by Western blot with the stated antibodies. FIGURE 3: Identification of the CANDIS Binding site in the IL-6R. A, To identify the binding site of CANDIS in the IL-6R, chimeras of human IL-6R (white) and human IL-11R (black) were used. Chimeras I and V contained the IL-11R with the stalk region of IL-6R, and vice versa. Chimeras IX and X featured exchanges of the membrane-proximal regions encompassing the cleavage site of ADAM17 within the IL-6R. B, Western blot analysis of the pull-down experiments of IL-6R/IL-11R chimeras with CANDIS or control peptides coupled to Sepharose beads. The control peptides contained the CANDIS-homologous region of ADAM10 (pA10) or a randomized sequence of CANDIS (cp). C, Deletion variants of human IL-6R, which were used to narrow down the binding site of CANDIS within ADAM17 (40). D, Analysis of the pull-down experiments of IL-6R deletion variants by either CANDIS or the same control peptides as in B. E, Overview of the stalk region of human IL-6R. The binding region of CANDIS (red font)

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

14

is located between the end of domain 3 (D3) and amino acid residue Q332. Deletion variant IL-6R∆A333_V362 (∆30) is still able to bind to CANDIS, whereas deletion variants IL-6R∆E317_T352 (∆36) is not. ADAM17 cleaves C-terminally of Q357, the transmembrane helix (TM) starts with F367. FIGURE 4: Binding site of CANDIS in the IL-6R. A, Schematic illustration of IL-6R deletion variant IL-6R∆E317_Q332 (∆16). B, Analysis of the pull-down experiments of wild-type IL-6R and IL-6R∆E317_Q332 (∆16) by either CANDIS or control peptides, the CANDIS-homologous region of ADAM10 (pA10) and a randomized sequence of CANDIS (cp). C, Eligibility of IL-6R∆E317_Q332 (∆16) as an ADAM17 substrate. HEK293 cells were transfected with the deletion variant or wild-type IL-6R. Shedding was stimulated by addition of PMA. Control cell samples were either treated with DMSO or with PMA and the metalloprotease inhibitor marimastat (Mari). The shed IL-6R was detected by ELISA. Shedding activity is displayed in relation to the PMA-stimulated wild-type IL-6R sample as de-scribed in Experimental Procedures. Student’s t-test was performed using the online tool at http://www.physics.csbsju.edu/stats/t-test.html with data of three independent experiments in which at least triplicates were performed. The p-value below 0.005 indicates the statistical significance. D, Impact on CANDIS in IL-1RII shedding. Wild-type ADAM17 or ADAM17p10, comprising an exchange of CANDIS with the respective sequence of ADAM10 (p10) were cotransfected with AP-tagged IL-1RII into ADAM17ex/ex mEFs. One day after transfection cells were treated with PMA, ADAM17 shedding activity was detected and calculated as described in Experimental Procedures. Student’s t-test was used to proof the significance and was calculated out of four independent experiments performed with triplicates using the online tool http://www.physics.csbsju.edu/stats/t-test.html. A p-value below 0.005 was calculat-ed and considered statistically significant. FIGURE 5: HE-ADAM17: an inactive mutein of ADAM17. A, The mutein HE-ADAM17 was created by exchanging H415 with E406 in the active centre of the catalytic domain. This exchange is presented in a ribbon representation of the wild-type catalytic domain (PDB ID: 1BKC) as well as in a close-up of the Zn2+ binding motif. The exchanged residues are displayed in blue, the unchanged histidine residues (H405, H409) of the motif in green. CD, catalytic domain; DD, disintegrin domain; MPD, membrane-proximal domain. B, Flow cytometry analysis of HE-ADAM17 surface expression. The presence of wild-type (green line) or HE-ADAM17 (purple line) on ADAM17ex/ex mEFs was monitored using antibodies against the extracellular part of ADAM17 (grey: untransfected cells). C, The catalytic activity of HE-ADAM17 versus wild-type ADAM17 was analysed by co-transfection with AP-tagged IL-1RII into ADAM17ex/ex mEFs. One day later, ADAM17 shedding activity was measured and the relative AP activi-ty was calculated as described in Experimental Procedures. The significance of this experiment was cal-culated by Student’s t-test, which was performed using the online tool at http://www.physics.csbsju.edu/stats/t-test.html. The data obtained from six independent experiments with triplicates resulted in a p-value below 0.005 and were considered statistically significant. D, To ensure that the inactivity of HE-ADAM17 was not due to differences in expression levels, the lysates of the har-vested cells were analysed by Western blots, in which PC-tagged ADAM17 wild-type and HE-mutein were detected by an anti-PC antibody (HPC4). E, To test whether the overall structure of the active centre was unaltered, HE-ADAM17 and wild-type ADAM17 were co-expressed with TIMP3 in HEK293 cells. After cell lysis, ADAM17 variants were precipitated via their PC-tags and co-precipitated TIMP3 was detected by Western blotting. noAB, non-relevant antibody.

FIGURE 6: PDI conversion of ADAM17 abrogates access of CANDIS to IL-6R. A, Western blot analysis of IL-6R pulled down by HE-ADAM17 or MPD17plusCANDIS-GPI. HE-ADAM17 or MPD17plusCANDIS-GPI were expressed in HEK293 cells, bound to Sepharose beads and either treated with PDI or left untreated (PBS). These samples were used to pull down the IL-6R from lysates of IL-6R-overexpressing HEK293 cells. The samples were analyzed by Western blot, which clearly showed that PDI-treated HE-ADAM17 and MPD17plusCANDIS-GPI lost their ability to bind IL-6R. B, For quantifi-cation, the band densities of the IL-6R and ADAM17 constructs from panel A as a representative example were measured with the software ImageJ (43) and expressed as their ratio (see Experimental Procedures). These ratios showed that binding of both HE-ADAM17 and MPD17plusCANDIS-GPI to the IL-6R de-creased at least five fold after treatment with PDI and was considered as statistically significant. As the p-value of three independent experiments displayed a p-value below 0.005, which was calculated by Stu-dents T-test using the online tool at http://www.physics.csbsju.edu/stats/t-test.html. C, Overexpression of PDIA6 suppresses shedding of IL-1RII as well as TNF-α. Extracellular AP-tagged substrates were

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

15

cotransfected into HEK293 cells either with empty pcDNA3.1 or PDIA6 expression vector. Next day transfected cells were either left untreated, stimulated by 100 nM PMA or stimulated by 100 nM PMA in the presence of 10 µM metalloprotease inhibitor marimastat (Ma). Two hours later supernatant and cells were harvested and shedding activity regarding IL-1RII and TNF-α and significance of experience were calculated as described in Experimental Procedures. P-values of both PMA stimulated samples were with 0.007 (IL-1RII) and 0.006 (TNF-α) below 0.05 they were considered as statistically significant.

Figures:FIGURE 1:

FIGURE 2:

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

16

FIGURE 3:

FIGURE 4:

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

17

FIGURE 5:

FIGURE 6:

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from

and Joachim GrötzingerLorenzenAthena Chalaris, Christoph Garbers, Jürgen Scheller, Stefan Rose-John, Inken

Stefan Düsterhöft, Katharina Höbel, Mirja Oldefest, Juliane Lokau, Georg H. Waetzig,- the sweet tooth for the human interleukin-6 receptor

"A Disintegrin And Metalloprotease-17 Dynamic interaction sequence" (CANDIS)

published online April 30, 2014J. Biol. Chem. 

  10.1074/jbc.M114.557322Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on February 16, 2018http://w

ww

.jbc.org/D

ownloaded from