A CUB-Serine Protease in the Olfactory Organ of the … CUB-Serine Protease in the Olfactory Organ...

A CUB-Serine Protease in the Olfactory Organ ofthe Spiny Lobster Panulirus argus

Min Z. Levine,* Paul J. H. Harrison, W. William Walthall, Phang C. Tai,Charles D. Derby

Department of Biology and Center for Behavioral Neuroscience, Georgia State University,Atlanta, Georgia 30303

Received 13 June 2001; accepted 1 August 2001

ABSTRACT: csp, a gene encoding a protein withhigh sequence identity to trypsinlike serine protease andCUB domains, was identified from a cDNA library fromthe olfactory organ (antennular lateral flagellum) of thespiny lobster Panulirus argus. The full-length cDNAsequence of csp is 1801 bp, encoding a protein of 50.25kD, with three domains: signal peptide, trypsinlikeserine protease, and CUB (named for a class of com-pounds including Complement subcomponents Clr/Cls,Uegf, and Bone morphogenic protein-1). RT-PCR,Northern blots, and immunoblots showed that csp ispredominantly expressed in the lateral flagellum andeyestalk. Immunocytochemistry showed that Csp ispresent in olfactory (aesthetasc) sensilla around auxil-iary cells (glia that surround the inner dendrites of

olfactory receptor neurons, ORNs) and ORN outer den-drites. We propose that Csp is expressed and secreted byauxiliary cells, associates with ORN cell membranes orextracellular matrix via the CUB domain, and hastrypsinlike activity. In the eyestalk, Csp is associatedwith cells surrounding axons between neuropils of theeyestalk ganglia. Possible functions in the olfactory or-gan and eyestalk are discussed. To our knowledge, this isthe first report from any olfactory system of a geneencoding a protein with serine protease and CUBdomains. © 2001 John Wiley & Sons, Inc. J Neurobiol 49: 277–302,

2001

Keywords: glia; auxiliary cells; olfaction; vision; devel-opment; perireception; trypsin

INTRODUCTION

Proteases play crucial roles in numerous biologicalprocesses in nervous systems, including neurogenesis,cell migration, neurite outgrowth, and synapse elimi-

nation (Gschwend et al., 1997). Four classes of pro-teases have been identified owing to their character-istic active site residues; these are serine proteases,cysteine proteases, aspartate proteases, and metallo-proteases (Bond and Beynon, 1995).

Serine proteases have been shown to be involvedin many important processes. For example, they reg-ulate the development of vertebrate nervous systems,including migration, process extension, differentia-tion, signaling, and survival of neurons and glia (Mo-nard, 1988; Saksela and Rifkin, 1988; Seeds et al.,1990; Basbaum and Werb, 1996; Thewke and Seeds,1996; Lemosy et al., 1999; Yamada et al., 2000).Their functions depend on their ability to modifyextracellular matrix proteins, to degrade polypeptideprecursor proteins and thus generate active peptides,growth factors, and hormones, and to bind to cell

* Present address: DPD Division, Centers for Disease Controland Prevention, 4770 Buford Hwy., MS F-13, Atlanta, GA 30341.

Correspondence to: C. Derby ([email protected]).Contract grant sponsor: National Institute on Deafness and

Other Communication Disorders; contract grant number: DC00312.Contract grant sponsor: National Science Foundation; contract

grant number: IBN-0077474.Contract grant sponsor: National Institutes for Health; contract

grant number: GM34766 (P.C.T.).Contract grant sponsor: Georgia Research Alliance.Contract grant sponsor: Georgia State University Research Pro-

gram Enhancement Fund.© 2001 John Wiley & Sons, Inc.DOI 10.1002/neu.10010

277

surface receptors to activate intracellular signalingcascades (Scarisbrick et al., 2001). Serine proteasesand their inhibitors have been identified and functionin several sensory systems. In mammalian olfactorysystems, serine proteases, such as the kexin familyprotease PACE4 (Akamatsu et al., 1997) and plasmin-ogen activators (Thewke and Seeds, 1996), and serineprotease inhibitors, such as glia-derived nexin (Rein-hard et al., 1988, 1994; Scotti et al., 1994), mayregulate neurogenesis and axogenesis of olfactory re-ceptor neurons. A serine protease inhibitor influencesgrowth of gustatory neuronal axons and gustatorybehavior of Drosophila (Murugasu-Oei et al., 1996).In the mammalian eye, serine proteases play multipleroles in development processes (Masos et al., 2000),such as acting as an avoidance cue in axonal guidanceduring development (Baird and Rapier, 1995). Incrustaceans, serine proteases and their inhibitors havebeen shown to function in digestion (Vanwormhoudtet al., 1995; Klein et al., 1996; Roy et al., 1996;Hernandez-Cortes et al., 1997) and in immunity(Soderhall and Cerenius, 1998; Kanost, 1999). How-ever, the role of serine proteases in crustacean ner-vous systems is virtually unexplored. Crustaceanserine proteases may play a role in chemoreception byfunctioning in perireception. In chemosensory perire-ception, chemical stimuli are processed by enzymesand transporters located in or around the chemorecep-tor neurons’ dendritic membrane, consequently influ-encing which chemical molecules are active (Getchellet al., 1984; Carr et al., 1990a,b). Serine proteaseshave been suggested to function in crustacean chemo-sensory perireception, based on behavioral studiesthat show that these serine proteases are present inchemosensory organs, cleave arginine and lysine res-idues from inactive precursors, and thereby generateactive chemical cues (Rittschof, 1990, 1993). How-ever, there has been no cellular or molecular identi-fication or characterization of these serine proteases incrustacean chemosensory organs as there has been forthe ectoenzyme ectonucleotidase/phosphatase, whichfunctions in perireception in the aesthetascs of spinylobsters (Trapido-Rosenthal et al., 1989; Carr et al.,1990a,b; Gleeson et al., 1991, 1992).

A subset of biologically important serine proteasescontains CUB domains. The CUB domain is an ex-tracellular domain of about 110 amino acids, and isnamed after three proteins from which it was origi-nally identified: Complement subcomponents Clr/Cls,Uegf, and Bone morphogenic protein-1 (Leytus et al.,1986; Tosi et al., 1987; Delgadillo-Reynoso et al.,1989; Bork and Beckmann, 1993). Proteins contain-ing CUB domains have diverse functions, but they areoften involved in development (Bork and Beckmann,

1993; Hishida et al., 1996). The CUB domain ischaracterized by four conserved cysteines that formtwo disulfide bonds. CUB domains are typically cou-pled to other domains, in most cases protease do-mains, including serine proteases. Many CUB do-main-containing proteins have multiple CUB domainsand multiple protease domains. They can function inthe differentiation of cell fates, activation of growthfactors, degradation of polypeptides, and processingof extracellular proteins in mature and developingsystems (Bork and Beckmann, 1993; Bond and Bey-non, 1995; Lindsay et al., 1999a,b; Yamada et al.,2000). CUB domain proteins are mostly secreted ex-tracellularly. They contain noncatalytic interactiondomains that may be involved in protein-protein andprotein-substrate interactions (Bond and Beynon,1995), which serve in guidance and binding. TheCUB domain-containing proteins can bind to otherproteins through the interaction of the CUB domainwith either the extracellular matrix, such as mamma-lian hyaluronate-binding protein TSG-6 (or PS4)(Wisniewski et al., 1994), or lipids and carbohydrateson the membrane surface, such as the vitamin B12receptor cubulin, spermadhesins, and oviductin(Moestrup et al., 1998; Topfer-Petersen et al., 1998;Lindsay et al., 1999a). CUB domain-containing pro-teins have been identified in the mouse vomeronasalorgan (Matsushita et al., 2000). There is no directevidence for the existence of CUB domain-containingproteins in visual systems, but there is one reportshowing functional expression of a mouse CUB do-main-containing protein, neuropilin, in chick retinalganglion, which regulated retinal development (Bairdand Rapier, 1995; Takagi et al., 1995).

In our study, we have investigated the role ofserine proteases in the olfactory system. We chose theCaribbean spiny lobster Panulirus argus, because ithas proven to be an effective model in the study ofmolecular and cellular aspects of postembryonic pro-liferation and development of olfactory receptor neu-rons (Steullet et al., 2000a; Harrison et al., 2001a,b;Derby et al., 2001; Stoss et al., 2001), perireception(Trapido-Rosenthal et al., 1993; Linser et al., 1997),and olfactory transduction (Xu and McClintock,1999; Xu et al., 1999; Munger et al., 2000). Wedescribe the cloning of a CUB-serine protease gene(csp) in the olfactory organ of P. argus, compare thesequence identity of csp to those for serine proteasesin other animals, show, using immunocytochemistry,that the spiny lobster Csp protein is located in glialcells (called auxiliary cells) surrounding the dendritesof olfactory receptor neurons, and speculate on itspossible roles.

278 Levine et al.

METHODS

Animals

Caribbean spiny lobsters P. argus were collected in theFlorida Keys. They were shipped to Atlanta where theywere held in aquaria containing recirculating, filtered, andaerated Instant Ocean (Aquarium Systems, Mentor, OH) at20–25°C, and fed shrimp and squid. Molt stage of theanimals was determined by evaluating epidermal retractionas described by Lyle and MacDonald (1983). Molt stageswere identified as postmolt (stage A, B), intermolt (stage C),and premolt (stage D).

Construction and Screening of anOlfactory cDNA Library

The peripheral olfactory organ of the spiny lobster is thelateral flagellum of the first pair of antennae, or antennule.Of the many chemosensilla on the antennular flagella, theaesthetasc sensilla are a prominent type (Grunert and Ache,1988; Steullet et al., 2000b; Cate and Derby, 2001) (Fig. 1).In P. argus, each aesthetasc sensillum is innervated byabout 300 olfactory receptor neurons (ORNs; Grunert andAche, 1988; Steullet et al., 2000b), wherein both perirecep-tion (Carr et al., 1990a,b; Trapido-Rosenthal et al., 1989;Gleeson et al., 1991, 1992; Derby et al., 1997) and olfactorytransduction (Blaustein et al., 1993; Hatt and Ache, 1994;Xu and McClintock, 1999; Xu et al., 1999; Munger et al.,2000) occur.

A cDNA library was constructed from the antennularlateral flagella taken from live lobsters. The lateral flagellawere removed from the animals, placed in a liquid nitrogenbath, and then stored at �80°C until used. This tissue washomogenized first by mortar and pestle, and then by aPolytron homogenizer. Total RNA was extracted by guani-dine isothiocyanate and phenol-chloroform extraction(RNA isolation kit; Stratagene). Poly A RNA was isolatedby an oligo dT cellulose column (polyA Quik mRNA Iso-lation Kit; Stratagene). cDNA was synthesized with therandom priming method using Superscript reverse transcrip-tase (Life Technology), then EcoR I adapters were ligated toboth ends of the double stranded cDNA by T7 ligase. Theresulting cDNA pool was then size-fractioned through col-umn chromatography, and cDNA greater than 500 bp inlength was collected for the subsequent library construction(Superscript Choice System for cDNA Synthesis; LifeTechnology). The collected cDNA was ligated to the EcoRI sites of the Lamda ZAP II EcoR I predigested vector(Stratagene), and the ligation mixture was packaged withGigapack III Gold packing extract (Stratagene) using an invitro � packing system. The primary library was amplified,to a titer of 3 � 108 pfu.

Screening of the cDNA library was performed usingprobes labeled by nonradioactive digoxigenin-11-dUTP(Boehringer-Mannheim), using the random prime method.The ExAssist interference-resistant helper phage was usedin the in vivo excision of the pBluescript SK(�) phagemid

(Stratagene), and then inserts in the excised phagmid weresequenced according the manufacturer’s protocol (Strata-gene). The sequences were then analyzed using BLAST,MacVector, and SMART software.

RNA Extraction

Eleven different tissues (see Fig. 3) were harvested fromlive spiny lobsters of undetermined molt stages. The har-vested tissue was placed in a liquid nitrogen bath and thenstored at �80°C until used. Total RNA was extracted usingTRI-regent (Molecular Research Center) following themanufacturer’s protocol. Poly A RNA was further isolatedusing oligo dT cellulose columns (Molecular Research Cen-ter).

5� and 3� RACE

5� and 3� RACE was performed to generate the full-lengthclone of the spiny lobster olfactory CUB-serine proteasegene, csp. One hundred nanograms of poly A RNA fromantennular lateral flagella was used in reverse transcriptionwith Moloney Murine Leukemia Virus (MMLV) reversetranscriptase to prepare the 5� and 3� RACE ready cDNA.Reactions were performed according to the manufacturer’sprotocol (SMART RACE cDNA Amplification; Clonetech).SMART primers and gene specific primers from the clonedcsp fragment were used. The primer 5�CCTCCGTGGT-CAGCGACACACACA3� was used for the 5� RACE reac-tion, and 5�CCAGGAGTGTATGCCAGGGTCACCG3�was used in the 3� RACE reaction. RACE PCR conditionswere: 94°C for 5 s, 68°C for 10 s, and 72°C for 3 min, fora total of 20 cycles. Nested PCR was performed to confirmthe specificity of the first RACE products. The sequences ofthe two nested primers were 5�AGAGTGTGGCGGCT-GAGAGGAAC3� for 5� RACE and 5�TTCTGACCAGC-GAACATCGGCAAC3� for 3� RACE. First-round RACEproducts were used as DNA templates for the nested RACEreactions. PCR conditions were the same as those for thefirst-round RACE. Products were analyzed on a 1% agarosegel. PCR products consistent in both RACE reactions werepurified, subcloned into pGEM-T vector (Promega), andsequenced.

Northern Blots

Two probes from the csp sequence were amplified usingPCR and were then used in Northern blots. These wereprobe 1 (bp 28 to 766) and probe 2 (bp 28 to 1480). As apositive control, we used glyceraldehyde-3-phosphate de-hydrogenase (GAPDH) DNA PCR product of 750 kb am-plified by degenerate primers [5� end � 5�GTIGTIGCIG-TIAA(C/T)GA(C/T)CCITT(C/T)AT3� and 3� end primer� 5�GCTATAICC(A/G)AA(C/T)TC(A/G)TT(A/G)TC(A/G)TACAA3�]. These probes were labeled with �-32P-dCTPby random priming DNA labeling beads (Pharmacia Bio-

Olfactory CUB-Serine Protease 279

Figure 1

280 Levine et al.

tech) and cleaned through G-50 Micro columns (PharmaciaBiotech) following the manufacturer’s protocol.

To examine csp RNA expression patterns in the tissues,Northern blots were prepared using standard methods.Briefly, about 20 �g of total RNA or 1 �g mRNA from eachtissue was size-fractionated using 1% formaldehyde agarosegels. RNA was transferred onto nylon membrane (Gene-screen). Membrane was prehybridized at 42°C for 3 h informamide hybridization buffer [5 times SSC (0.75 M NaCl,0.075 M sodium citrate � 2H2O), 5 times Denhardt solution,50% formamide, 1% SDS, 100 �g/mL yeast tRNA]. Hy-bridization was performed overnight under the same condi-tions using 32P-dCTP-labeled probes from the csp clone,followed by washes under highly stringent conditions: 2times SSC 0.1% SDS at room temperature, 5 min twice; 0.2times SSC 0.1% SDS at room temperature, 5 min twice; andthen 0.1 times SSC 0.1% SDS, 65°C, 15 min twice; and 2times SSC at room temperature for 5 min. Signal was thendetected by autoradiography. The blots hybridized with cspwere then stripped and reprobed with the constitutivelyexpressed GAPDH gene as a positive control.

RT-PCR

RT-PCR was used to examine csp RNA expression patterns.Approximately 40 ng total RNA from each tissue wastreated with DNase I (Life Technology), then first strandcDNA was synthesized using reverse transcriptase (Super-script II; Life Technology). The mixture was then treatedwith RNase H and used as a template for the subsequentamplification by PCR with the csp 5� primer 5�ACAGAAC-CCTTCACCCTTGC3� (nt 28 to 47) and the csp 3� primer5�TGTGGCACGGTTGACATTTCC3� (nt 746 to 766).GAPDH and 18S RNA were used as positive controls. Fortheir amplification, the following primers were used: 5�GT-GGTTGCCGTGAATGACCCCTTCAT3� (5� end primer)and 5�GCTATAGCCGAACTCGTTGTCGTACAA3� (3�end primer) for GAPDH; 5�TCAAGAACGAAAGTTA-GAGG3� (5� end primer) and 5�GTGCCCTTCCGTCAAT-TCCT3� (3� end primer) for 18S RNA. PCR conditions

were 94°C for 3 min for one cycle, 94°C for 1 min, 55°C for30 s, 68°C for 90 s for 20 cycles, and 68°C for 7 min for onecycle.

Over-Expression of the CUB-SerineProtease Protein

The CUB domain of the Csp protein was produced byover-expression in a bacterial cell culture. A 680 bp cDNAfragment (nt 86–766) of Csp was subcloned into the EcoRI and Hind III restriction sites of the pTricHis2A histidine-tag vector (Invitrogen). The inserted sequence was clonedin-frame with the predicted translational initiation site ofcsp. The recombinant DNA construct was confirmed byDNA sequencing. For over-expression, the recombinantstrain of Escherichia coli DH5� containing the pTricHis2A-CUB plasmid was grown in TA medium [1% tryptone,0.5% NaCl, 20 mM K2HPO4, 11 mM KH2PO4, 3.7 mM(NH4)2SO4, and 0.8 mM sodium citrate � 2H2O] supple-mented with 0.5% glucose, 50 mg/L ampicillin, and 2.5�g/mL thiamine. At OD600 of 0.5, cells were induced with1 mM IPTG and 0.2% yeast extract for 4 h, then harvested,and the over-expressed protein was analyzed by SDS-PAGEon a 12% gel. Over-expressed CUB protein was purified bynickel metal Probond resin (Invitrogen) following the man-ufacturer’s protocol, and concentrated by a Millipore ultra-free-4 centrifugal filter unit with 5 kD molecular mass limit.Purified CUB protein was sequenced N-terminally to verifythe over-expression.

Production of Antibodies to CUB-SerineProtease

Polyclonal antibodies against the Csp protein were gener-ated from peptides synthesized from the predicted aminoacid sequence of Csp and from over-expressed Csp. Fourpeptides were synthesized (Research Genetics, Rockland,AL): two from the CUB domain region [Csp1: H- CKYT-NLQEDNSFKLPEEFVAR-amide (Mw 2529.2 daltons); Csp2:

Figure 1 Lobster olfactory CUB-serine protease. (A) cDNA of csp with predicted amino acidsequence. Asterisk indicates the first stop codon. Underlined region indicates the signal peptidesequence. Numbers to the left of the sequence correspond to nucleotides (upper) and amino acids(lower). The first boxed area indicates the CUB domain, and the second boxed area indicates theserine protease domain. Possible protein kinase C phosphorylation sites (�), casein kinase IIphosphorylation sites (●), N-glycosylation sites (�), and N-myristolation sites (#) are indicated. Thesequence was submitted to Gene Bank with accession number AF357226. (B) Schematic diagramof the CUB-serine protease. The predicted amino acid sequence was determined by BLAST (NIH)and SMART (EMBL) programs. The sequence includes a signal peptide domain (amino acids 1through 21), a CUB domain (amino acids 77 to 193), and a trypsinlike serine protease domain(amino acids 228 to 454). (C) Hydrophobicity plot of the deduced amino acid sequence of the Cspprotein, based on the Kyte-Doolittle algorithm. Hydrophobic segments are characterized by negativehydrophilicity values. Hydrophilicity values � �2 are considered significantly hydrophobic. Lo-cations of the three domains of Csp are indicated on this graph. In (A), (B), and (C), amino acidsare numbered from the first methionine.


H-CGSSVTFQSTNYPSSYPNREN-amide (Mw 2336.0 dal-tons)] and two peptides from the serine protease region [Csp3:H-CDGGNIGYVLVGDHNFASTDD-amide (Mw 2166.9 dal-tons); Csp4: H-CISHPDYDSSTVDNDMA-amide (Mw

1867.7 daltons)]. Three peptide mixtures were used as antigensto generate antibodies [Fig. 5(B)]: one was a mixture of the twopeptides from the CUB domain region (Csp1, 2), one was amixture of the two peptides from the serine protease region(Csp3, 4), and one was a mixture of all four peptides (Csp1–4).Over-expressed CUB domain protein was used in combinationwith the two CUB domain peptides as antigens.

Protein Extraction and Immunoblots

Proteins from different tissues were extracted and used inimmunoblots. Tissue was homogenized and total proteinwas collected by phenol extraction using TRI-reagent (Mo-lecular Research Center) from liquid nitrogen quick-frozenlobster tissues and then solubilized in 1% SDS. For immu-noblots, equal amounts of protein from different tissueswere separated on a 10% SDS-PAGE gel (Laemmli, 1970)and then transferred onto PVDF membranes (Problott; ABI)in Tris-glycine transfer buffer (25 mM Tris, 192 mM gly-cine, 20% methanol, pH 8.3). Membranes were washed inTBS (20 mM Tris-HCl, 175 mM NaCl, pH 7.5) for 5 min,then incubated in blocking solution (5% nonfat dry milk,0.02% NaN3 in TBS) overnight. The blots were washedwith TTBS (20 mM Tris-HCl, 175 mM NaCl, pH 7.5, 0.05%Tween-20 sorbitol) for 10 min, then incubated with Cspantibody #99-6 (see Results section for description of thisantibody) at 1:1000 dilution in antibody dilution buffer (1%nonfat milk, 0.02% NaN3 in TTBS) for 1 h and washedthree times with TTBS for 10 min each. Goat antirabbitalkaline phosphatase conjugated IgG secondary antibodywas applied for 1 h in antibody dilution solution, thenwashed three times with TTBS for 10 min each, and withTBS for 5 min. For colorimetric detection, substrate NBT(nitro blue tetrazolium 50 mg/mL in 70% N�N�-dimethil-foramide) and BCIP (5-bromo-4-chloro-3-indolyl phos-phate, 25 mg/mL in 100% N�N�-dimethilforamide) wereadded afterwards in alkaline phosphatase buffer (25 mMTris-HCl, 100 mM NaCl, 50 mM MgCl2, pH 9.8). Forchemiluminescent detection, immunostar substrate andbuffer (Bio-Rad) were added at a 1:10 ratio. The membraneswere sealed in a bag and exposed to X-ray film. Preimmuneserum was also used in parallel experiments as negativecontrols.

Immunocytochemistry

Immunocytochemistry was used to characterize the cellularlocation of Csp protein in the lateral flagellum and eyestalkof spiny lobsters. Two different embedding media wereused. LR Gold resin (Pelco, Redding, CA) was used forpostmolt, intermolt, and premolt lobsters. Paraffin wax wasused for postmolt lobsters (less than 1 day after molting),because only in this stage was the cuticle of the lateralflagellum soft enough to be sectioned in wax.

For immunocytochemistry, lateral flagella were cut intosmall pieces and fixed overnight in 4% paraformaldehyde inPBS (0.2 M phosphate buffer, pH 7.4). Pieces of fixedflagella were washed with PBS and dehydrated in a gradedseries of ethanol (30%, 50%, 70%, 90%, 100%, 100% dry,and 100% dry).

For LR Gold embedding, dehydrated tissue was infil-trated in LR Gold, and LR Gold was cured with an accel-erator (0.5% benzoin methyl ether) under UV light at 4°Cfor 72 h. Transverse sections were taken from different partsof the aesthetasc-bearing region using an ultramicrotomeand diamond knife. Sets of 1 �m thick serial sections weretaken at increments of 10 �m. Sections were placed in wellsof Teflon-coated spot slides, dried, rinsed with PBS, andincubated with blocking solution (5% normal goat serum,0.1% bovine serum albumin, 0.02% NaN3, 0.3% TritonX-100 in PBS) for 1 h. Sections were then incubated witheither the primary antibody #99-6 or preimmune serum(negative control) in blocking solution at 1:100 dilution forat least 2 h, rinsed with PBS three times for 30 min, and thenincubated with Texas Red-conjugated goat antirabbit IgGsecondary antibody (Molecular Probes) for 1 h. Finally,sections were rinsed in PBS and viewed using a compoundmicroscope (Zeiss Axioskop) or confocal microscope (ZeissAxioplan, using LSM510 software). Some sections wereincubated in 5 �M DAPI to stain nuclei and in 1 �g/mLfluorescein for background histological staining.

For paraffin wax embedding, dehydrated tissue was in-filtrated in wax (xylene:wax—50:50, 25:75, 12.5:87.5,0:100, 0:100), set in blocks, and sectioned longitudinally at10 �m on a histomicrotome. Wax ribbons were aligned onslides (Superfrost�/Plus; Fisher Scientific) and air driedovernight. Sections were then dewaxed in xylene (3 times 5min) and rehydrated with a serial dilution of ethanol (100%dry, 100%, 90%, 70%, 50%, 30%, 5 min each) and PBS,and processed for immunocytochemistry with the sameblocking solution, primary antibody, and secondary anti-body as described above except for differences in incuba-tion times. Wax-sectioned tissue was incubated with block-ing solution for 30 min, primary antibody for 4 h, andsecondary antibody for 2 h. Sections were then rinsed withPBS and viewed using the confocal microscopy. For per-manent mounting, sections were dehydrated through alco-hol series (30%, 50%, 70%, 90%, 100%, 100% dry, and100% dry), cleared in xylene, and mounted in Cytoseal 60(Stephens Scientific, Kalamazoo, MI).

RESULTS

cDNA Clone from Spiny LobsterOlfactory Organ Encodes a CUB-SerineProtease

During a low stringency screen of a cDNA libraryfrom antennular lateral flagella of spiny lobsters forolfactory receptors, we found a clone with three do-

282 Levine et al.

mains: a signal peptide domain, a CUB domain, and aserine-protease domain (Fig. 1).

This clone has two methionines near the N termi-nal, at cDNA bp 86 and 98. Although either mightserve as an ATG start codon, we believe that the firstmethionine is the start codon. The sequence contentaround both of these start codons reveals a purine (A)at the �3 position, which is the most important fea-ture of the flanking sequence of AUG in arresting the43S preinitiation complex and initiating translation.The flanking sequence of the first ATG (cDNA bp 86to 88) from position �6 to �4 is GCCATCATGA(with ATG as position �1 to �3), and the flankingregion of the second ATG (cDNA bp 98–100) isACCAACATGT. Both are very similar to the consen-sus translational initiation sites in vertebrates GCCA(/G)CCATGG and crustaceans ACCAACATGA(/G)(Mankad et al., 1998) Both ATG start codons encodethe same open reading frame. However, in eukaryoticsystems, the ribosome subunit 43S stops at the firstAUG that it encounters to initiate translation. In ad-dition, signal peptides are normally 20 amino acidslong. Therefore, it is most likely that the first methi-onine is the translational initiation site, and the signalpeptide is 21 amino acids long, as opposed to a 17amino acid signal peptide if the second methioninewere used as the translational initiation site.

Using the first methionine (ATG) as the transla-tional initiation site, the open reading frame of thisclone is 1401 bp, which translates into 467 aminoacids before the first stop codon (TGA). 5� RACEshowed that there are 86 nucleotides before the firstmethionine (designated as cDNA1 to 86), which rep-resents the 5� end untranslated region.

3� RACE of the csp clone identified 311 nucleo-tides (cDNA bp 1490 to 1801) after the first stopcodon TGA (cDNA bp 1487 to 1489). It has a con-sensus polyadenylation signal at the end, which indi-cates that it is the complete 3� end untranslated region.

Therefore, the complete cDNA sequence of thisCUB-serine protease (csp) is 1801 bp [Fig. 1(A)]. Theopen reading frame with the initiation codon ATG atcDNA bp 86 to 88 is 1401 bp long, encoding 467amino acids [Fig. 1(A)], with a predicted molecularmass of 50.251 kD and an isoelectric focusing pointof 4.47. The cDNA sequence of csp was submitted toGene Bank with accession number AF357226.

Several computer analyses showed that its pre-dicted amino acid sequence of csp has three domains:a signal peptide, a CUB domain, and a trypsinlikeserine protease domain [Fig. 1(B)].

Signal Peptide. A Kyte-Doolittle hydrophobicity plotof the deduced amino acid sequence (MacVector soft-

ware) showed a hydrophobic segment at the aminoterminus [Fig. 1(C)]. This deduced segment is com-posed of 21 amino acid residues that are coded by thenucleotide sequence 86 to 148. Analysis usingSMART software (EMBL) suggests it is a signalpeptide. Expression of this clone in bacteria followedby amino acid sequencing confirms this peptide se-quence (see below). There are no other obvious hy-drophobic regions in the protein.

CUB Domain. The CUB domain of csp was alignedwith the CUB domain proteins from other speciesusing the CLUSTAL algorithm (MacVector), and thisanalysis showed that the domain has four conservedcysteines at positions 77, 106, 133, and 155 [Fig.2(A)]. These positions are similar to other CUB do-main proteins, which is a major conserved feature ofthe CUB domain. The CUB domain of csp shares35% sequence identity with dog cubulin CUB do-main, 29% sequence identity with mouse neuropilinCUB domain, 29% sequence identity with humanbone morphogenic protein CUB domain, 28% se-quence identity with zebrafish tolloid protein CUBdomain, and 27% sequence identity with Drosophilatolkin CUB domain.

Serine Protease Domain. Comparison of the cDNAand the amino acid sequences of csp as deduced fromGene Bank by BLAST and SMART (EMBL) re-vealed a trypsinlike serine protease domain at thecarboxyl terminus. This domain showed high se-quence identity with other serine proteases(CLUSTAL alignment, MacVector) [Fig. 2(B)]. Inthe protease domain, Csp shares 42% sequence iden-tity to centipede plasminogen activator, 40% se-quence identity to mouse neurotrypsin, 40% identityto mosquito Anopheles gambiae serine protease, and37% identity to mosquito Anopheles stephensi tryp-sin. It contains histidine, aspartic acid, and serine atthe deduced amino acid sites 270, 318, and 411 re-spectively; by sequence identity, these form a highlyconserved catalytic triad for the serine protease do-main. The sequence around these three amino acidsalso exhibits the highest overall sequence identity inthe protease domain. The Csp protein has an asparticacid at position 405 and glycine at position 432. Thesetwo amino acids are also present at correspondingpositions in all trypsinlike serine proteases, indicatingthat it has trypsin substrate specificity.

Other Features of the CUB-Serine Protease. Anal-ysis of the open reading frame by the PROSITEprogram (EMBL) indicated several features of theCsp protein. These include the following: one putative


N-glycosylation site (asparagine at position 59); fiveputative protein kinase C phosphorylation sites (serineat positions 23, 34, and 152, and threonine at positions177 and 295); eight casein kinase II phosphorylation

sites (serine at positions 61, 289, 306, 313, and 421,and threonine at positions 193, 201, and 369); nineputative N-myristoylation sites (glycine at positions78, 86, 130, 231, 257, 274, 349, 363, and 462). Amino

Figure 2

284 Levine et al.

acids are numbered beginning with the first methio-nine [Fig. 1(A)].

CUB-Serine Protease RNA Is HighlyExpressed Only in Antennular LateralFlagellum and Eyestalk

As a first step to identify possible biological functionsof csp, its RNA expression pattern in a variety oflobster tissues was analyzed by Northern blot andRT-PCR.

mRNA from antennular lateral flagella was exam-ined in Northern blots using two different sizes ofprobes: one from only the CUB domain (nt 86–766),and one covering both the CUB and serine proteasedomains (nt 86–1480). In both cases, only one pre-dominant transcript was detected, which had 1.8 kbp[Fig. 3(B)]. This suggests that the csp message is notalternatively spliced. Therefore, only one of theprobes (nt 86 to 1480) was used in subsequent North-ern blots.

Total RNA from antennular lateral flagellum, an-tennular medial flagellum, second antenna, pereiopod(leg, minus dactyl), dactyl tip, eyestalk, brain, abdom-inal muscle, hepatopancreas, intestine, and carapacewas used in Northern blots. A predominant transcriptwith a size of approximately 1.8 kbp was detectedonly in antennular lateral flagellum and eyestalk.Trace expression was occasionally observed in secondantenna and dactyl tip, but when observed, it was atvery low levels. There was no expression of csp inany of the other tissues tested. GAPDH, the positivecontrol, was detected in all 11 tissues, with highestexpression levels in abdominal muscle [Fig. 3(C)].

RT-PCR using the primers from the CUB domain(see Methods) further substantiated that csp is heavilyexpressed in lateral flagellum and eyestalk (Fig. 4). Insome RT-PCR experiments, a trace of csp expressionwas seen in dactyl tip and second antenna. Theseresults are in agreement with those from the Northernblots. 18S RNA, which was used as a positive controlin the RT-PCR, showed that approximately the sameamount of RNA was used in all tissues. The otherpositive control, GAPDH, was expressed in all tis-sues, with highest levels in abdominal muscle. Takentogether, these results indicate that csp RNA is ex-pressed predominantly in two sensory organs: theantennular lateral flagellum and eyestalk.

CUB-Serine Protease Protein Is OnlyPresent in Lateral Flagellum andEyestalk

Antibodies were generated from several different re-gions of the Csp protein and were used to determineits location in lobster tissue [Fig. 5(B)]. Four peptideswere used as antigens. These were Csp-1 and Csp-2from the CUB domain, and Csp-3 and Csp-4 from theserine protease domain. The protein fragment fromamino acid 1–228 (numbered from the first methio-nine) was over-expressed in a histidine-tag vector andwas purified using a nickel column. It yielded a 25.04kD protein [Fig. 5(A)]. The N-terminal sequencedwas VSLKVTNL, which matches exactly a fragmentof the predicted amino acid sequence of Csp thatimmediately follows the predicted N-terminal signalsequence. This also provides evidence that Csp has asignal peptide at its N-terminal end.

Figure 2 CLUSTAL alignment of the CUB and protease domains of the spiny lobster to CUBdomains and protease domains of other species. (A) The CUB domain from lobster olfactory Csp(amino acids 77 to 186). Related CUB domains shown here include: human bone morphogenicprotein, amino acid sequence 45 to 150 (accession number AAC41710); zebrafish tolloid protein,amino acid sequence 783 to 888 (accession number AAC60304); dog cubulin protein, amino acidsequence 1388 to 1497 (accession number AAF14258); mouse neuropilin, amino acid sequence 23to 135 (accession number NP032763); and Drosophila tolkin, amino acid sequence 1271 to 1385(accession number S58984). The major conserved feature of the CUB domain is four cysteines thatform two disulfide bonds, labeled by *. (B) The serine protease domain from lobster olfactory Csp(amino acids 228 to 455). Related serine protease sequences include: mosquito Anopheles stephensitrypsin, amino acid sequence 43 to 269 (accession number AAB66878); mouse neurotrypsin, aminoacid sequence 511 to 756 (accession number Y13192); mosquito Anopheles gambiae serineprotease, amino acid sequence 4 to 235 (accession number CAA89967); and centipede plasminogenactivator, amino acid sequence 28 to 263 (accession number AAD00320). Trypsin substratespecificity is determined by amino acids D and G (labeled as #). The catalytic triad of trypsinlikeserine protease is amino acids H, D, and S (labeled as *). In both (A) and (B), conserved amino acidsare highlighted by squares and gray background. Gaps inserted into the sequences are indicated bydots.


Figure 3 Northern blot showing tissue specificity in the expression of the lobster CUB-serineprotease. (A) Diagram of spiny lobster and body parts used in examining tissue specificity. (B)mRNA Northern blot using 1 �g of poly A RNA from the lateral flagellum of spiny lobster (in eachlane). Two probes from CUB-serine protease were used: “1” encodes only the CUB domain, and “2”encodes both the CUB domain and the serine protease domain. (C) Total RNA Northern blot.Approximately 20 �g of total RNA from each tissue was used. The blot was probed with theCUB-serine protease probe 2 as described in (B), then stripped and reprobed with GAPDH probeas a positive control.

286 Levine et al.

This over-expressed protein was used, in combina-tion with the synthesized peptides, for producing an-tibodies for localizing Csp protein expression patterns[Fig. 5(B)]. One antiserum (#99-6) was selected foruse in determining tissue specificity because in im-munoblots it had the strongest immunoreactivity withCsp compared with the other antisera [Fig. 5(C)].Antiserum #99-6 was generated from both the over-expressed protein fraction and the two peptides fromthe CUB domain (Csp-1 and Csp-2) [Fig. 5(B)].When used in immunoblots with protein samples ex-tracted from lateral flagella, antiserum #99-6 detected

a band with a molecular mass of around 60 kD [Fig.5(C)]. All other antisera also recognized a 60 kDprotein [Fig. 5(C)], but generally had less intense orless specific labeling, which suggests that the CUBand serine protease domains are not separated fromeach other during protein processing but rather func-tion together as a unit in the lateral flagella. The 10 kDdifference between the predicted molecular mass(50.251 kD) and the actual molecular mass detectedby SDS-PAGE (ca. 60 kD) may be attributed topost-translational modifications, such as glycosyla-tion. In support of this idea is analysis of the Csp

Figure 4 RT-PCR showing tissue specificity in the expression of the lobster CUB-serine protease.Approximately 40 ng of poly A RNA from each tissue was used. PCR was performed for 20 cycles.Housekeeping genes 18S rRNA and GAPDH were used as positive controls. Primers were fromCUB-serine protease, lobster GAPDH, and lobster 18S rRNA.


Figure 5

288 Levine et al.

sequence with the PROSITE program, which indi-cates that it has one putative N-glycosylation site atamino acid 59 [Fig. 1(A)].

Immunoblots using antiserum #99-6 on differenttissues revealed limited expression of a similar protein(Fig. 6). A single protein band was detected in thelateral flagellum and eyestalk, with a molecular massof approximately 60 kD. There was no immunoreac-tivity detected with the preimmune serum from thesame rabbit. All other tissues— antennular medialflagellum, second antenna, eyestalk, brain, pereiopod(leg, minus the dactyl), dactyl tip, abdominal muscle,intestine, and hepatopancreas—had no labeling [Fig.6(B)]. This result is consistent with the Northern blotand RT-PCR results on RNA expression patterns.Immunoblots using antibody 102-4 [generated againstthe serine protease; Fig. 5(B)] revealed a single pro-tein band of similar density in the lateral flagellumand eyestalk, with a molecular mass of 60 kD [Fig.6(C)]. This result confirms that the CUB and serineprotease domains exist as a single protein in both thelateral flagellum and eyestalk.

CUB-Serine Protease Is Located in theLateral Flagella in Auxiliary CellsSurrounding the Dendrites ofAesthetasc Olfactory Receptor Neurons

The expression pattern of Csp in the lateral flagellumwas examined by immunocytochemistry using anti-serum #99-6. This antiserum was generated from boththe over-expressed protein fraction and the two pep-tides from the CUB domain (Csp-1 and Csp-2) [Fig.5(B)]. The anatomy of the lateral flagellum and itsaesthetasc sensilla, which contain ORNs, is describedin Figure 7. The expression pattern of Csp was exam-ined for animals of different molt stages and for allregions of the lateral flagellum. We examined differ-ent molt stages because the physiology of animalschanges dramatically over a molt cycle, includingexpression patterns of some proteins (Chung et al.,1998). Of particular interest in the context of thepotential role of Csp in affecting function or growth of

the olfactory organ is the fact that proliferation rate ofORNs is dependent on molt cycle, with highest ratesin premolt and lowest rates in intermolt animals (Har-rison et al., 2001b). We also examined expressionover the entire lateral flagellum, because it containsdifferent zones with ORNs of different ages and statesof functional maturation (Steullet et al., 2000a). Thesezones, from proximal to distal, are:

1. The nonaesthetasc zone, which does not con-tain aesthetascs, and constitutes the proximalhalf of the lateral flagellum.

2. The ORN proliferation zone, where new aes-thetascs and their ORNs are born, which arenot functionally mature and not yet responsiveto odors.

3. The ORN maturation zone, where aesthetascORNs mature and become odor responsive.

4. The mature zone, where functional aesthetascORNs exist.

5. The senescence zone, where aesthetasc ORNslose their odor sensitivity and eventually die(Steullet et al., 2000a) [Fig. 8(A)]. Therefore,Csp expression patterns were examined forantennules from at least two different lobstersfor each molt stage and for each flagellar zone.

Immunocytochemistry showed that the Csp ex-pression pattern in the lateral flagellum was generallysimilar at all molt stages. In postmolt animals, Csp-like IR was observed in all lateral flagellar regionsthat contained aesthetasc ORNs (Fig. 8). However,the labeling was more prominent in the central por-tions of the aesthetasc-bearing regions, which are theregions containing maturing and mature aesthetascORNs (i.e., in regions 3 and 4 of Fig. 8; Steullet et al.,2000a). Csp-like IR was located in two specific re-gions of the aesthetascs [Fig. 8(B)]. First, it was foundin and around the auxiliary cells that ensheath theinner dendrite segments of aesthetasc ORNs [Fig.8(C,E,G)]. We could not determine if Csp-like IR wasassociated with the inner or outer auxiliary cells.Second, Csp-like IR was also located around the ORN

Figure 5 Over-expression of the CUB domain, antibody generation, and immunoblot. (A) Over-expression of the CUB domain. The CUB domain was over-expressed in the pTrcHis2A his-tagvector in bacteria by IPTG induction and then purified by immobilized metal affinity chromatog-raphy. 1. Total bacterial protein from the construct without 1 mM IPTG induction. 2. Total bacterialprotein from the construct with 1 mM IPTG induction. 3. Over-expressed CUB domain afterpurification. (B) Diagram of generation of antibodies against the CUB-serine protease. (C) Immu-noblot of two antibodies generated against different domains of the CUB-serine protease from thetotal protein extract from lateral flagella.


Figure 6

290 Levine et al.

outer dendritic segments in the lumen of the aes-thetascs, along the entire length of the aesthetasclumen, even extending to the tip [Fig. 8(C,F,H)]. Theimmunolabeling had a weblike appearance [Fig.8(H)]. No detectable labeling was found in the ORNsomata, axons, or inner dendritic segments. Immuno-labeling was absent in control tissue treated withpreimmune serum [Fig. 8(D)]. In all treatments, cuti-cle showed autofluorescence at 488 nm (green) butnot at 543 nm, which was used to detect the signal. Agenerally similar pattern of Csp-like IR was alsoobserved in antennules from intermolt and premoltlobsters. As in postmolt animals, Csp-like IR in inter-molt animals was more prevalent in the central, ma-ture ORN region [regions 3 and 4, Fig. 8(A)]. How-ever, in premolt animals, the Csp-like IR was equal inthe entire aesthetasc region [regions 2–5, Fig. 8(A)].

In summary, immunocytochemistry indicates thatCsp protein is found in all regions of the lateralflagellum where aesthetascs exist, although it may bemore prevalent in regions of maturing and matureaesthetasc ORNs. Csp is located near the auxiliarycells surrounding aesthetasc ORN inner dendrites andnear the ORN outer dendrites, as depicted graphicallyin Figure 8(B). Csp is present throughout the moltcycle of lobsters, with a generally similar expressionpattern except that the distribution may be broader inpremolt animals.

CUB-Serine Protease Is Also Located inTracts Connecting Neuropils in theEyestalk

Csp protein expression pattern in the eyestalk wasexamined using antiserum #99-6. The anatomy of theeyestalk is described in Figure 9. Csp expression waspredominantly restricted to the axonal tracts connect-ing eyestalk ganglia to each other and to the brainproper, but not in the neuropils themselves (summa-rized in Fig. 9). The location of Csp-like IR in theeyestalk is depicted in Figure 9 by three representativeplanes (1–3).

Csp-like IR is high in the axonal tracts connectingthe lamina and external medulla in the protocerebrum[Fig. 9(A)], compared to negative controls (i.e., pre-

immune serum treated). There is no obvious Csp-likeIR in the retina or lamina [compare (A) and (B)].Double labeling for Csp-like IR and for cell nuclei(using DAPI) shows that Csp is not colocalized withcell nuclei [inset to Fig. 9(A)].

Tracts between the external medulla and internalmedulla also show Csp-like IR with a similar pattern(data not shown). Axonal tracts in the terminal me-dulla and hemiellipsoid body neuropils were heavilylabeled, while the neuropils themselves showed onlyslight Csp-like IR. The labeling was weblike andappeared to be in glial cells rather than in neurons[Fig. 9(C)].

The protocerebral tract had extensive Csp-like IR[Fig. 9(E)]. The weblike appearance of its Csp-like IR[inset of Fig. 9(E)] is consistent with its labeling ofglia. The olfactory-globular tract was unlabeled.There was another smaller axonal bundle near theolfactory-globular tract without any Csp-like IR [Fig.9(E)], but we could not determine whether it wasconnected with any neuropil in the terminal medulla.Csp-like IR occurred along the entire length of theprotocerebral tract, until it reached the brain. Therewas, however, very little Csp-like IR in the brainitself, including the anterior median protocerebralneuropil, olfactory lobes, and accessory lobes (datanot shown).

In summary, immunocytochemistry shows thatCsp is located in axonal tracts connecting neuropils inthe eyestalk, and appears to be associated mostclosely with glia rather than neurons. This labelingpattern is summarized in yellow in the top diagram ofFigure 9.

DISCUSSION

We have identified a gene expressed in the olfactoryorgan of spiny lobsters that encodes a CUB-serineprotease with a hydrophobic signal peptide domain.The full-length cDNA sequence of this gene—csp—is1802 bp, and it encodes a 50.25 kD protein with 467amino acids. RT-PCR, Northern blots, and immuno-blots showed that the Csp protein is highly expressedonly in the olfactory organ (i.e., the antennular lateral

Figure 6 Immunoblot showing tissue specificity in the expression of the lobster CUB-serineprotease. (A) 10% SDS-PAGE gel. (B) Immunoblot of protein extracts from different tissues using#99-6 antibody (generated against the CUB domain) at 1:1000 dilution. (C) Immunoblot of proteinextracts from lateral flagellum and eyestalk using #102-4 antibody (generated against serine proteasedomain) at 1:200 dilution. Twenty micrograms of total protein from each tissue was used in allreactions. In immunoblots, signals were detected by chemiluminescence.


flagellum) and in the eyestalk, but not in other tissue.Immunocytochemistry reveals that Csp is located inaesthetasc sensilla of the olfactory organ, near glia

(called auxiliary cells) that surround the inner den-drites of ORNs, and around the receptor neurons’outer dendrites that extend into the receptor lymph

Figure 7 Lateral flagellum of spiny lobster. (A) Distal region of antennular lateral flagellum. Thelateral flagellum is composed of segments called annuli. Aesthetascs are located on the distal region(from Trapido-Rosenthal et al., 1989). (B) Higher magnification drawing of the aesthetasc region oflateral flagellum. There are two rows of aesthetascs on each annulus; cell bodies of olfactoryreceptor neurons (ORNs) associated with a single aesthetasc form a cluster (from Michel et al.,1999). (C) Enlarged view of longitudinal section of one aesthetasc. The proportions of the structuresinside the aesthetasc shaft are not to scale. Each aesthetasc is innervated by around 300 ORNs(Grunert and Ache, 1988; Steullet et al., 2000b). Cell bodies associated with each aesthetasc forma cluster under the base of next proximal row of aesthetascs, the dendrites fill the lumen of theaesthetasc’s cuticular shaft, and the axons project to the olfactory lobes in the brain (Sandeman etal., 1992). There are three segments in each ORN dendrite: inner dendrite, ciliary, and outerdendrite. The transition region between the inner and outer dendrites, which occurs within theaesthetasc itself, forms the transitional zone. The inner dendritic segments that lie underneath theantennular cuticular surface are surrounded by layers of inner auxiliary cell bodies and theirextensions. These glial cells ensheath the inner dendritic segments into the transitional zone in theaesthetasc shaft. In the transitional zone, the inner auxiliary cell extensions will either adjoin thecuticle or project into bundles of dendrites. Outer auxiliary cells are located distal to the innerauxiliary cells, but unlike the inner cells, do not extend into the aesthetasc shaft. Outer dendriticsegments that are distal to the transitional zone do not have a glial sheath. Therefore, only theproximal 20% of the outer dendritic segments have auxiliary cell sheathing (Grunert and Ache,1988). Modified from Grunert and Ache (1988).

292 Levine et al.

within the aesthetasc sensillar shaft. These data leadus to conclude that Csp is expressed in and secretedby glia and associates via the CUB domain with theentire length of the extracellular face of the ORNdendritic membrane, where it is likely to have trypsin-like enzymatic activity. In the olfactory organ, it mayfunction in growth and development or reception byORN, or in perireception. In the eyestalk, this CUB-serine protease associates with cells, probably glia, inaxonal tracts between neuropils.

CUB and Serine Protease DomainsOccur as a Single Structural andFunctional Molecule in the Lobster’sOlfactory Organ and Eyestalk

The Csp protein in the olfactory organ of spiny lob-sters appears to function as a single unit. This is alsothe case for CUB-serine proteases in some other sys-tems (Bork and Beckmann, 1993; Hishida et al., 1996;Yamada et al., 2000). In other cases, proteins contain-ing multiple CUB domains and multiple protease do-mains exist as inactive proenzymes but upon activa-tion are post-translationally processed to form severalsmaller active molecules (Lindsay et al., 1999b). Ad-ditionally, proenzymes can be processed by alterna-tive splicing at the mRNA level (Lindsay et al.,1999b). The CUB-serine protease in the lobster’s ol-factory organ appears not to be processed at either themRNA or protein level. At the mRNA level, only onesize of transcript was detected using either the CUBdomain or both CUB-serine protease domains to-gether as probes [Fig. 3(B)], suggesting that the CUBdomain and the protease domain are not spliced dur-ing mRNA processing. At the protein level, antibodiesgenerated from three regions (CUB domain alone,serine protease domain alone, and both CUB andserine protease domains) detected the same 60 kDprotein in the lateral flagellum [Fig. 5(C)]. Further-more, antibodies generated against the CUB domain(#99-6) and serine protease domain (#102-4) detectedthe same band in both the lateral flagellum and theeyestalk, and with the same density in both tissues[Fig. 6(C)]. These results indicate that the CUB do-main and the protease domain remain together andfunction as a single protein in both the lateral flagel-lum and the eyestalk of the spiny lobster.

CUB-Serine Protease Is Expressed in aRestricted Pattern in the LateralFlagellum and Eyestalk

Three independent approaches—Northern blots (Fig.3), RT-PCR (Fig. 4), and immunoblots (Fig. 6)—all

showed that the mRNA and protein for the CUB-serine protease gene are abundant in the antennularlateral flagella and eyestalk of the spiny lobster. Traceamounts of CUB-serine protease expression wereseen occasionally in two other sensory tissues—sec-ond antennae and dactyls (i.e., leg tips)—but not inother tissue (Fig. 6, inset), including other sensorytissue (antennular medial flagella, leg), other neuraltissue (brain), muscle (abdomen, intestine), and hepa-topancreas. Thus, the expression of CUB-serine pro-tease is primarily restricted to nervous tissue, espe-cially sensory tissue, but it is not expressed in allnervous or sensory tissue. For example, chemorecep-tor neurons and mechanoreceptor neurons are foundin antennular lateral flagella, medial flagella, secondantennae, dactyls, and legs (Cate and Derby, 2001),and the brain has many of these sensory neurons plusother neurons.

Immunocytochemistry shows that expression ofthe Csp protein is highly restricted within the anten-nular lateral flagellum and eyestalk. In the lateralflagellum, Csp-like IR is located specifically in andaround auxiliary cells. These are glial cells that en-sheath the inner dendritic segments of aesthetascORNs in the lateral flagella (Grunert and Ache, 1988;Gleeson et al., 1996). Much of the Csp-like IR, espe-cially near the auxiliary cells, appears to be closelyapposed to cell membranes (Fig. 8), but confirmationof this requires transmission electron microscopy. Itscellular localization and hydrophilic signal peptidedomain suggest that Csp is produced in the auxiliarycell somata at the base of the inner dendritic segmentsof the aesthetasc ORNs, is transported to their cellularprocesses, which extend up the aesthetasc to the tran-sitional zone of the ORNs (Grunert and Ache, 1988;Gleeson et al., 1996), and is secreted out of theauxiliary cells. Some of the extracellularly locatedCsp moves distally in the aesthetasc, even to theaesthetasc tip, into the environment of the outer den-dritic segments of the ORNs.

In the eyestalk, Csp-like IR is found primarily inaxonal tracts connecting neuropil in the eyestalk gan-glia with each other or with neuropils in the brain(Fig. 9). From its cellular localization, we speculatethat Csp-like IR in the eyestalk is probably associatedwith glia rather than neurons. Individual axons orbundles of axons in the protocerebral tracts, and clus-ters of cell bodies, are ensheathed by glial cells (Nun-nemacher and Davis, 1968; Sandeman, 1982; Carlson,1987). Diverse types of glia are found in crustaceans(Sandeman, 1982; Carlson, 1987), and different typesof glia are likely to occur in axonal tracts, somaclusters, and neuropils of P. argus. Csp-like IR has aweblike pattern in which labeled areas are inter-


Figure 8

294 Levine et al.

spersed with pockets of unlabeled areas. This patternof labeling is consistent with the idea that the label isin glia that surround unlabeled neurite tracts and ax-onal bundles between eyestalk ganglia and in theprotocerebral tract (Fig. 9). Verification of the pres-ence of Csp-like IR in glia in the eyestalk will dependon developing glia-specific markers and/or transmis-sion electron microscopic level analysis of the label-ing (e.g., Linser et al., 1997; Hollins and McClintock,2001).

Possible Functions of the CUB-SerineProtease in the Lateral Flagellum andthe Eyestalk

Expression of Csp protein in the lateral flagellumoccurs in all molt stages but with slightly differentpatterns, and its expression is largely independent ofthe developmental age of the ORNs. This distributionof Csp in the lateral flagellum suggests several pos-sible functions, including perireception, maintenanceof ORN dendritic function, and molting.

Perireception. In olfactory perireception, odorantstimuli are processed by molecules located in oraround the ORN dendritic membrane, thus affectingwhich odorant molecules are active and/or how theseodorants move in or out of the receptor environment(Getchell et al., 1984; Carr et al., 1990b). For exam-ple, ectonucleotidases/phosphatases on dendrites ofORNs and auxiliary cells in aesthetascs of spiny lob-sters dephosphorylate adenine nucleotides, which arepotent chemostimulants (Trapido-Rosenthal et al.,1989; Carr et al., 1990a,b; Gleeson et al., 1991, 1992).The lobster olfactory Csp has a cellular localizationsimilar to that of the ectoenzymes—aesthetascs andauxiliary cells. Therefore, the lobster olfactory Cspmight play a role in inactivating exogenous protein orpeptide odorant molecules by cleaving their arginineand lysine residues. If so, Csp would assist in regu-

lating the residence and concentration of protein andpeptide odor stimuli around the receptor sites, thusfacilitating the recovery and limiting desensitization.Furthermore, the fact that Csp is most prevalent in themature region of the intermolt and postmolt stageanimals (Fig. 8) suggests that it functions in odordetection. The lobster olfactory Csp might also func-tion in perireception by generating active odorantsfrom inactive precursors in the sensillar lymph sur-rounding odorant receptors. Behavioral studies of her-mit crabs support this possibility (Rittschof, 1990,1993).

Maintenance of ORN Dendritic Function. The Cspprotein may help to produce an environment condu-cive to the functional integrity of ORNs. ORN den-drites are constantly exposed to a harsh and stressfulenvironment, and they have adopted strategies toovercome these stresses. Aesthetascs, which containORN dendrites, can be physically damaged or de-stroyed, in which case they regenerate (Harrison et al.,2001a). Osmotic stress to the olfactory organ of crus-taceans can cause loss of ORN dendrites, but thedendrites can regenerate to their full length (Gleesonet al., 1996, 2000). Serine proteases and their inhibi-tors might play a role in the maintenance of dendritestructure and function. To achieve this function, thelobster olfactory Csp could have various roles. First, itmight be activated when the dendrites are damaged,and its proteolytic function may help to remove olddendrites to facilitate their replacement by new den-drites. Cell-associated proteolytic activity functions inthe regulation of neural morphogenetic remodeling inother systems (Yoshida and Shiosaka, 1999). Second,Csp might be involved in activating dendritic out-growth. In the olfactory system of rats, proteases mayaffect the turnover, maturation, or neuritic outgrowthof ORNs (Thewke and Seeds, 1996; Akamatsu et al.,1997).

Figure 8 CUB-serine protease-like immunoreactivity in antennular lateral flagellum of postmoltlobster. A longitudinal section is shown for paraffin wax-embedded middle region of an antennulefrom a postmolt animal. (A) Diagram of the lateral flagellum indicates the location of Csp-like IR.The lateral flagellum is divided into five regions, as described in text. (B) Summary of Csp-like IRin the lateral flagellum. Label is restricted to specific regions in the aesthetascs, as indicated in red.(C–H) The micrographs have the same orientation as in (A) and (B), with aesthetascs oriented downand to the right. (C) Low magnification view of Csp-like IR, using Csp antiserum #99-6, from regionlabeled as (C) in the top diagram. (D) Section adjacent to (C) that was treated with preimmune serumat 1:100 dilution. (E,F) Higher magnification view of inset box (E) and (F) in the figure (C). (G,H)Higher magnification view of inset box (G) in figure (E) and box (H) in figure (F), showing Csp-likeIR in auxiliary cells and the aesthetasc lumen. Texas Red label is Csp-like IR; green label is thebackground.


Figure 9

296 Levine et al.

Molting. Csp in the lateral flagellum may be involvedin molting. Lobsters have indeterminate growth, andthey molt repeatedly throughout their lives (Travis,1954). Csp is expressed in the lateral flagellum duringall stages of the molt cycle (Figs. 8 and 9), but thereare differences in the distribution of labeling acrossmolt stages. In postmolt and intermolt stages, Csp isin auxiliary cell processes that envelop and insert intothe bundles of ORN inner dendritic segments (Fig. 8).Csp might facilitate ecdysis through enzymatic break-down of the matrix between the old, to-be-sloughed-off cuticle and the new cuticle forming beneath theold. Csp might also be involved in degrading cuticularanchoring proteins or in activating peptide moltinghormones or other enzymes by processing their proen-zymes to stimulate molting, as has been shown forproteases in insects (Lustigman et al., 1996). Theaesthetasc’s long and narrow shape, specialized po-rous cuticle (Grunert and Ache, 1988; Derby et al.,1997), and extraordinarily dense innervation mayhave led to the evolution of a specific protease tofacilitate molting of this cuticle.

Function of the CUB-Serine Protease inthe Lobster’s Eyestalk

Serine proteases and their inhibitors can serve asmolecules for migration and extension of neural pro-cesses, and they can signal to other cells to regulatecell-cell interactions by modifying the extracellularmatrix (Yoshida and Shiosaka, 1999). For example,plasminogen activator, which is a serine protease, is

localized on neuronal surfaces and may function inaxonal growth through its proteolytic activity on theextracellular matrix (Yoshida and Shiosaka, 1999).One plasminogen activator (Gene Bank accessionnumber AAD00320) has strikingly high sequenceidentity (42%; Fig. 2) to lobster olfactory Csp, sug-gesting that these molecules may have similar func-tions and that the lobster Csp may be involved ingrowth and/or maintenance of axons in the eyestalk.Csp is concentrated in the axonal tracts connectingneuropil regions in the lobster’s eyestalk. The appear-ance and localization of the labeling suggests that Cspis mainly located in glia in these regions, and mayfunction in the maintenance and growth of axonsthere. The CUB domain might serve as a guidanceand binding molecule, leading the serine protease toits substrate region. CUB has two possible bindingpartners: the lipid bilayer and carbohydrates of thecell membrane, and the extracellular matrix. In thelatter case, Csp may degrade components of the ex-tracellular matrix, thereby creating a suitable environ-ment for axonal remodeling.

Serine Protease Inhibitors

Serine protease inhibitors may function in concertwith the CUB-serine protease in the lobster olfactoryorgan. In nervous systems of vertebrates, serine pro-teases and their inhibitors have been shown to be in abalance so as to maintain normal function (Festoff,1990; Scarisbrick et al., 2001). In mammalian olfac-tory organs, a serine protease inhibitor, glia-derived

Figure 9 CUB-serine protease-like immunoreactivity in axonal tracts connecting neuropils of theeyestalk. Top diagram: The eye is located on a cuticular stalk. This eyestalk contains not only theretina but also four ganglia that are part of the protocerebrum (Sandeman et al., 1992). Three of theseare optic ganglia; from distal to proximal, these are the lamina, external medulla, and internalmedulla. Proximal to this is a fourth eyestalk ganglion, which is actually part of the lateralprotocerebrum. This ganglion contains two neuropils, the terminal medulla and the hemiellipsoidbody (Sandeman et al., 1992). Two major axonal tracts connect the brain with protocerebral regionsin the eyestalk: protocerebral tract and olfactory-globular tract. The protocerebral tract links theterminal medulla and hemiellipsoid body with the anterior median protocerebral neuropil. Theolfactory-globular tract links the terminal medulla and hemiellipsoid body with the olfactory andaccessory lobes in the deutocerebrum. A summary of Csp-like IR (red regions) in the eyestalk andthe positions of the three planes in the figures (A–F) are shown in the top diagram. This summaryis based on data from eyestalks from three different lobsters. (A,B) Adjacent sections of lamina andaxonal tracts to the external medulla, from plane 1 in the figure at the top. (C,D) Adjacent sectionsat the terminal medullar region, from plane 2 in the figure at the top. TM, terminal medulla; HB,hemiellipsoid body. (E,F) Adjacent sections in the protocerebral tract region, from plane 3 in thefigure at the top. OGT, olfactory-globular tract. (A,C,E) Csp-like IR, using Csp antiserum #99-6 at1:100 dilution. (B,D,F) Control labeling using preimmune serum. Insets in (A) and (E) arehigh-magnification views of boxed areas. All sections were also stained with DAPI (blue label) toshow cell nuclei and Texas Red for Csp-like IR.


nexin, may promote the maturation, maintenance, andturnover of ORNs (Reinhard et al., 1988, 1994; Scottiet al., 1994). Glia-derived nexin is similar to serineproteases in the lobster’s olfactory organ in that it isproduced primarily in non-neural cells and later asso-ciates with neurons. From these similarities, we spec-ulate that inhibitors for the lobster Csp may be colo-calized with Csp and may modulate its proteolyticactivity, including regulating neural remodeling andmaintaining its functional integrity. Recent prelimi-nary reports of serine protease inhibitors in olfactoryorgans of lobsters P. argus and Homarus americanussupport this idea (Hollins et al., 2000; Hollins andMcClintock, 2001; Stoss et al., 2001).

The Role of Glia in Sensory Systems

Glial cells play a role in development of the sensorysystems. Among the best examples of these are in thevisual and olfactory systems of vertebrates and in-sects. Supporting cells in the olfactory epithelium,which act as glia, survive several functions, includingodorant uptake and processing, detoxification, andphagocytosis of dead and dying sensory neurons (re-viewed in Weiler and Farbman, 1998). Olfactory en-sheathing glia promote axonal extension of rodentORNs (Treloar et al., 2001). These glia express neu-roligin 3 (Gilbert et al., 2001), which is homologousto gliotactin, a protein necessary for development ofthe peripheral nervous system of Drosophila (Auld etal., 1995). Glia aid in organizing central neuropil ofthe antennal lobe of insects (Oland et al., 1999;Rossler et al., 1999; Jhaveri et al., 2000). Serineproteases may play a role in the function of glia in thedevelopment of the mammalian olfactory epithelium.For example, glia in the olfactory epithelium containserine proteases, such as the kexin family protease(Akamatsu et al., 1997) and MSP (Scarisbrick et al.,2001), and serine protease inhibitors, such as glia-derived nexin (GDN) (Reinhard et al., 1988; Scotti etal., 1994), which are suspected of being involved inneurogenesis, axogenesis, maturation, and mainte-nance of ORNs.

Glia also regulate development of visual systemsin insects and vertebrates. Glia aid in the targeting ofphotoreceptor neurons into the lamina of Drosophila(Poeck et al., 2001), a role analogous to that of glia inthe antennal lobe of insects. In chickens, glia controlretinal development, including determination of neu-ronal polarity, axonal growth and guidance, projectionpatterns, and lamination (Fiordalisi and Maness,1999; Ledig et al., 1999; Erskine et al., 2000; Ger-hardt et al., 2000; Steinbach and Schlosshauer, 2000;Willbold et al., 2000; Steinbach et al., 2001). Glia

may also facilitate damage-induced neural regenera-tion in chicken retina (Fischer and Reh, 2001).

In sensory systems, glia play a critical role insynaptic transmission. Glia at synapses contain en-zymes and transporters that regulate the concentra-tions of amino acid transmitters in the synaptic cleft.This has been shown for vertebrate retina (Lee et al.,1986; Kreutzberg et al., 1986; Ekstrom and Anzelius,1998; Gadea and Lopez-Colome, 2001) and the Aply-sia sensory system (Levenson et al., 2000).

While the olfactory organ of crustaceans is beingused as a model to understand many aspects of olfac-tion, including development, repair, transduction, andother physiological processes, the role of glia in thesefunctions is poorly understood. The best-known rolesof auxiliary cells, which are the glia surroundingantennular sensory neurons, are in secreting the sen-sillar cuticle (Guse, 1980a,b; Heimann, 1984) andregulating the odorant composition in the sensillarlymph (Trapido-Rosenthal et al., 1989; Carr et al.,1990a,b; Gleeson et al., 1991, 1992). Comparable gliain insect olfactory sensilla also play these roles ( Carret al., 1990a,b; Keil, 1997). The role of ectonucleoti-dases/phosphatases and nucleoside transporters oncrustacean auxiliary cells in regulating odorant com-position in the sensillar lymph is well described(Trapido-Rosenthal et al., 1989; Carr et al., 1990a,b;Gleeson et al., 1991, 1992), and is analogous to theclearance role of enzymes and transporters at syn-apses as described above. Crustacean auxiliary cellsare known to express a rich variety of other proteins,including those not expressed in olfactory neurons;however, the functional roles of these molecules arepoorly understood. These proteins include glutaminesynthetase (Trapido-Rosenthal et al., 1993; Linser etal., 1997), amine-beta-hydroxylase (Hollins and Mc-Clintock, 2001), alpha2-macroglobulin (Hollins andMcClintock, 2001), and serine proteases and theirinhibitors (this report; Hollins and McClintock, 2001;Stoss et al., 2001). Serine proteases promise to beespecially interesting molecules in the glia of anten-nular lateral flagella of spiny lobsters, because of theirdiversity and specific distributions. For example, inaddition to the relatively broadly distributed Csp de-scribed in the present study, two other types of serineproteases and a protease inhibitor are present in thelateral flagellum but with a different distribution thanCsp, being highly expressed in the aesthetasc ORNproliferation zone relative to other regions of thelateral flagellum (Stoss et al., 2001). The clawed lob-ster H. americanus also expresses several serine pro-teases and their inhibitors (Hollins et al., 2000; Hol-lins and McClintock, 2001). Studies of the specificfunctions of these serine proteases and other glial

298 Levine et al.

proteins will help elucidate the functions of glia in theperipheral olfactory organ.

We thank Lonny Anderson and staff of the Keys MarineLaboratory, Long Key, Florida, for supplying lobsters. Wethank Vivian Ngo and Ping Jiang for technical assistance,and Chung-Dar Lu and Timothy McClintock for technicaladvice.

REFERENCES

Akamatsu T, Daikoku S, Nagamune H, Yoshida S, Mori K,Tsuji A, Matsuda Y. 1997. Developmental expression ofa novel kexin family protease, PACE4E, in the rat olfac-tory system. Histochem Cell Biol 108:95–103.

Auld VJ, Fetter RD, Broadie K, Goodman CS. 1995. Glio-tactin, a novel transmembrane protein on peripheral glia,is required to form the blood-nerve barrier in Drosophila.Cell 81:757–767.

Baird JL, Rapier JA. 1995. A serine protease involved incontact mediated repulsion of retinal growth cones byDRG neurites. J Neurosci 15:6605–6618.

Basbaum CB, Werb Z. 1996. Focalized proteolysis: spatialand temporal regulation of extracellular matrix degrada-tion at the cell surface. Curr Opin Cell Biol 8:731–738.

Blaustein DN, Simmons RB, Burgess MF, Derby CD, Nish-ikawa M, Olson KS. 1993. Ultrastructural location of 5�AMP odorant receptor sites on the dendrites of olfactoryreceptor neurons of the spiny lobster. J Neurosci 13:2821–2828.

Bond JS, Beynon RJ. 1995. The astacin family of met-alloendopeptidases. Protein Sci 4:1247–1261.

Bork P, Beckmann G. 1993. The CUB domain. A wide-spread module in developmentally regulated proteins. JMol Biol 231:539–545.

Carlson SD. 1987. Ultrastructure of arthropod neuroglia andneuropil. In: Gupta AP, editor. Arthropod brain: its evo-lution, development, structure, and function. New York:Wiley, p 323–346.

Carr WES, Gleeson RA, Trapido-Rosenthal HG. 1990a.The role of perireceptor events in chemosensory pro-cesses. Trends Neurosci 13:212–215.

Carr WES, Trapido-Rosenthal HG, Gleeson RA. 1990b.The role of degradative enzymes in chemosensory pro-cesses. Chem Senses 15:181–190.

Cate HS, Derby CD. 2001. Morphology and distribution ofsetae on the antennules of the Caribbean spiny lobsterPanulirus argus reveal new types of bimodal chemo-mechanosensilla. Cell Tissue Res 304:439–454.

Chung AC, Durica DS, Hopkins PM. 1998. Tissue-specificpatterns and steady-state concentrations of ecdysteroidreceptor and retinoid-X-receptor mRNA during the moltcycle of the fiddler crab, Uca pugilator. Gen CompEndocrinol 109:375–389.

Delgadillo-Reynoso MG, Rollo DR, Hursh DA, Raff RA.1989. Structural analysis of the uEGF gene in the seaurchin Strongylocentrotus purpuratus reveals more sim-

ilarity to vertebrate than to invertebrate genes with EGF-like repeats. J Mol Evol 29:314–327.

Derby CD, Cate HS, Gentilcore LR. 1997. Perireception inolfaction: molecular mass sieving by aesthetasc sensillarcuticle determines odorant access to receptor sites in theCaribbean spiny lobster Panulirus argus. J Exp Biol200:2073–2081.

Derby CD, Maskol K, Cate HS, Steullet P, Harrison PJH.2001. Ontogeny in olfaction: comparison of turnover inthe olfactory system of post-larval and adult spiny lob-sters. Chem Senses, to appear.

Ekstrom P, Anzelius M. 1998. GABA and GABA-trans-porter (GAT-1) immunoreactivities in the retina of thesalmon (Salmo salar L.). Brain Res 812:179–185.

Erskine L, Williams SE, Brose K, Kidd T, Rachel RA,Goodman CS, Tessier-Lavigne M, Mason CA. 2000.Retinal ganglion cell axon guidance in the mouse opticchiasm: expression and function of Robos and Slits.J Neurosci 20:4975–4982.

Festoff BW, editor. 1990. Serine proteases and their serpininhibitors in the nervous system: regulation in develop-ment and in degenerative and malignant disease. NewYork: Plenum. 359 p.

Fiordalisi JJ, Maness PF. 1999. Rek, an Axl/Tyro3-relatedreceptor class tyrosine kinase, is expressed in Muller gliaand differentiating neural subpopulations in the avianretina. Exp Eye Res 68:201–210.

Fischer AH, Reh TA. 2001. Muller glia are a potentialsource of neural regeneration in the postnatal chickenretina. Nature Neurosci 4:247–252.

Gadea A, Lopez-Colome AM. 2001. Glial transporters forglutamate, glycine, and GABA. II. GABA transporters.J Neurosci Res 63:461–468.

Gerhardt H, Rascher G, Schuck J, Weigold U, Redies C,Wolburg H. 2000. R- and B-cadherin expression definessubpopulations of glial cells involved in axonal guidancein the optic nerve head of the chicken. Glia 31:131–143.

Getchell TV, Margolis FL, Getchell ML. 1984. Perireceptorand receptor events in vertebrate olfaction. Prog Neuro-biol 23:317–345.

Gilbert M, Smith J, Roskams AJ, Auld VJ. 2001. Neuroligin3 is a vertebrate gliotactin expressed in the olfactoryensheathing glia, a growth-promoting class of macroglia.Glia 34:151–164.

Gleeson RA, Hammar K, Smith PJ. 2000. Sustaining olfac-tion at low salinities: mapping ion flux associated withthe olfactory sensilla of the blue crab Callinectes sapidus.J Exp Biol 20:3145–3152.

Gleeson RA, McDowell LM, Aldrich HC. 1996. Structureof the aesthetasc (olfactory) sensilla of the blue crab,Callinectes sapidus: transformation as a function of sa-linity. Cell Tissue Res 284:279–288.

Gleeson RA, McDowell LM, Aldrich HC, Trapido-Rosenthal HG, Carr WES. 1991. Localization of 5�-ectonucleotidase/phophatase activity within the olfactorysensilla of the spiny lobster, Panulirus argus. Cell TissueRes 265:385–391.

Gleeson RA, Trapido-Rosenthal HG, McDowell LM, Al-


drich HC, Carr WES. 1992. Ecto-ATPase/phosphataseactivity in the olfactory sensilla of the spiny lobsterPanulirus argus: localization and characterization. CellTissue Res 269:439–445.

Grunert U, Ache BW. 1988. Ultrastructure of the aesthetasc(olfactory) sensilla of the spiny lobster Panulirus argus.Cell Tissue Res 251:95–103.

Gschwend TP, Krueger SR, Kozlov SV, Wolfer DP, Son-deregger P. 1997. Neurotrypsin, a novel multidomainserine protease expressed in the nervous system. Mol CellNeurosci 9:207–219.

Guse G-W. 1980a. Development of antennal sensilla duringmoulting in Neomysis integer (Leach) (Crustacea, Mysi-dacea). Protoplasma 105:53–67.

Guse G-W. 1980b. Fine structure of sensilla during moult-ing in Neomysis integer (Leach) (Crustacea,Mysidacea).Experiencia 36:1382–1384.

Harrison PJH, Cate HS, Steullet P, Derby CD. 2001a. Struc-tural plasticity in the olfactory system of adult spinylobsters: postembryonic development enables life-longgrowth, turnover, and regeneration. Mar Freshwater Res,to appear.

Harrison PJH, Cate HS, Swanson ES, Derby CD. 2001b.Postembryonic proliferation in the spiny lobster antennu-lar epithelium: rate of genesis of olfactory receptor neu-rons is dependent on molt stage. J Neurobiol 47:51–66.

Hatt H, Ache BW. 1994. Cyclic nucleotide-and inositolphosphate-gated ion channels in lobster olfactory recep-tor neurons. Proc Natl Acad Sci USA 91:6264–6268.

Heimann P. 1984. Fine structure and molting of aesthetascsense organs on the antennules of the isopod, Asellusaquaticus (Crustacea). Cell Tissue Res 235:117–128.

Hernandez-Cortes P, Whitaker JR, Garcia-Carreno FL.1997. Purification and characterization of chymotrypsinfrom Penaeus vannamei (Crustacea: Decapoda). J FoodBiochem 21:497–514.

Hishida R, Ishihara T, Kondo K, Kasura I. 1996. hch-1, agene required for normal hatching and normal migrationof a neuroblast in C. elegans, encodes a protein related totolloid and BMP-1. EMBO J 15:4111–4122.

Hollins B, McClintock TM. 2001. Cell type specific expres-sion of olfactory-enriched mRNAs in the lobster olfac-tory organ. Chem Senses, to appear.

Hollins B, Schweder D, McClintock TM. 2000. Identifica-tion of messenger RNAs enriched in the lobster olfactoryorgan. Chem Senses 25:646.

Jhaveri D, Sen A, Rodrigues V. 2000. Mechanisms under-lying olfactory connectivity in Drosophila: the atonallineage organizes the periphery while sensory neuronsand glia pattern the olfactory lobe. Dev Biol 226:73–87.

Kanost MR. 1999. Serine protease inhibitors in arthropodimmunity. Dev Comp Immuno 23:291–301.

Keil TA. 1997. Comparative morphogenesis of sensilla: areview. Int J Insect Morphol Embryol 26:151–160.

Klein B, LeMoullac G, Sellos D, Van Wormhoudt A. 1996.Molecular cloning and sequencing of trypsin cDNAsfrom Penaeus vannamei (Crustacea, Decapoda): use in

assessing gene expression during the molt cycle. IntJ Biochem Cell Biol 28:551–563.

Kreutzberg GW, Heymann D, Reddington M. 1986. 5�-Nucleotidase in the nervous system. In: Kreuzberg GW,Reddington M, Zimmermann H, editors. Cellular biologyof ectoenzymes. Berlin: Springer, p 147–164.

Laemmli UK. 1970. Cleavage of structural proteins duringthe assembly of the head of bacteriophage T4. Nature227:680–685.

Ledig MM, McKinnell LW, Mrsic-Flogel T, Wang J, Al-vares C, Mason I, Bixby JL, Mueller BK, Stoker AW.1999. Expression of receptor tyrosine phosphatases dur-ing development of the retinotectal projection of thechick. J Neurobiol 39:81–96.

Lee KS, Scubert P, Reddington M, Kreutzberg GW. 1986.The distribution of adenosine A1 receptors and 5�-nucle-otidase in the hippocampal formation of several mamma-lian species. J Comp Neurol 256:427–434.

Lemosy EK, Hong CC, Hashimoto C. 1999. Signal trans-duction by a protease cascade. Trends Cell Biol 9:102–107.

Levenson J, Sherry DM, Dryer L, Chin J, Byrne JH, EskinA. 2000. Localization of glutamate and glutamate trans-porters in the sensory neurons of Aplysia. J Comp Neurol423:121–131.

Leytus SP, Kurachi K, Sakariassen KS, Davie EW. 1986.Nucleotide sequence of the cDNA coding for humancomplement C1r. Biochemistry 26:4855–4863.

Lindsay L, Wieduwilt MJ, Hedrick J. 1999a. Oviductin, theXenopus laevis oviductal protease that processes egg en-velope glycoprotein gp43, increases sperm binding toenvelopes, and is translated as part of an unusual mosaicprotein composed of two protease and several CUB do-mains. Biol Reprod 60:989–995.

Lindsay L, Yang J, Hedrick JL. 1999b. Ovochymase, aXenopus laevis egg extracellular protease, is translated aspart of an unusual polyprotease. Proc Natl Acad Sci USA96:11253–11258.

Linser PJ, Trapido-Rosenthal HG, Orona E. 1997. Glu-tamine synthetase is a glial-specific marker in the olfac-tory regions of the lobster (Panulirus argus) nervoussystem. Glia 20:275–283.

Lustigman S, McKerrow JH, Shah K, Lui J, Huima T,Hough M, Brotman B. 1996. Cloning of a cysteine pro-tease required for the molting of Onchocerca volvulusthird stage larvae. J Biol Chem 271:30181–30189.

Lyle WG, McDonald CD. 1983. Molt stage determination inthe Hawaiian spiny lobster Panulirus marginatus. J CrustBiol 3:208–216.

Mankad RV, Gimelbrant AA, McClintock TS. 1998. Con-sensus translational initiation sites of marine invertebratephyla. Biol Bull 195:251–254.

Masos T, Dan JA, Miskin R. 2000. Plasminogen activatorinhibitor-1 mRNA is localized in the ciliary epithelium ofthe rodent eye. Invest Ophthalmol Vis Sci 41:1006–1011.

Matsushita F, Miyawaki A, Mikoshiba K. 2000. Vomer-oglandin/CRP-Ductin is strongly expressed in the glandsassociated with the mouse vomeronasal organ: identifi-

300 Levine et al.

cation and characterization of mouse vomeroglandin.Biochem Biophys Res Commun 16:275–281.

Michel WC, Steullet P, Cate HS, Burns CJ, ZhainazarovAB, Derby CD. 1999. High-resolution functional labelingof vertebrate and invertebrate olfactory receptor neuronsusing agmatine, a channel-permeant cation. J NeurosciMethods 90:143–156.

Moestrup SK, Kozyraki R, Kristiansen M, Kaysen JH,Rasmussen HH, Brault D, Pontillon F, Goda FO, Chris-tensen EI, Hammond TG, Verroust PJ. 1998. The intrin-sic factor-vitamin B12 receptor and target of teratogenicantibodies is a megalin-binding peripheral membraneprotein with high sequence identity to developmentalproteins. J Biol Chem 273:5235–5242.

Monard D. 1988. Cell-derived proteases and protease inhib-itors as regulators of neurite outgrowth. Trends Neurosci11:541–544.

Munger S, Gleeson RA, Aldrich HC, Rust NC, Ache BW.2000. Molecular evidence for phosphoinositide-mediat-ing signaling in lobster olfactory receptor neurons. J BiolChem 275:20450–20457.

Murugasu-Oei B, Balakrishnan R, Yang X, Chia W. 1996.Mutations in masquerade, a novel serine protease-likemolecule, affect axonal guidance and taste behavior inDrosophila. Mech Dev 57:91–101.

Nunnemacher RF, Davis PP. 1968. The fine structure of theLimulus optic nerve. J Morphol 125:61–70.

Oland LA, Marrero HG, Burger I. 1999. Glial cells in thedeveloping and adult olfactory lobe of the moth Manducasexta. Cell Tissue Res 297:527–545.

Poeck B, Fischer S, Gunning D, Zipursky SL, Salecker I.2001. Glial cells mediate target layer selection of retinalaxons in the developing visual system of Drosophila.Neuron 29:99–113.

Reinhard E, Meier R, Halfter W, Rovelli G, Monard D.1988. Detection of glia-derived nexin in the olfactorysystem of the rat. Neuron 1:387–394.

Reinhard E, Suidan HS, Pavlik A, Monard D. 1994. Glia-derived nexin/protease nexin-1 is expressed by a subsetof neurons in the rat brain. J Neurosci Res 37:256–270.

Rittschof D. 1990. Peptide-mediated behaviours in marineorganisms: evidence for a common theme. J Chem Ecol16:261–272.

Rittschof D. 1993. Body odors and neutral-basic peptidemimics: a review of responses by marine organisms.Amer Zool 33:487–493.

Rossler W, Oland LA, Higgins MR, Hildebrand JG, TolbertLP. 1999. Development of a glia-rich axon-sorting zonein the olfactory pathway of the moth Manduca sexta.J Neurosci 19:9865–9877.

Roy P, Colas B, Durand P. 1996. Purification, kinetical, andmolecular characterizations of a serine collagenolyticprotease from green shore crab (Carcinus maenas) diges-tive gland. Comp Biochem Physiol 115B:87–95.

Saksela O, Rifkin D. 1988. Cell associated plasminogenactivation: regulation and physiological functions. AnnRev Cell Biol 4:93–126.

Sandeman D, Sandeman R, Derby C, Schmidt M. 1992.

Morphology of the brain of crayfish, crabs, and spinylobsters: a common nomenclature for homologous struc-tures. Biol Bull 183:304–326.

Sandeman DC. 1982. Organization of the central nervoussystem. In: Atwood HL, Sandeman DC, editors. Thebiology of Crustacea. Vol. 3: Neurobiology: structure andfunction. New York: Academic, p 1–61.

Scarisbrick IA, Isackson PJ, Ciric B, Windebank AJ, Ro-driguez M. 2001. MSP, a trypsin-like serine protease, isabundantly expressed in the human nervous system.J Comp Neurol 431:347–361.

Scotti AL, Hoffmann MC, Nitsch C. 1994. The neuritegrowth-promoting protease nexin-1 in glial cells of theolfactory bulb of the gerbil: an ultrastructural study. CellTissue Res 278:409–413.

Seeds NW, Haffke S, Christensen K, Schoonmaker J. 1990.Cerebellar granule cell migration involves proteolysis. In:Lauder JM, editor. Molecular aspects of development andaging of the nervous system. New York: Plenum, p169–178.

Soderhall K, Cerenius L. 1998. Role of the propheroloxi-dase-activating system in invertebrate immunity. CurrOpin Immunol 10:23–28.

Steinbach K, Bauch H, Stier H, Schlosshauer B. 2001.Tissue-specific neuro-glia interactions determine neuritedifferentiation in ganglion cells. Eur J Cell Biol 80:245–255.

Steinbach K, Schlosshauer B. 2000. Regulatory cell inter-actions between retinal ganglion cells and radial gliaduring axonal and dendritic outgrowth. Microsc ResTechn 48:12–24.

Steullet P, Cate HS, Derby CD. 2000a. A spatiotemporalwave of turnover and functional maturation of olfactoryreceptor neurons in the spiny lobster Panulirus argus.J Neurosci 20:3282–3294.

Steullet P, Cate HS, Michel WC, Derby CD. 2000b. Func-tional units of a compound nose: aesthetasc sensilla housesimilar populations of olfactory receptor neurons on thecrustacean antennules. J Comp Neurol 418:270–280.

Stoss T, Derby CD, McClintock TM. 2001. Transcriptsenriched in the proliferation zone of the spiny lobsterolfactory organ. Chem Senses, to appear.

Takagi S, Kasuya Y, Shimizu M, Matsuura T, Tsuboi M,Kawakami A, Fujisawa H. 1995. Expression of a celladhesion molecule, neuropilin, in the developing chicknervous system. Dev Biol 170:207–222.

Thewke DP, Seeds NW. 1996. Expression of hepatocytegrowth factor/scatter factor, its receptor, c-met and tissue-type plasminogen activator during development of themurine olfactory system. J Neurosci 16:6933–6944.

Topfer-Peterson E, Romero A, Varela PF, Ekhlasi-Hun-drieser M, Dostalova Z, Sanz L, Calvete JJ. 1998. Sper-madhesins: a new protein family. Facts, hypotheses andperspectives. Andrologia 30:217–224.

Tosi M, Duponchel C, Meo T, Julier C. 1987. CompletecDNA sequence of human complement Cls and closephysical linkage of the homologous genes Cls and Clr.Biochemistry 29:8516–8524.


Trapido-Rosenthal HG, Carr WES, Gleeson RA. 1989. Bio-chemistry of purinergic olfaction. The importance of nu-cleotide dephosphorylation. In: Brand JG, Teeter JH,Cagan RH, Kare MR, editors. Chemical senses, Vol. 1:Receptor events and transduction in taste and olfaction.New York: Marcel Dekker, p 243–262.

Trapido-Rosenthal HG, Linser PJ, Greenberg RM, GleesonRA, Carr WES. 1993. cDNA clones from the olfactoryorgan of the spiny lobster encode a protein related toeukaryotic glutamine synthetase. Gene 129:275–278.

Travis DF. 1954. The molting cycle of the spiny lobster,Panulirus argus Latreille. I. Molting and growth in lab-oratory-maintained individuals. Biol Bull 107:433–450.

Treloar HB, Bartolomei JC, Lipscomb BW, Greer CA.2001. Mechanisms of axonal plasticity: lessons from theolfactory pathway. Neuroscientist 7:55–63.

Vanwormhoudt A, Sellos D, Donval A. 1995. Chymotryp-sin gene-expression during the intermolt cycle in theshrimp Penaeus vannamei (Crustacea-Decapoda). Expe-rientia 51:159–163.

Weiler E, Farbman AI. 1998. Supporting cell proliferation

in the olfactory epithelium decreases postnatally. Glia22:315–328.

Willbold E, Rothermel A, Tomlinson S, Layer PG. 2000.Muller glia cells reorganize reaggregating chicken retinalcells into correctly laminated in vitro retinae. Glia 29:45–57.

Wisniewski HG, Burgess WH, Oppenheim JD, Vilcek J.1994. TSG-6, an arthritis-associated hyaluronan bindingprotein, forms a stable complex with the serum proteininter-alpha-inhibitor. Biochemistry 33:7423–7439.

Xu FQ, Bose SC, McClintock TS. 1999. Lobster G-proteincoupled receptor kinase that associates with membranesand G-proteins in response to odorants and neurotrans-mitters. J Comp Neurol 415:449–459.

Xu FQ, McClintock TS. 1999. A lobster phospholipase C-�that associates with G-proteins in response to odorants.J Neurosci 19:4881–4888.

Yamada K, Takabatake T, Takeshima K. 2000. Isolationand characterization of three novel serine protease genesfrom Xenopus laevis. Gene 252:209–216.

Yoshida S, Shiosaka S. 1999. Plasticity-related serine pro-teases in the brain (review). Int J Mol Med 3:405–409.

302 Levine et al.

A CUB-Serine Protease in the Olfactory Organ of the … CUB-Serine Protease in the Olfactory Organ...

Documents

Transcript of A CUB-Serine Protease in the Olfactory Organ of the … CUB-Serine Protease in the Olfactory Organ...