A Caleosin-Like Protein with Peroxygenase Activity MediatesAspergillus flavus Development, Aflatoxin Accumulation, and SeedInfection

Abdulsamie Hanano,a Ibrahem Almousally,a Mouhnad Shaban,a Elizabeth Bleeb

Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria (AECS), Damascus, Syriaa; Institut de Biologie Moléculaire des Plantes,Strasbourg, Franceb

Caleosins are a small family of calcium-binding proteins endowed with peroxygenase activity in plants. Caleosin-like genes arepresent in fungi; however, their functions have not been reported yet. In this work, we identify a plant caleosin-like protein inAspergillus flavus that is highly expressed during the early stages of spore germination. A recombinant purified 32-kDa caleosin-like protein supported peroxygenase activities, including co-oxidation reactions and reduction of polyunsaturated fatty acidhydroperoxides. Deletion of the caleosin gene prevented fungal development. Alternatively, silencing of the gene led to the in-creased accumulation of endogenous polyunsaturated fatty acid hydroperoxides and antioxidant activities but to a reduction offungal growth and conidium formation. Two key genes of the aflatoxin biosynthesis pathway, aflR and aflD, were downregulatedin the strains in which A. flavus PXG (AfPXG) was silenced, leading to reduced aflatoxin B1 production in vitro. Application ofcaleosin/peroxygenase-derived oxylipins restored the wild-type phenotype in the strains in which AfPXG was silenced. PXG-deficient A. flavus strains were severely compromised in their capacity to infect maize seeds and to produce aflatoxin. Our resultsuncover a new branch of the fungal oxylipin pathway and may lead to the development of novel targets for controlling fungaldisease.

Oxylipins constitute a large family of diverse oxygenated fattyacids and derivatives present in mammals, plants, algae, and

fungi (1–3). While the biosynthesis and the roles of animal andplant oxylipins have been extensively studied (4–8), knowledgeabout fungal oxylipins remains limited. Fungal oxylipins are wide-spread among filamentous fungi, yeasts, and oomycetes (9–11)and were first described to be precocious sexual inducers, or psifactors (12). They are composed of a mixture of hydroxylatedoxylipins derived from oleic (18:1), linoleic (18:2), and linolenic(18:3) acids under the action of psi factor-producing oxygenase(Ppo) enzymes (13–15). Linoleate diol synthase (LDS) convertslinoleic acid directly to hydroxylated derivatives (8). However,most of the fungal oxylipins derive from an initial hydroperoxi-dation step, whereby polyunsaturated fatty acids (PUFAs) are cat-alyzed by lipoxygenases (LOXs) and dioxygenases (DOXs) (8, 16,17). Whereas in plants such enzymes form essentially three typesof hydroperoxides (OOHs), i.e., 9-OOH, 13-OOH, and 2-OOH,in fungi, they can introduce molecular oxygen on the carbon 8, 10,11, or 15 of PUFA, yielding 8-OOH, 10-OOH, 11-OOH, and 15-OOH derivatives, respectively (8, 10, 11, 17, 18). Whatever theirmode of formation, fatty acid hydroperoxides (FAOOHs) andtheir metabolites have been reported to play crucial roles in the lifecycle of fungi, notably, in conidiogenesis and sclerotium forma-tion (19). In addition, Ppo-derived psi factors produced by Asper-gillus nidulans were shown to regulate both asexual and sexualspore development (12, 14, 20).

Fungal oxylipins are also involved in the regulation of second-ary metabolism, involving the synthesis of mycotoxins and anti-biotics. For example, deletion of Ppo enzymes yielded mutantsdepleted of the mycotoxin sterigmatocystin but enriched withpenicillin (21). A lipoxygenase-like enzyme-deficient Aspergillusochraceus strain producing low levels of linoleic acid-derived 13-hydroperoxyoctadecadienoic acid (13-HPOD) displayed de-

creased ochratoxin A production and delayed formation ofconidia but increased production of sclerotia. Complementationof the culture medium with 9-HPOD and 13-HPOD enhanced theproduction of ochratoxin A in wild-type (WT) A. ochraceus butnot in a mutant in which the LOX-like gene was deleted (19).Fungal production of aflatoxins seems to be favored by an oxida-tive environment. For example, the oxidative stress caused by theaddition of cumene hydroperoxide and H2O2 was reported to in-duce aflatoxin accumulation (22). In contrast, plant-derived an-tioxidants diminished aflatoxin formation without affecting fun-gal growth (23). Besides endogenous oxylipins, several lines ofevidence show that during the Aspergillus-seed interaction, thehost oxylipins also play determinant roles in the biology of thefungus (24). For example, 13-HPOD affected sexual spore devel-opment in A. nidulans and Aspergillus flavus, whereas spore ger-mination was inhibited by C6 to C12 derivatives of the phytooxy-lipin pathway (25). In addition, while 13-HPOD decreased thelevels of production of mycotoxins, 9-HPOD did not reduce theirlevels of biosynthesis (26). Moreover, genetic evidence for recip-rocal oxylipin cross talk during the plant-seed interaction has been

Received 17 March 2015 Accepted 20 June 2015

Accepted manuscript posted online 26 June 2015

Citation Hanano A, Almousally I, Shaban M, Blee E. 2015. A caleosin-like proteinwith peroxygenase activity mediates Aspergillus flavus development, aflatoxinaccumulation, and seed infection. Appl Environ Microbiol 81:6129 –6144.doi:10.1128/AEM.00867-15.

Editor: A. A. Brakhage

Address correspondence to Abdulsamie Hanano, ashanano@aec.org.sy.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.00867-15

September 2015 Volume 81 Number 18 aem.asm.org 6129Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

reported: plant oxylipin directly or indirectly affected Aspergillusdevelopment processes, whereas plant oxylipin production, inturn, was modified during infection by the fungus (27). Intrigu-ingly, plant fatty acid hydroperoxides and their correspondingalcohols are metabolized by fungi into trihydroxy derivatives (28).In plants, such oxylipins are derived from the hydrolysis of 15,16-epoxy-13-hydroxy-9,11-octadecenoic acid. The formation ofthese quite unusual epoxy alcohols is catalyzed by peroxygenase(29). In addition to �-dioxygenases and cytochrome P450 en-zymes, this enzyme is known to initiate one of the branches of thephytooxylipin pathway. Such peroxygenases have been identifiedto be caleosins, which constitute a small family of Ca2�-bindingproteins (30). They are membrane-bound hemoproteins that arestrictly hydroperoxide dependent and play protective roles in re-sponse to stress (31). Although we have demonstrated that mem-bers of the plant caleosins act as peroxygenases (30, 32, 33), theenzymatic activity of fungal caleosins remains to be confirmed.

Here we identify one of the Aspergillus flavus genes to be a genefor caleosin. The corresponding protein encoded by the gene pos-sesses peroxygenase activity, including oxylipin formationactivity. The possibility that fungal caleosin could catalyze the for-mation of antifungal epoxy and hydroxy fatty acid (FAOH) deriv-atives (28) led us to ask how such compounds are physiologicallyrelevant in fungi and how their biosynthesis is regulated duringthe plant-pathogen interaction. Because disruption of the caleosingene prevents fungal development, we have used small interferingRNA (siRNA) approaches to reveal its importance in fungalgrowth and thus in aflatoxigenicity. Our data uncover a new oxy-lipin pathway in fungi.

MATERIALS AND METHODSMaterials, chemicals, host strains, and culture conditions. Oligonucle-otides were provided either by Eurofins or by Sigma-France. Aniline,thiobenzamide, cumene hydroperoxide, aflatoxin B1 (AFB1), andAFB2 were purchased from Sigma-Aldrich. [1-14C]oleic acid and[1-14C]linoleic acid (52 and 50 �Ci/mmol, respectively) were pur-chased from PerkinElmer Life Sciences. Aspergillus flavus strain FSS63,isolated from a local farmed soil, was morphologically and biochemicallyidentified by the Laboratory of Microbiological Enzymes of the AtomicEnergy Commission of Syria (AECS). This strain was subjected to a finemolecular characterization. Using primers designed to amplify the inter-nal transcribed spacer (ITS) region as described by White et al. (34), theITS region was amplified and sequenced. Moreover, the identity of thisstrain as A. flavus was confirmed using a protocol proposed by Godet andMunaut (35) as well as by the restriction fragment length polymorphism(RFLP) method as described before (36). The primers used in this studyare presented in Table 1. Stock cultures of A. flavus were maintained inslant tubes at 4°C on potato dextrose agar (PDA; Difco Laboratories,USA). For solid or liquid cultures of A. flavus, the stock culture was trans-ferred onto petri dishes containing PDA or into a 500-ml Erlenmeyer flaskcontaining 100 ml of potato dextrose (PD) broth, respectively, and al-lowed to develop for 7 days at 28°C. Escherichia coli strain TOP10 was usedas the host for plasmid cloning experiments. Bacteria were grown inLuria-Bertani medium supplemented with ampicillin (100 �g ml�1) at37°C. Saccharomyces cerevisiae Wa6 (ade his7-2 leu2-3 leu2-112 ura3-52)was used as the host for protein expression. Recombinant yeast was grownin S medium (7 g liter�1 yeast nitrogen base, 1 g liter�1 Casamino Acids,and 20 g liter�1 glucose supplemented with 50 �g ml�1 histidine, 200 �gml�1 adenine, and 50 �g ml�1 leucine) for 2 days with shaking at 30°C.

Preparation of A. flavus subcellular fractions. Isolation of micro-somal and oleosomal fractions from fungal cells was performed essentiallyas described previously (37, 38) with a slight modification. Fungal myceliataken from 7-day-old cultures were pelleted by centrifugation at 5,000 �

g, and the cells were washed with 200 ml of washing buffer (50 mM Tris-HCl, pH 7.5). The pellet (10 g) was resuspended in 30 ml of the samebuffer containing 0.6 M sorbitol and 1% (vol/vol) protease inhibitor cock-tail (Sigma-Aldrich) and remained on ice during the preparation proce-dure. The fungal cells were disrupted by a high-performance disperser(Ultra-Turrax; IKA, Germany). The resulting homogeneous lysate wascentrifuged once at 10,000 � g for 15 min. The supernatant was recoveredand centrifuged at 100,000 � g for 90 min. After centrifugation, a fine,floating, creamy layer of lipid droplets, corresponding to oleosomes, wasobtained on the surface of the preparation, while the pellet correspondedto microsomes. The crude lipid droplet fraction was carefully collectedwith a pipette and washed with 100 mM potassium pyrophosphate bufferthat contained 0.1 M sucrose (pH 7.4). After centrifugation at 100,000 �g for 45 min, the oleosomes were taken and finally suspended in 10 mMTris-HCl, pH 8, containing 10% (vol/vol) glycerol (buffer A). In parallel,the microsome fraction was gently homogenized and suspended in bufferA. The protein concentrations in each fraction were estimated by a Brad-ford assay (Bio-Rad) using bovine serum albumin as a standard (39).

Peroxygenase activities. Peroxygenase activity was routinely mea-sured during the purification procedure by use of aniline and thiobenz-amide as the substrate (40). Epoxidation of [1-14C]oleic acid and[1-14C]linoleic acid was performed as described by Blee and Schuber (41).The hydroperoxide reductase activity of Aspergillus flavus PXG (AfPXG)was measured by incubation of 9-HPOD or 13-HPOD overnight at 26°Cwith 50 �g of purified recombinant AfPXG in a total volume of 500 �l ofsodium acetate (0.1 M, pH 5.5). The reaction was stopped with a drop ofHCl (4 N), and the residual substrate and products were extracted threetimes in 2 ml of dichloromethane-ether (1:1, vol/vol). After the extractswere dried under a nitrogen flow, the extracts were taken with 25 �l ofacetonitrile-water-acetic acid (50:50:0.1, vol/vol/vol). The extracts wereanalyzed using a Jasco LC-2000 Plus series high-pressure liquid chroma-tography (HPLC) system (Jasco, USA), a UV detector (234 nm; RF-10Axl;Shimadzu), and a C18 column (150 by 4.6 mm; particle size, 5 �m; Eclipse

TABLE 1 Names and nucleotide sequences of primers used in thisstudya

Name Oligonucleotide sequence (5=–3=)ITS1 TCCGTAGGTGAACCTGCGITS4 TCCTCCGCTTATTGATATGCAfltF GCACCAAATGGGTCTTTCTCGTAfltR ATCCACGGTGAAGAGGGTAAGGAfafltF CGCGCGAGATACTTCTTATACTAfafltR GAGCCCACTTCGAAAATACCAfPXGqF ATGCTCAACGGCGACGGTCCAfPXGqR GCGACGCCGGGGTTGTCTATAfPXGF GGGGATCCATGCCTTCCAAAGTAAACATCGAfPXGR GGAAGCTTTTACGAATATATCTTTTCTCCTAfPXG.NHis GGGGATCCATGCACCACCACCACCACCACATGCCTT

CCAAAGTAAACATCGAfPXG.CHis GGAAGCTTTTAGTGGTGGTGGTGGTGGTGCGAATAT

ATCTTTTCTCCTsiRNAPXG1F UGGGCCAAUAAGGUCCGGGUUsiRNAPXG1R CCCGGACCUUAUUGGCCCAUUsiRNAPXG2F GGCUAAGCACGGCUCGGACUUsiRNAPXG2R GUCCGAGCCGUGCUUAGCCUUP1 AAGTTCGGTTAAGTATGATATCAAP2 GAGTTCAGGCTTTTTCATAAACTATTAAATAACTCAP3 CCGAGGGCAAAGAAATAGTAAAGAGGCGGTTGATACP4 TCTTTGTACAGCGGTTACCATP5 TGAGTTATTAATTAGTTTATGAAAAAGCCTGAACTCP6 AACTATGTATCAACCGCCCTATTTCTTTGCCCTCGGa Underlined nucleotides indicate BamHI and HindIII restriction sites. Poly-His codonswere inserted at the N terminus of primer AfPXG.NHis (6� CAC) and the C terminusof AfPXG.CHis (6� GTG).

Hanano et al.

6130 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

XDB-C18; Agilent, USA). The analysis was performed using a mobilephase of acetonitrile-water-acetic acid (50:50:0.1, vol/vol/vol) at a flowrate of 0.6 ml min�1.

Primers and PCR amplification conditions. The nucleotide se-quences of the primers used in this study are presented in Table 1. ThePCR amplification was performed in a 25-�l reaction final volume con-taining 3 mM MgSO4, 200 �M (each) the four deoxynucleoside triphos-phates (dNTPs), 10 �M each primer, and 2.5 U Taq DNA polymerase.PCR conditions were 94°C for 4 min, followed by 35 cycles at 94°C for 30s, 58°C for 30 s, and 72°C for 1 min and then a hold at 72°C for 10 min.PCR amplifications were verified by 1% agarose gel electrophoresis for 30min at 100 V. The gel was visualized in an UV illuminator. If necessary, thePCR fragments were purified using a QIAquick PCR purification kit (Qia-gen, USA).

Analysis of gene transcripts. For studies of AfPXG gene expression, A.flavus was grown by spreading a suspension containing a known numberof fungus conidia (about 1 � 106 spores ml�1) on PDA plates at 28°C for7 days. Each developmental stage (germinated spores, mycelia, conidio-phores, and conidia) was produced in triplicate. The totality of fungalgrowth in each stage was collected and taken for RNA isolation and cDNAsynthesis. Total RNA was extracted from the fungal cells using an RNeasykit according to the manufacturer’s instructions (Qiagen, Germany).DNA traces were removed by treating RNA for 1 h at 37°C with 2 U ofRNase-free RQI DNase (Promega, USA). RNAs were diluted to 50 ng �l�1

using RNase-free water and stored at �80°C. First-strand cDNA synthesiswas performed using Moloney murine leukemia virus (MMLV) reversetranscriptase (RT) (Invitrogen) under the following conditions: 0.5 �g oftotal RNA and 0.5 �g of oligo(dT) primer were denatured for 5 min at65°C and immediately placed on ice for 10 min. The reverse transcriptasereaction was performed in a final volume of 20 �l containing 10 mM eachdNTP, 200 units of MMLV RT, and 10 units of RNase inhibitor, and themixture was incubated for 1 h at 37°C in a Mastercycler Pro gradient PCRmachine (Eppendorf, Germany). RT inactivation and RNA removal wereperformed by heating the reaction mixture at 70°C for 15 min, and thecDNA was stored at �80°C. Real-time PCR was carried out in 48-wellplates using a StepOne cycler from Applied Biosystems, USA. The 25-�lreaction mixtures contained 0.5 �M each target and reference gene-spe-cific primer pairs AfPXGqF/AfPXGqR (Table 1) and 18SF/18SR, 12.5 �lof SYBR green quantitative RT-PCR (qRT-PCR) mix (Bio-Rad, USA),and 2.5 �l of 10-fold-diluted cDNA. Quantitative PCR (qPCR) conditionswere 3 min at 95°C for enzyme activation and 40 cycles of 15 s at 95°C, 15s at 58°C, and 15 s at 72°C. An additional step that started at 60 andincreased to 95°C (0.2°C s�1) was performed to establish the denaturationcurve specific for each amplified sequence. Each point was replicated intriplicate, and the average threshold cycle (CT) value was taken. Subse-quently, relative quantification (RQ) of the target gene, where RQ is equalto 2(���CT), was calculated by the software of a StepOne cycler fromApplied Biosystems, USA.

Cloning and sequence analysis of AfPXG gene. The full-length openreading frame (ORF; 873 bp) of the AfPXG-like gene was amplified byPCR using A. flavus cDNA. For the further purification of AfPXG, primersAfPXG.NHis and AfPXG.CHis were designed to add a His tag at the N andC terminal ends of the AfPXG gene, respectively (Table 1). The purifiedAfPXG PCR product was ligated to the pGEM-T Easy vector (Promega,USA) following the instructions in the manufacturer’s manual, resultingin pGEM-T/AfPXG. The recombinant plasmid pGEM-T/AfPXG wastransferred into E. coli TOP10 competent cells. pGEM-T/AfPXG plasmidswere extracted from E. coli TOP10 cells using a plasmid purification mini-kit (Qiagen, Germany). The presence of the AfPXG gene in the isolatedplasmid was confirmed by PCR and BamHI-HindIII digestion. Bothstrands of at least three clones of the AfPXG gene were sequenced on anABI 310 genetic analyzer (Applied Biosystems) using primers T7 and SP6and a BigDye Terminator kit (Applied Biosystems). Nucleotide sequenceanalysis and multiple-sequence alignment of the nucleotide and deduced

amino acid sequences were performed with Vector NTI Advance software(Invitrogen).

Expression of recombinant AfPXG protein. AfPXG was subclonedinto the yeast constitutive expression vector pVT102U (42) usingthe BamHI-HindIII site. The correct recombinant plasmid,pVT102U/AfPXG, was then introduced into the yeast Saccharomycescerevisiae Wa6 (ade his7-2 leu2-3 leu2-112 ura3-52) (43). Expression ofrecombinant AfPXG in transformed yeast cells was carried out as de-scribed by Hanano et al. (30). The microsomes of the recombinant yeastswere resuspended in 10 mM potassium phosphate (pH 8) containing 10%(vol/vol) glycerol and were treated with Emulphogene (final concentra-tion, 0.2%) for 45 min at 4°C. The mixture was centrifuged at 100,000 �g for 2 h.

Solubilization and purification of recombinant AfPXG. All the sub-sequent steps were performed on ice (4°C). The oleosomes of recombi-nant yeasts resuspended in 10 mM potassium phosphate (pH 8) contain-ing 10% (vol/vol) glycerol were treated separately with differentdetergents (CHAPS {3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate}, Triton X-100, Emulphogene; Sigma) at a final con-centration of 0.2% (vol/vol) for 45 min. The mixture was then centrifugedat 100,000 � g for 45 min. After centrifugation, the supernatant was taken,the concentration of the solubilized proteins was estimated by the Brad-ford assay (39), and enzymatic activity was determined. The solubilizedfraction was used in the protein purification procedure. The His-taggedAfPXG present in the supernatant was purified on an Ni-nitrilotriaceticacid Superflow column (Qiagen) under native (nondenaturing) condi-tions, according to the manufacturer’s instructions. The purity of therecombinant protein was confirmed by 12% SDS-PAGE, followed byCoomassie blue staining. For Western blot experiments, proteins werefractionated by 12% SDS-PAGE and electrotransferred to Immobilon-Pmembranes (Millipore Corp., Bedford, MA) using a mini-Transblottransfer cell apparatus (Bio-Rad). For detection of PXG-His, a mousemonoclonal anti-His antibody and an anti-mouse immunoglobulin anti-body conjugated to peroxidase were used at 1:2,000. Blots were developedusing an enhanced chemiluminescence kit from Pierce.

Replacement of the PXG-like gene by an Hygr gene. The replacementof the PXG-like gene by the hygromycin resistance (Hygr) gene was car-ried out as described by Ninomiya et al. (44). The 5= and 3= flanking DNA(�1 kb) of the PXG-like gene was amplified by PCR using the genomicDNA of A. flavus FSS63 as a template. The primers used for the amplifi-cation of the 5= or 3= flanking DNA were primers P1 and P2 or primers P3and P4, respectively (Table 1). The Hygr gene was amplified by PCR usingthe binary vector pCAMBIA1381 (http://www.cambia.org/daisy/cambia/585.html) (GenBank accession number AF234302) as a template andprimers P5 and P6. The three PCR products were mixed and used as atemplate in a fusion PCR (45). The fusion PCR product was analyzed onan agarose gel (1%) and used for transformation of the protoplasts of theA. flavus FSS63 wild type.

Design of siRNAs. Two siRNAs that targeted the mRNA sequenceof the PXG-like gene of A. flavus (GenBank accession numberXM_002382445), named siRNAPXG1 and siRNAPXG2,were designedonline by the use of Block-iT RNAi Designer software (Life Technologies)and purchased from VBC-Biotech (Austria). The primers used to detectthese siRNAs are provided in Table 1. An siRNA control (siRNACt) withno sequence homology to the A. flavus genome in any sequence databasewas also purchased from the same company.

Preparation of fungal protoplast and transformation. Protoplastswere prepared from fungal conidia as described by Cheng and Belanger(46) with some modifications. Briefly, 7-day-old cultures of A. flavus wereobtained on PDA plates. The expected conidia (about 1 � 108 conidia perplate) were harvested and then washed with sterile water. The spores weresuspended in 20 ml of a solution of 25 mM L-mercaptoethanol and 5 mMNa2EDTA, pH 8.0, under gentle shaking for 20 min at room temperature.The treated spores were collected by centrifugation for 5 min at 5,000 rpm,and the pellets were resuspended and incubated for 2 h at 25°C in 5 ml of

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6131Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

digestion buffer (10 mM Na2HPO4, 1.2 M MgSO4, 10 mg ml�1 lysozyme;Sigma-Aldrich). The protoplasts were purified by filtration through asmall mass of cotton (about 2 cm3) and then harvested by centrifugationat 5,000 rpm for 15 min at 4°C. The resulting pellets were washed twicewith 5 ml STC buffer (1 M sorbitol, 50 mM CaCl2, 50 mM Tris-HCl, pH8). Finally, the protoplasts were resuspended in 1 ml of STC buffer anddivided into 50-�l aliquots. Delivery of siRNA to the protoplast was car-ried out in sterile 1.5-ml microcentrifuge tubes, 10 �l of each siRNA wasmixed with an equal volume of Lipofectin reagent (Invitrogen Life Tech-nologies, United Kingdom), and the mixture was allowed to stand for 15min at 20°C. A volume of 50 �l of protoplasts was added, and the com-ponents were gently mixed. The tubes were incubated at 20°C for 24 h toallow transfection to proceed (47). Then, the mixture was inoculated in 10ml of PD medium with 1.2 M sorbitol for 7 days at 28°C in the dark.Different dilutions of siRNA (25, 50, 100 nM) were tested on A. flavus. Asimilar treatment of protoplasts without siRNA or with nonspecificsiRNA was performed as a negative control. All experiments were carriedout using three biological replicates. For replacement of the PXG-likegene, a solution (5 �l) containing 10 �g DNA of the fusion PCR productwas mixed with 50 �l of protoplasts, and the mixture was incubated on icefor 5 min. Forty microliters of the mixture was transferred to an electro-porator cell (BTX Electro Cell Manipulation 600; Genetronics) andshocked by using a charging voltage of 1.5 kV and a resistance of 186 .After the electroshock, 1 ml of PD medium containing 1.2% sucrose wasadded and the conidia were incubated at 30°C for 2 h. The solution (200�l) was spread on agar medium containing hygromycin B (500 �g ml�1).Colonies resistant to hygromycin were isolated and tested by PCR usingprimers P1 and P6. Southern blotting was used to confirm whether thecolonies contained extra copies of the Hygr gene.

Biomass and conidium number measurements. The fungal biomassof 7-day-old cultures on PDA plates was determined. The transformantsor the control strain was inoculated at a single point on a cellophanemembrane placed on the surface of a PDA plate. Seven days later, themembranes were removed and the corresponding mycelial mats werecollected, thoroughly washed twice with distilled water, filtered throughWhatman no. 4 filter papers, and dried overnight in an oven at 95°C.Mycelial dry weights were then determined as described by Rasooli andRazzaghi-Abyaneh (48). Fungal growth inhibition (in percent) was calcu-lated according to the following formula: [(total control weight � totalsample weight)/total control weight] � 100. In parallel, the total conidiawere harvested from each plate and placed in 5 ml of water containing0.01% Tween 80. The conidia were diluted to 1:10 and counted with ahemocytometer.

Extraction, cleanup, and HPLC analysis of aflatoxin. One milliliterof the conidial suspension (1 � 106 spores ml�1) generated from A. flavuswas cultivated on petri plates containing PDA. The plates were incubatedat 28°C for 7 days. The total growth of the fungi was collected to extract theaflatoxins (AFs). The extraction of AFs produced by A. flavus was carriedout as described by Bertuzzi et al. (49) by placing the A. flavus fungi in 100ml of chloroform and rotating the mixture on a rotary shaker for 1 h. Thecleanup of the extract was done as described previously (50) using a thin-layer chromatography (TLC) plate. Extracted AF samples were spottedonto a C18 reversed-phase TLC plate (aluminum sheets, 20 by 20 cm,200-�m layer; Merck, Germany), and the chromatogram was developedusing a solvent system of chloroform-acetone (90:10, vol/vol). After de-velopment, the spot with an Rf value similar to that of the AFB1 standardwas scraped and then reextracted with chloroform and evaporated todryness under nitrogen. The extract was resuspended with 100 �l aceto-nitrile and stored in an amber-colored vial under refrigeration. Extractswere analyzed using a Jasco LC-2000 Plus series HPLC system (Jasco,USA), a fluorescence detector (excitation , 247 nm; emission , 480 nm;RF-10Axl; Shimadzu), and a C18 column (150 by 4.6 mm; particle size, 5�m; column temperature, 53°C; Eclipse XDB-C18; Agilent, USA). Theanalysis was performed using a mobile phase of water-methanol-acetoni-trile (50:40:10, vol/vol/vol) at a flow rate of 0.8 ml min�1 and a run time of

10 min. To study the time course of aflatoxin production in the strains inwhich AfPXG was silenced and with different treatments, aflatoxin pro-duction was evaluated at 2, 5, 7, 9, 11, and 13 days after inoculation.

SOD and CAT enzymatic activities. Preparation of the fungal tissuesfor determination of enzyme activities was carried out as described previ-ously (51), with some modification. Briefly, 5 g of fungal tissues was ho-mogenized with 5 ml potassium phosphate buffer (pH 7.5) containing 1mM EDTA, 3 mM DL-dithiothreitol, and 5% (wt/vol) insoluble polyvinyl-polypyrrolidone on ice. Subsequently, the homogenate was centrifuged at12,000 rpm for 5 min, and the supernatant was used for analysis of theenzymatic activities. Superoxide dismutase (SOD) activity was assayed bymeasuring its ability to inhibit the photochemical reduction of nitrobluetetrazolium (NBT) as described by Beauchamp and Fridovich (52). Cat-alase (CAT) activity was measured by the method of Azevedo et al. (53).Activity was determined by monitoring the decrease in absorbance due toH2O2 reduction at 240 nm for 2 min.

Complementation of strains in which AfPXG was silenced with PXGpathway oxylipins. C18:2 oxylipins derived from the LOX-PXG pathwaywere biosynthesized in three separate steps. In the first step, hydroperox-ides 9-HPOD and 13-HPOD were prepared by incubation of C18:2 with9-LOX and 13-LOX from tomato and soybean, respectively, as describedpreviously (54, 55). In the second step, two possible forms of epoxide,9,10-epoxy-12(Z)-octadecenoic acid (9,10-EOE) and 12,13-epoxy-9(Z)-octadecenoic acid (12,13-EOE), were produced from linoleic acid by in-cubation of radiolabeled C18:2 (50 �Ci/mmol in ethanol) overnight at26°C in the presence of 50 �g of purified recombinant AfPXG and 10 �l ofcumene hydroperoxide (20 mM). Reaction, extraction, and purificationof epoxides were carried out as described by Hanano et al. (30). Finally,the purified epoxides resulting from the second step were hydrolyzed totheir corresponding dihydroxy compounds, 9,10-dihydroxy-12(Z)-octa-decenoic acid (9,10-DHOE) and 12,13-dihydroxy-9(Z)-octadecenoicacid (12,13-DHOE). The hydrolysis of epoxides can take place chemicallyin acidic solution (pH 5.5). Then, the dihydroxy compounds were ex-tracted, purified, and analyzed as described by Summerer et al. (56). Anethanol solution of 100 �M containing a mix of epoxides (mix-EOE) ordihydroxy compounds (mix-DHOE) was added to the liquid cultures ofthe (�) siRNAPXG1 strain in a 500-ml Erlenmeyer flask containing 100ml of PD broth for 2 days at 28°C. To maximize any possible effects ofthese oxylipins on mutant growth, the mutant was first fed on PD brothcontaining a mix of 9-hydroxyoctadecadienoic acid (HOD) and 13-HOD(100 �M each) for 5 days at 28°C. Subsequently, a known quantity offungal growth was then transferred onto petri dishes containing PDAsupplemented with the oxylipins indicated below and allowed to developfor 5 days at 28°C. Six transformants of A. flavus were examined for theirresponses to each oxylipin. In parallel, the control experiment was carriedout using ethanol only.

Inoculation of maize seeds with A. flavus and biomass estimation. Aquantity of 100 g of maize (Zea mays) was sterilized by emerging maizegrains into 70% ethanol for 1 min. After they were dried, the grains wereplace in a sterile petri plate and directly inoculated with 200 �l of a liquidculture of A. flavus in PD broth. The inoculated grains were incubated at28°C for 7 days. Fungal biomass was estimated on day 7 by careful washingof the infected grains, filtration, and then weighing of the fungal growth,expressed as the number of grams (fresh weight) per 100 g of grains.

Statistical analysis. All data presented are expressed as means � stan-dard deviations (SDs). Comparisons between control and treated strainswere evaluated by the t test. The difference from the control was consid-ered significant when P was �0.05, very significant when P was �0.01, andhighly significant when P was �0.001.

Nucleotide sequence accession numbers. The sequences of the ITSregion and the AfPXG gene of A. flavus were submitted to GenBank andmay be found under accession numbers KC621105 and KJ668859, respec-tively.

Hanano et al.

6132 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

RESULTSAspergillus flavus contains a single caleosin gene-like gene.When the sequence of the Arabidopsis thaliana At4g26740 gene,encoding the first characterized caleosin/peroxygenase (30), wascompared with the sequence of the Aspergillus flavus NNRL 3357genome by BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi),it presented about 50% identity with the A. flavus AFLA_002850gene. The DNA sequence of this gene, which has no biologicalfunctions known so far (57), contains an ORF of 873 nucleotidesencoding a putative calcium-binding protein. Primers designedon the basis of the AFLA_002850 gene sequence (primers AfPXGFand AfPXGR; Table 1) were used to clone a homologous genefrom toxigenic isolate A. flavus FSS63. An open reading frame of873 nucleotides encoding a polypeptide of 291 amino acids (Gen-Bank accession number KJ668859) was identified in the clonedgene. Multiple-sequence alignment of the protein sequences re-vealed that this fungal protein has a high degree of similarity(67%) with Arabidopsis caleosins (Fig. 1A). As expected for a ca-leosin, AFLA_002850 contains an EF-hand calcium-binding sitemotif near its N terminus and several putative phosphorylationsites in the C terminus (58). Like some plant caleosins, it lacksmost of the conserved proline residues in the central hydrophobic

region initially postulated to be essential for caleosin anchoring inmembranes (59) (Fig. 1B), raising questions about the location ofthe protein in fungal cells (60). Besides the Ca2�-binding site, twohistidine residues crucial for plant peroxygenase activity are pres-ent in the AFLA_002850 primary sequence, suggesting that thisfungal protein might also act as an enzyme. However, comparedto the sequences of Arabidopsis caleosins, both the N terminus andC terminus of AFLA_002850 are extended by additional motifs(Fig. 1A and C) that might impede substrate entrance and thusprevent peroxygenase activity.

AFLA_002850 is a peroxygenase. To test whether the fungalcaleosin-like enzyme possesses peroxygenase activity, AFLA_002850was expressed in yeast. As demonstrated for recombinant plant per-oxygenases, crude extracts of yeast expressing AFA_002850 efficientlycatalyzed the sulfoxidation of thiobenzamide (32.8 nmol min�1

mg�1 protein), the hydroxylation of aniline (24.6 nmol min�1

mg�1), and the epoxidation of oleic acid (36.2 nmol min�1 mg�1)in the presence of cumene hydroperoxide (Fig. 2A). No enzymaticactivity was observed in the fractions isolated from yeast trans-formed with an empty vector (Fig. 2A).

When yeast crude extracts were subfractionated by differentialcentrifugations, only membrane fractions, i.e., microsomes and

FIG 1 Structural features of AfPXG. (A) Multiple-sequence alignment of the deduced amino acids of the protein isolated from A. flavus (GenBank accessionnumber KJ668859) with the A. thaliana proteins AtPXG1 (At4g26740), AtPXG2 (At5g55240), AtPXG3 (At2g33380), and AtPXG4 (At1g70670). The boxeddomain (residues 62 to 97) corresponds to an EF-hand motif, and the underlined residues between residues 75 and 86 correspond to the Ca2�-binding domain.A star indicates the position of histidine 86, responsible for heme binding; an inverted triangle indicates a phosphorylation site; hyphens indicate absent residues;dark gray shading indicates similarity; light gray shading with lighter text indicates identity; light gray shading with darker text indicates a conservative residue;black text with a white background indicates nonsimilar residues. (B) Orientation and location of structural and functional domains. (C) Predicted three-dimensional structure of the putative caleosin (AFLA_00280). The virtual image was generated online using http://www.sbg.bio.ic.ac.uk/phyre2.

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6133Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

6134 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

lipid droplets, showed catalytic activity, while the supernatantfraction did not show activity (Fig. 2A). Since addition of the Histag to the N terminus or the C terminus of the protein did notmodify its oxidative ability (not shown), we attempted to purify aHis-tagged protein. Lipid droplet proteins were first solubilized(about 45%) with 0.2% Emulphogene, and then the solubilizedenzymatic fraction (representing 85% of the total activity presentin the lipid droplets) was purified by affinity chromatography onan Ni2� column with a purification factor of 9.2 (Table 2). Whenanalyzed by SDS-PAGE, the purified fraction showed one majorsingle band at 32 kDa with a degree of purity higher than 98%when estimated by scanning densitometry (Fig. 2B). The purifiedfraction catalyzed the oxidation of thiobenzamide (1.55 �molmin�1 mg�1 of protein), aniline (1.24 �mol min�1 mg�1 of pro-tein), and oleic acid (2.1 �mol min�1 mg�1 of protein) in thepresence of cumene hydroperoxide as a cosubstrate. The heat-inactivated fraction was unable to catalyze such reactions. Thesedata strongly suggest that peroxygenase activity is associated withthe 32-kDa membrane-bound protein (Fig. 2C).

In Arabidopsis, such peroxygenase activity was assigned to aheme prosthetic group presumably bound to a histidine residue ofthe active site of the caleosin (30). The preservation of this aminoacid in the primary structure of AFLA_002850 suggested that thefungal protein may also contain a heme group (Fig. 1A). Analysisof the light absorption spectra revealed a peak at 407 nm repre-sentative of the Soret band of hemoproteins. Addition of 1 mMcumene hydroperoxide resulted in a gradual decrease of the Soretband (Fig. 2D) that was correlated with a decline in the amount ofhydroperoxide-supported oxidation by the fungal caleosin-likeprotein. Both the decrease in the absorbance at 407 nm and en-zyme inactivation followed pseudo-first-order kinetics (Fig. 2E),in agreement with the presence of heme in AFLA_002850 actingas a prosthetic group. Moreover, the oxidative ability ofAFLA_002850 was totally abolished by the addition of 1 mM -mercaptoethanol and 3 mM terbufos, which act as competitiveand suicide inhibitors of plant PXGs, respectively (30) (Fig. 2F).Taken together, these results indicate that AFLA_002850 has sev-eral features similar to those of plant peroxygenases. The enzy-matic activity of Arabidopsis thaliana PXG1 (AtPXG1) requires

calcium. To verify that A. flavus caleosin also requires the presenceof Ca2� to function as a peroxygenase, we performed extensivedialysis of this protein against the chelating agent EDTA to removeany trace of metal. This treatment completely abolished the co-oxidative properties of AFLA_002850, which were restored (up to78.5%) by adding 1 mM CaCl2 to the medium (Fig. 2G). Thus,calcium appears to be crucial for the structure and/or the activityof the A. flavus caleosin-like protein. Together these results favor aperoxygenase identity for AFLA_002850, and we have proposed toname this gene AfPXG (GenBank accession number KJ668859).

AfPXG efficiently metabolizes linoleic acid and its 13-hy-droperoxide derivative. AfPXG catalyzed the oxidation ofmonounsaturated fatty acids (Fig. 3A). However, most of theoxylipins so far identified in pathogenic fungi derive from li-noleic acid (24). To examine whether polyunsaturated fattyacids are also substrates, 14C-labeled C18 fatty acids with one tothree double bonds were incubated with recombinant AfPXGin the presence of cumene hydroperoxide, H2O2, 9-HPOD, and13-HPOD, and their metabolization was followed by TLC cou-pled with radiodetection. Linoleic acid was efficiently epoxi-dized by AfPXG followed by linolenic acid, whereas incomparison, only weak epoxidation of oleic acid was observedregardless of the hydroperoxide used. The most active cosub-strates were the fatty acid hydroperoxides followed by H2O2. Incontrast, cumene hydroperoxide poorly promoted the epoxi-dation of unsaturated fatty acids (Fig. 3A).

Next, the metabolism of fatty acid hydroperoxides in the presenceof the purified recombinant AfPXG was analyzed by HPLC (with UVdetection). After 2 h of incubation, only 20% of the 13-HPOD and42% of the 9-HPOD remained intact (peaks 1 and 2, respectively, inFig. 3B and C, panels I). Peak 3 and peak 4 were identified to be thealcohol products 13-HOD and 9-HOD, respectively, by coelutionwith standards (Fig. 3B and C, panels II). No metabolites were de-tected from incubations of 9-HPOD and 13-HPOD with heat-inac-tivated AfPXG (Fig. 3B and C, panels III). These data indicate thatrecombinant AfPXG may preferably metabolize linoleic acid and its13-hydroperoxide.

AfPXG is highly expressed in the early stage of spore germi-nation. Plant caleosins/peroxygenases are present in seeds but also

FIG 2 Biochemical characterization of recombinant AfPXG. (A) PXG activities as the sulfoxidation of thiobenzamide (light gray), the hydroxylation of aniline(dark gray), and the epoxidation of [1-14C]oleic acid (black) were measured in the crude extract, supernatant, lipid droplets, and microsomes of recombinantyeasts containing plasmid pVT102U ligated with the AfPXG insert. Results are means � SDs (n � 3). (B) SDS-PAGE analysis of purified AfPXG. The purity ofthe recombinant protein was confirmed by SDS-12% PAGE, followed by Coomassie blue staining (right) and detection of PXG-His by anti-His antibody and ananti-mouse immunoglobulin antibody conjugated to peroxidase (left). Numbers to the left and right of the gels are molecular masses (in kilodaltons). (C) Specificactivities of the purified recombinant AfPXG. (D) Sequential scanning of the absolute spectrum of AfPXG obtained on addition of cumene hydroperoxide overthe indicated times (in minutes). (E) Correlation between the hydroxylation activity of the purified AfPXG and the disappearance of the heme content. (F)Inhibition of native AfPXG by treatment with -mercaptoethanol (1 mM) or terbufos (3 mM). (G) Co-oxidation activities for native purified AfPXG and for theCa2�-deionized AfPXG after extensive dialysis and for AfPXG after dialysis followed by the addition of 1 mM CaCl2 to the medium. All data are the means � SDs(n � 3).

TABLE 2 Representative purification of oleosomal recombinant AfPXGa

FractionVol(ml)

Total activity (nmolmin�1)

Amt of protein(mg [%])

Sp act (nmol min�1

mg�1)Purificationfactor

Oleosomes 4 655.6 4.8 (100) 136.5 1Solubilized fraction 8 558.4 2.1 (43.7) 265.9 1.9Purified AfPXG 2 2,016.8 1.6 (33.3) 1,260.5 9.2a Recombinant AfPXG was solubilized in the presence of 0.2% Emulphogene for 45 min at 4°C. His-tagged AfPXG was purified by affinity chromatography on an Ni2� column.The activity was measured with 1 mM aniline in the presence of 1 mM cumene hydroperoxide at 310 nm.

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6135Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

FIG 3 Peroxygenase activities of the purified recombinant AfPXG. (A) Co-oxidation of radiolabeled polyunsaturated fatty acids in the presence of cumenehydroperoxide (CuOOH), hydrogen peroxide (H2O2), 9-hydroperoxy-10,12-octadecadienoic acid (9-HPOD), or 13-hydroperoxy-9,11-octadecadienoic acid(13-HPOD). 14C-labeled substrates metabolized by purified recombinant AfPXG were separated by TLC and analyzed by radiodetection. C18:1, oleic acid; C18:2,linoleic acid; C18:3, linolenic acid. *, P � 0.05; **, P � 0.01; ***, P � 0.001. Different lowercase letters indicate significant differences (P � 0.05) for the fatty acidsused. (B and C) UV-HPLC analysis of the metabolization of fatty acid hydroperoxides by purified AfPXG. (I) Products formed after 2 h of incubation at 27°C of13-HPOD or 9-HPOD by AfPXG; (II) 13-HOD or 9-HOD standards; (III) 13-HPOD or 13-HPOD incubated with heat-inactivated AfPXG. 9-HPOD and13-HPOD did not differ in their ability to co-oxidize the reactions when the difference was analyzed by the t test. This FAOOH reduction capacity wassignificantly different from that measured in the presence of H2O2 and cumene hydroperoxide when analyzed by the t test.

Hanano et al.

6136 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

in vegetative tissues, where they play distinct physiological roles.To examine whether AfPXG was constitutively expressedthroughout the fungal life cycle or whether it was induced duringparticular phases of development, we evaluated AfPXG expressionand AfPXG enzymatic activity in conidia, germinated spores, veg-etative mycelium, and the conidiophore stage. The AfPXG tran-scription level was first evaluated by RT-PCR, and it level of ex-pression was compared to that of the 18S rRNA gene, which wasused as a reference. The accumulation of the AfPXG transcript wasundetectable in the mature (nongerminated) conidia of A. flavus(time zero; Fig. 4A). The transcription of AfPXG was activated inthe early stage of conidial germination (1 day after inoculation),and the level of the AfPXG transcript reached its maximal levelafter 2 days. The accumulation of AfPXG transcripts was reducedin the vegetative mycelium stage (days 4 and 5). Only low levels ofAfPXG accumulated in the conidiophore stage (days 6 and 7).Variations in the expression of AfPXG during development wereconfirmed by quantitative real-time RT-PCR analysis (Fig. 4B).AfPXG enzymatic activity was also assessed by measuring its ca-pacity to oxidize the aniline of microsomal fractions isolated fromthe different developmental stages of A. flavus. Maximal peroxy-genase activity was measured (168.2 nmol min�1 mg�1 of pro-tein) with microsomes isolated from germinated spores (day 2).Lower levels of enzymatic activity were found in microsomes iso-lated from vegetative mycelium and conidiophores (Fig. 4B). Insummary, these results indicate that both the activation of AfPXGexpression and the peroxygenase activity of the AfPXG-encodedprotein were maximal in the early stages of conidium germinationof A. flavus.

The replacement of PXG by Hygr dramatically affects A. fla-vus development. Using fusion PCR, we deleted the PXG-likegene by creating DNA fragments carrying Hygr with �1-kb 5= and3=flanking sequences from the A. flavus PXG-like gene. The fusionPCR products were introduced into the protoplast of A. flavus

FSS63, and hygromycin-resistant colonies were isolated. The pres-ence of the Hygr gene or the absence of the AfPXG gene in thegenomic DNA of the transformant was confirmed by PCR (datanot shown). In parallel, Hygr transformants were screened bySouthern hybridizations, and approximately 65% of the transfor-mants showed a pattern diagnostic for the replacement of PXG byHygr (data not shown). We therefore use the abbreviationAfPXG� to indicate this replacement. We examined the AfPXG�strain for growth, sporulation, and aflatoxin production. Thegrowth of the AfPXG� strain was dramatically decreased, its bio-mass did not exceed 20% of that of the wild-type strain, and itfailed to produce any remarkable spores after 7 days of culture. Noexpression of AfPXG was detected by qPCR, and no AfPXG activ-ity was measured in the AfPXG� strain. These results for biomassand sporulation did not change after 14 days of culture (data notshown). Due to the dramatic effects on fungal developmentcaused by the deletion of AfPXG, we next silenced AfPXG via asmall interfering RNA (siRNA) approach to obtain putative inter-mediate phenotypes.

AfPXG expression is silenced by siRNA. Modifying the ex-pression of a given gene is a powerful strategy to access biolog-ical functions. We therefore attempted to reduce AfPXG ex-pression by the siRNA approach. The success of this strategywas evaluated by quantitative RT-PCR analysis and confirmed

FIG 4 The transcriptional level of AfPXG and the enzymatic activity of PXG ofA. flavus are dependent on A. flavus development. (A) AfPXG transcriptionallevel detected by RT-PCR at different stages of fungal development (the 18SrRNA gene was used as a reference). The numbers at the top are days of culture.(B) AfPXG expression and the AfPXG-specific hydroxylation activity of anilinein the microsomal fraction prepared from conidia, germinated spores, myce-lium, and conidiophores. The measurements were done in triplicate. Valuesare the means � SDs (n � 3).

FIG 5 Efficiency of silencing of AfPXG at the gene transcript and enzymaticactivity levels. (A) Two siRNAs specific for PXG, siRNAPXG1 andsiRNAPXG2 (Table 1), were delivered to the protoplast via the Lipofectin reagentat various concentrations. Treatment of the protoplasts without (�) siRNA orwith nonspecific control siRNA, (�) siRNACt, used as a negative control, wasperformed. AfPXG transcripts were quantified by qRT-PCR. (B) AfPXG activ-ities were measured by sulfoxidation of thiobenzamide (light gray), hydroxy-lation of aniline (dark gray), and epoxidation of oleic acid (black). Values aremeans � SDs (n � 3). The activities of lines in which AfPXG was silenceddiffered significantly from those of the control when analyzed by the t test(*, P � 0.05; **, P � 0.01).

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6137Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

by measuring the enzymatic activity of AfPXG in the micro-somal fractions isolated from strains in which AfPXG was si-lenced. The primers designed to be specific for the two siRNAssiRNAPXG1 and siRNAPXG2 differed in efficacy, with theprimer specific for siRNAPXG1 being the most effective (Table1). For example, compared to the results for the control strain,only 8% of the AfPXG transcript accumulated after the addi-tion of 100 nM the primer specific for siRNAPXG1, whereasdouble that amount of gene expression was retained after theaddition of the same concentration of the primer specific forsiRNAPXG2 (Fig. 5A). Similarly, compared to the peroxyge-nase activity in the control strain, peroxygenase activities weremore affected in the (�) siRNAPXG1 strain than in the (�)siRNAPXG2 strain (Fig. 5B). Thus, the siRNA strategy resultedin low levels of AfPXG peroxygenase activity linked to the effi-cient reduction of AfPXG expression in the treated strains.

AfPXG silencing leads to fatty acid hydroperoxide accumu-lation. To examine whether AfPXG metabolized fatty acid hy-droperoxides in the fungus like the recombinant protein did in

vitro (see above), we first quantified the total hydroperoxide(ROOH) content present in the tissues of fungal strains in whichAfPXG was silenced and the control strain. Hydroperoxide levelstripled and doubled in the (�) siRNAPXG1 and (�) siRNAPXG2strains, respectively, compared to the level in the control (data notshown). The rise in the amount of ROOH was mostly due to theaccumulation of fatty acid hydroperoxides, with the levels of 13-HPOD being higher than those of 9-HPOD in the two strains inwhich AfPXG was silenced (Fig. 6). Notably, the correspondingalcohol, 13-HOD, was present in WT A. flavus but was not bedetected in the lines carrying siRNAPXG. These results are inagreement with a functional fatty acid hydroperoxide reductaseactivity supported by AfPXG in A. flavus.

Silencing of AfPXG reduces fungal biomass and leads to in-hibition of conidial formation. The most striking visual effect of

FIG 6 Repression of AfPXG expression resulted in hydroperoxide accumula-tion. The 9-HPOD and 13-HPOD contents in the tissues of the WT strain andstrains in which AfPXG was silenced were analyzed. Each point represents theresult of triplicate measurements. Values are means � SDs (n � 3). The resultfor each line in which AfPXG was silenced was significantly different from thatfor the WT (*, P � 0.05; **, P � 0.01; ***, P � 0.001). fw, fresh weight.

FIG 7 Phenotypes of strains in which AfPXG was silenced. (A) Phenotypes of the (�) siRNAfPXG1 and (�) siRNAfPXG2 strains compared with the phenotypeof the (�) siRNACt control strain on PDA cultures. Cultures were carried out at 28°C for 7 days. (B) Evaluation of number of conidia and biomass in strains inwhich AfPXG was silenced and the control strain. The measurements were done in triplicate. Values are means � SDs (n � 3). The number of conidia from eachline in which AfPXG was silenced was significantly different from that for the WT when analyzed by the t test (*, P � 0.05; **, P � 0.01).

TABLE 3 Dry weight of A. flavus mycelium in relation to AfPXGsilencing before and after treatment with exogenous oxylipins

A. flavus strain or strain andtreatment

Mean � SD mycelium wt(g DW per plate)a CVb

Strain(�) siRNACt 3.61 � 0.034 0.96(�) siRNAPXG1 1.13 � 0.014c 1.23(�) siRNAPXG2 1.43 � 0.026c 1.81

Strain and treatmentWT without oxylipins 3.73 � 0.042 1.12(�) siRNAPXG1 without oxylipins 1.15 � 0.023 2.00(�) siRNAPXG1 with 9-HOD 1.86 � 0.024d 1.29(�) siRNAPXG1 with 13-HOD 2.07 � 0.020d 0.96(�) siRNAPXG1 with mix-EOE 1.31 � 0.032 2.44(�) siRNAPXG1 with mix-HOE 1.24 � 0.030 2.41

a Mean weight for fungal growth on six separate plates (n � 6) on day 7 afterinoculation. DW, dry weight.b CV, coefficient of variation, which was calculated as (standard deviation of the weight/mean weight) � 100.c The mycelium weight for each silenced strain was significantly different from that forthe WT (P � 0.05).d The mycelium weight for treated strain (�) siRNAPXG1 was significantly differentfrom that for the WT (P � 0.05).

Hanano et al.

6138 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

silencing of AfPXG was the poor fitness of the resulting strainscompared to the fitness of the control. For example, only thinmycelia developed from the (�) siRNAPXG1 strain, with the my-celium weight representing about 30% of the mycelium weight ofthe control (Fig. 7A and B). Moreover, development of this strainwas blocked at the reproductive stage because it failed to formconidia. The phenotypes were also attenuated in the (�)siRNAPXG2 strain. Its mycelial weight was still reduced comparedto that of the control (it had about half of the mycelium weight ofthe control), but this strain was able to form conidia, although theconidia were 7-fold less numerous than they were in the control(Fig. 7B; Table 3). Thus, silencing of AfPXG resulted in a dramaticdecrease of the growth of the transformed strains and a signifi-cantly reduced capacity to undergo conidiogenesis.

Silencing of AfPXG leads to poor production of AFB1. Wenext examined the effect of silencing of AfPXG on the productionof aflatoxin B1 (AFB1). A. flavus FSS63 generated a unique peakcoinciding with that of the AFB1 standard when analyzed by

HPLC coupled with fluorescence detection (Fig. 8A, peak 2). Byusing a standard curve established with known concentrations ofAFB1, about 13 �g ml�1 of AFB1 was recovered from cultures ofthe control strain, siRNACt (Fig. 8A, inset). Silencing of AfPXGdecreased the concentration of AFB1 by a factor of about 6 on day7 after inoculation (Fig. 8A), suggesting a role of AfPXG in afla-toxin accumulation. The result for this one time point was con-firmed by evaluating the time course of AFB1 production by theline in which AfPXG was silenced in comparison with that by thewild type (Fig. 8B).

To determine at what stage of the aflatoxin biosynthetic chainAfPXG was acting, we analyzed the expression of two crucial genes.The first one, aflD (alternatively named nor-1), intervenes in the earlysteps of aflatoxin biosynthesis when the first stable aflatoxin norsol-orinic acid intermediate is converted into averantin. The second gene,aflR, is a regulatory gene involved in transcriptional activation ofmost of the structural genes. Expression of both genes was stronglyrepressed (by up to a factor of 51) in both strains in which AfPXG was

FIG 8 Aflatoxigenicity was affected in strains in which AfPXG was silenced. (A) HPLC analysis of the aflatoxin B1 produced by wild-type A. flavus and A. flavusstrains in which AfPXG was silenced (peaks 1, 3, 4, and 6, 25, 10, 5, and 1 ng ml�1 of standard AFB2, respectively). (Inset) Quantification of AFB1 in the (�)siRNAfPXG2 and (�) siRNAfPXG1 (open circles) strains compared to AFB1 standard (closed circles). (B) Time course of AFB1 production in strains in whichAfPXG was silenced. AFB1 was extracted and analyzed on days 2, 5, 7, 9, 11, and 13 after inoculation, as described in Materials and Methods. (C) Silencing ofAfPXG downregulated aflR and aflD expression. Each point represents the result of triplicate measurements. Values are means � SDs (n � 3). Asterisks indicatesignificant differences in gene expression between strains in which AfPXG was silenced and the control strain (*, P � 0.05; **, P � 0.01).

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6139Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

silenced and the control strain (Fig. 8C). Thus, silencing of AfPXGcontributes to a reduction in the expression of aflatoxin biosyntheticgenes and, therefore, toxin accumulation.

Silencing of AfPXG enhances ROS-degrading enzyme activ-ities. Aflatoxin biosynthesis is stimulated under stress oxidativeconditions that provoke reactive oxygen species (ROS) accumu-lation (61). To evaluate whether silencing of AfPXG modified thefungal ROS status, we measured A. flavus superoxide dismutase(SOD) and catalase (CAT) activities. These two enzymes controlO2

� and H2O2 accumulation, respectively, in cells. SOD activitywas stimulated by factors of 3 and 2 in strains (�) siRNAPXG1and (�) siRNAPXG2, respectively, compared to its activity in theWT. CAT activity was similarly induced and doubled in the twostrains, respectively, compared to its activity in the WT (Fig. 9).These data suggest that silencing of AfPXG leads to enhanced ROSscavenging activities that probably result in reduced ROSaccumulation in the transformed strains.

Oxylipins derived from the AfPXG pathway restore pheno-types in which AfPXG is silenced. To investigate whether pheno-types resulting from silencing of AfPXG were specifically due toAfPXG peroxygenase activity, we tried to complement strains inwhich AfPXG was silenced chemically using oxylipins derivedfrom AfPXG metabolization of C18:2 and C18:2 fatty acid hydroper-oxides. Thus, the (�) siRNAPXG1 strain was cultivated in thepresence of 100 �M 9-HOD, 13-HOD, mix-EOE [9,10-epoxy-12(Z)-octadecenoic acid and 12,13-epoxy-9(Z)-octadecenoicacids], or mix-HOE [9,10-dihydroxy-12(Z)-octadecenoic acid,12,13-dihydroxy-9(Z)-octadecenoic acid, 9,12,13-trihydroxy-11-octadecenoic acid, and 9,10,13-trihydroxy-12-octadecenoic acid].In particular, the level of restoration of the mycelium growth ofstrain (�) siRNAPXG1 was about 50% of that of the control when9-HOD and 13-HOD were added (Fig. 10A and B; Table 3). Inaddition, conidiation was significantly reestablished (up to 60%compared to that in the wild type) in the strains in which AfPXGwas silenced if they were grown in the presence of these fatty acidalcohols but far less (about 20%) when they were grown in thepresence of mixtures of epoxides or di- and trihydroxylated deriv-atives (Fig. 10C). Moreover, oxylipins generated by AfPXG re-stored aflatoxigenicity in strain (�) siRNAPXG1. Compared tothe level of transcription in the WT, addition of 13-HOD resultedin the recovery of up to 90% of the level of aflD transcription and80% of the level of aflR transcription. 9-HOD, mix-EOE, andmix-HOE were less effective (Fig. 10D and E). As a consequence,AFB1 production was stimulated in the strains in which AfPXGwas silenced and that were grown in the presence of 13-HOD (upto 70% compared to the level of AFB1 production in the wildtype), and AFB1 production was stimulated to a lesser extent bythe other oxylipins (Fig. 10F). The restoration of AFB1 productionin strains in which AfPXG was silenced reached a peak on day 7after inoculation, and its maximal level was observed when theywere complemented with 13-HOD compared to the levelsachieved when they were complemented with other oxylipins (Fig.10G). Of note, we observed that feeding of the AfPXG� strain witha mixture of 9- and 13-HOD similarly restored the growth, conidi-ation, and AFB1 production of the null mutant (data not shown).Together, these results indicate that the oxylipins generated byAfPXG are able to complement phenotypes resulting from alter-ation of the expression of AfPXG.

Silencing of AfPXG limits maize seed infection by A. flavus.Finally, we investigated whether strains in which AfPXG was si-

lenced were still able to colonize maize seeds. Compared to thelevel of plant colonization by the WT A. flavus strain grown onmaize seeds for 7 days, the (�) siRNAPXG1 strain exhibited poorplant colonization (Fig. 11A). Both mycelial mass and aflatoxinaccumulation were reduced by a factor of 40 compared to themycelial mass of and the level of aflatoxin accumulation by theWT (Fig. 11B). These data strongly suggest that AfPXG is crucialfor the successful infection of maize seeds by A. flavus.

DISCUSSIONCharacteristics of AfPXG. We identified and characterized a fun-gal caleosin-like protein as a peroxygenase and consequently as-cribe a new branch to the oxylipin pathway present in Aspergillusflavus. Similarly to plant caleosins, the enzymatically active AfPXGwas found to be bound to the endoplasmic reticulum and lipiddroplets when expressed in yeast. Ppo enzymes have also beendetected in lipid droplets (62), suggesting that this organelle mightbe a major site for oxylipin biosynthesis in fungi. However, themode of anchorage of AfPXG remains to be clarified because, likeclass II caleosins, it does not possess the canonical proline knotpresumed to be crucial for targeting to lipid droplets (33).

AfPXG activity is pivotal for fungal development. Arabidopsispossesses at least seven isoforms of caleosins (58). Each of themfulfills a distinct function linked to its catalytic activity (30, 33). Incontrast, AfPXG is a monocopy gene in A. flavus and might playmultiple roles in fungal biology. Silencing of this gene severelyaffected and reduced fungal growth, conidium production, andaflatoxin accumulation. The restrained vegetative growth of thestrains in which AfPXG was silenced could partly result from adefect in spore germination, a developmental stage where the geneexpression and enzymatic activity of the fungal caleosin were attheir highest levels in wild-type A. flavus. Because the caleosinATS1 (63) was shown to control the germination of seeds by af-fecting the degradation of their lipid reserves (64), it can be pos-tulated that AfPXG might similarly promote spore germination bystimulating the metabolism of some spore reserve in the fungus.

FIG 9 Silencing of AfPXG enhanced antioxidant activities. SOD and CATactivities were measured in the strainsin which AfPXG was silenced and theWT strain. SOD activity was assayed by measuring its ability to inhibit thephotochemical reduction of nitroblue tetrazolium (NBT). CAT activity wasmeasured by monitoring the decrease in absorbance due to H2O2 reduction at240 nm for 2 min. Each point represents the result of triplicate measurements.Values are means � SDs (n � 3). Asterisks indicate significant differencesbetween the enzymatic activities of each line in which AfPXG was silenced andthe control (*, P � 0.05; **, P � 0.01).

Hanano et al.

6140 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

FIG 10 The phenotypes of strains in which AfPXG was silenced were due to peroxygenase activity. Addition of 100 �M 9-HOD, 13-HOD, mix-EOE (mono- ordiepoxides), or mix-HOE (di- or trihydroxy compounds) to the (�) siRNAPXG1 strain restored fungal development. (A) Morphology and appearance of fungalgrowth on PDA medium; (B) mycelium dry weight; (C) conidium formation; (D and E) relative expression of aflD (D) and aflR (E) expression. (F) Aflatoxin B1production. Controls (the WT strain and strains in which AfPXG was silenced) were treated with ethanol. (G) The production of AFB1 in the treatments over time(2, 5, 7, 9, 11, and 13 days [d] after inoculation). Treatments and measurements were done in triplicate. Values are means � SDs (n � 9). Asterisks indicatesignificant differences between treatment with each exogenous oxylipin and the control treatment (*, P � 0.05; **, P � 0.01; ***, P � 0.001).

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6141Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Alternatively, most of the A. flavus phenotypes observed when wedeleted or silenced AfPXG might result from the alteration of theexpression of other oxylipin biosynthetic enzymes, such as lipoxy-genase or Ppo (62). In favor of this hypothesis, similar phenotypesfor growth, conidiogenesis, and aflatoxin biosynthesis have beenreported for the A. flavus lox1 (Aflox1) mutant devoid of an Mn-dependent lipoxygenase (65). However, whether these symptomswere due to the action of FAOOHs per se or that of oxylipin prod-ucts derived from further FAOOH degradation was not deter-mined. In disagreement with this hypothesis is the restoration ofthe wild-type phenotypes in the strains altered in AfPXG expres-sion by AfPXG-derived oxylipins, which are not substrates ofLOXs or Ppo. Moreover, deletion of AfPXG resulted in the arrestof fungal growth at as early as 2 days when the induction of Ppowas not accomplished (17).

Our data rather suggested that the physiological deficiencies oflines in which AfPXG was silenced and probably those of theAflox1 mutant resulted from the lack of production of oxylipins byAfPXG. Among them, FAOHs were more active in restoring thephenotypes of strains in which AfPXG was silenced than fatty acidepoxides and/or the di- and trihydroxylated derivatives. SuchFAOHs were recently found to modulate reactive oxygen speciesaccumulation in plants (32). For example, deletion of an FAOH-producing caleosin in Arabidopsis thaliana resulted in the accu-mulation of the corresponding hydroperoxide precursors, whichwas correlated with a low cellular oxidative status under physio-

logical conditions. It is tempting to make a parallel with the fungalsituation. We showed here that the alteration of AfPXG expressionresulted in the accumulation of linoleic acid-derived hydroperox-ides and to an increase in the activities of antioxidative enzymes,leading to low levels of ROS production. These data would ex-plain, at least in part, the functioning of the fungal caleosin inaflatoxin production. Indeed, it was previously reported that 13-HPOD represses aflatoxin biosynthesis when added to Aspergilluscultures, whereas 9-HPOD lengthens the time during which afla-toxin transcripts accumulate (26). Thus, endogenous accumula-tion of both 13-HPOD and 9-HPOD in strains in which AfPXGwas silenced might account for the poor accumulation of AFB1.On the other hand, the biosynthesis of aflatoxin is favored underconditions with high levels of ROS and silencing of AfPXG mini-mized ROS accumulation in fungal tissues. Thus, the combinedeffects of low levels of ROS and high levels of FAOOH productionmight account for the reduced production of aflatoxin in linesaltered in AfPXG expression. This result would be in accordancewith the findings of previous studies suggesting that the fungal cellresponds to incomplete scavenging of reactive oxygen species atthe intracellular level by producing toxins (61). Alternatively, re-strained conidium and aflatoxin production in lines in which Af-PXG was silenced might also result from the limited growth of thetransformed fungus.

Aspergillus species produce aflatoxins at a time that coincideswith spore development (66). In A. nidulans, these processes areregulated by G-protein signaling pathway components (67). Like-wise, deletion of one subunit of the heterotrimeric G-proteincomplex in A. flavus yielded an aconidial, aflatoxin-null pheno-type for the resulting strain (66). Plant caleosin has been found tolink to the G-protein component (68). Thus, at present, we cannotexclude the possibility that fungal caleosin and the oxylipins de-rived from it act by modulating the G-protein signaling pathway,resulting in an alteration of fungal development and, therefore,mycotoxin production.

Implication of AfPXG pathway in interactions between A.flavus and plant seeds. The incapacity of lines in which AfPXGwas silenced to develop on maize seeds contrasts with the findingsfor Aflox1 strains, which, surprisingly, recovered the ability toform conidia and aflatoxin when inoculated onto viable corn ker-nels (65). It was thus presumed for the Aflox1 mutant that theoxylipins released by seeds induce the activation of secondary me-tabolite synthesis and fungal morphological changes (27, 65). Ac-cordingly, it was earlier shown that the addition of 13-HPOD and9-HPOD caused an increase in conidial development in A. flavus(24). Because the seed oxylipins closely resemble psi factors instructure, it was hypothesized that the sporogenic effect of the seedoxylipins could take place through interference and/or mimickingof psi factors (66).

Our results, identifying a fungal caleosin using plant fatty acidhydroperoxides as the substrates, make the story more complex.Accordingly, the lack of recovery of conidiogenesis and aflatoxinproduction of the strains in which AfPXG was silenced in thepresence of maize seeds might be due to their inability to generateactive fungal FAOHs from the fatty acid hydroperoxides releasedby the maize seed lipoxygenase. This assumption would explainwhy conidiation and the production of aflatoxin were drasticallyreduced in Zmlox3 mutant fungi with a 9-LOX deletion infectingkernels (69). Similarly, this hypothesis would also explain howoxylipins generated by ZmLOX3 cloned in an aconidial �ppoAC

FIG 11 Impact of silencing of AfPXG on maize seed colonization by A. flavus.(A) Maize seeds infected with a wild-type A. flavus strain (left) or strain (�)siRNAPXG1 (right). After sterilization, grains were place in a sterile petri plateand directly inoculated with a 200 �l of a liquid culture of A. flavus in PD broth.The photograph was taken at 7 days after infection. (B) Estimation of themycelium weight and level of aflatoxin B1 accumulation in the (�)siRNAPXG1 and WT strains on day 7 after infection of maize seeds. Asterisksindicate significant differences between the strains in which AfPXG was si-lenced and the wild type (**, P � 0.01).

Hanano et al.

6142 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

mutant of A. nidulans are able to restore the capacity of this mu-tant to produce conidia (27). Intriguingly, the growth of strainswith AfPXG (Fig. 11) and Aflox1 (65) was not rescued when theyinfected maize kernels. These results point to a specificity of fungaloxylipins for the control of A. flavus mass that act independentlyof the pathogenic process. In conclusion, by identifying a noveloxylipin enzyme, our data underline the importance of plant-likehydroxy fatty acid derivatives in fungal development and patho-genesis possibly through the control of oxidative status.

ACKNOWLEDGMENTS

We thank I. Othman, director general of AECS, and N. MirAli, head of theMolecular Biology and Biotechnology Department, for their support. Wealso kindly thank John Mansfield, Imperial College of London, and PeterLamont from the Ecology Department of Scottish Marine Institute,United Kingdom, for their precious help in critical reading of the manu-script.

REFERENCES1. Andreou A, Brodhun F, Feussner I. 2009. Biosynthesis of oxylipins in

non-mammals. Prog Lipid Res 48:148 –170. http://dx.doi.org/10.1016/j.plipres.2009.02.002.

2. Blee E. 1998. Phytooxylipins and plant defense reactions. Prog Lipid Res37:33–72. http://dx.doi.org/10.1016/S0163-7827(98)00004-6.

3. Funk CD. 2001. Prostaglandins and leukotrienes: advances in eicosanoidbiology. Science 294:1871–1875. http://dx.doi.org/10.1126/science.294.5548.1871.

4. Shah J. 2005. Lipids, lipases, and lipid-modifying enzymes in plant diseaseresistance. Annu Rev Phytopathol 43:229 –260. http://dx.doi.org/10.1146/annurev.phyto.43.040204.135951.

5. Trienens M, Rohlf M. 2012. Insect-fungus interference competition—the potential role of global secondary metabolite regulation, pathway-specific mycotoxin expression and formation of oxylipins. Fungal Ecol5:191–199.

6. Shea JM, Del Poeta M. 2006. Lipid signaling in pathogenic fungi. CurrOpin Microbiol 9:352–358. http://dx.doi.org/10.1016/j.mib.2006.06.003.

7. Sakuradani E, Ando A, Ogawa J, Shimizu S. 2009. Improved productionof various polyunsaturated fatty acids through filamentous fungus Mor-tierella alpina breeding. Appl Microbiol Biotechnol 84:1–10. http://dx.doi.org/10.1007/s00253-009-2076-7.

8. Su C, Oliw EH. 1996. Purification and characterization of linoleate 8-di-oxygenase from the fungus Gaeumannomyces graminis as a novel hemo-protein. J Biol Chem 271:14112–14118. http://dx.doi.org/10.1074/jbc.271.24.14112.

9. Alem MA, Douglas LJ. 2005. Prostaglandin production during growth ofCandida albicans biofilms. J Med Microbiol 54:1001–1005. http://dx.doi.org/10.1099/jmm.0.46172-0.

10. Hamberg M. 1986. Isolation and structures of lipoxygenase productsfrom Saprolegnia parasitica. Biochim Biophys Acta 876:688 – 692. http://dx.doi.org/10.1016/0005-2760(86)90059-7.

11. Matsuda Y, Satho T, Beppu T, Arima K. 1976. Purification and prop-erties of Co2� requiring heme protein having lipoxygenase activity fromFusarium oxysporum. Agric Biol Chem 40:963–976. http://dx.doi.org/10.1271/bbb1961.40.963.

12. Champe SP, el-Zayat AA. 1989. Isolation of a sexual sporulation hor-mone from Aspergillus nidulans. J Bacteriol 171:3982–3988.

13. Mazur P, Meyers HV, Nakanishi K, El-Zayat AAE, Champe SP. 1990.Structural elucidation of sporogenic fatty acid metabolites from Aspergil-lus nidulans. Tetrahedron Lett 31:3837–3840. http://dx.doi.org/10.1016/S0040-4039(00)97482-3.

14. Mazur P, Nakanishi K, Elzayat AAE, Champe SP. 1991. Structure andsynthesis of sporogenic psi factors from Aspergillus nidulans. J Chem SocChem Commun 20:1486 –1487.

15. Tsitsigiannis DI, Kowieski TM, Zarnowski R, Keller NP. 2004. Endog-enous lipogenic regulators of spore balance in Aspergillus nidulans. Eu-karyot Cell 3:1398 –1411. http://dx.doi.org/10.1128/EC.3.6.1398-1411.2004.

16. Hornsten L, Su C, Osbourn AE, Garosi P, Hellman U, Wernstedt C,Oliw EH. 1999. Cloning of linoleate diol synthase reveals homology with

prostaglandin H synthases. J Biol Chem 274:28219 –28224. http://dx.doi.org/10.1074/jbc.274.40.28219.

17. Tsitsigiannis DI, Kowieski TM, Zarnowski R, Keller NP. 2005. Threeputative oxylipin biosynthetic genes integrate sexual and asexual develop-ment in Aspergillus nidulans. Microbiology 151:1809 –1821. http://dx.doi.org/10.1099/mic.0.27880-0.

18. Tsitsigiannis DI, Kunze S, Willis DK, Feussner I, Keller NP. 2005.Aspergillus infection inhibits the expression of peanut 13S-HPODE-forming seed lipoxygenases. Mol Plant Microbe Interact 18:1081–1089.http://dx.doi.org/10.1094/MPMI-18-1081.

19. Reverberi M, Punelli F, Scarpari M, Camera E, Zjalic S, Ricelli A,Fanelli C, Fabbri AA. 2010. Lipoperoxidation affects ochratoxin A bio-synthesis in Aspergillus ochraceus and its interaction with wheat seeds.Appl Microbiol Biotechnol 85:1935–1946. http://dx.doi.org/10.1007/s00253-009-2220-4.

20. Calvo AM, Gardner HW, Keller NP. 2001. Genetic connection betweenfatty acid metabolism and sporulation in Aspergillus nidulans. J BiolChem 276:25766 –25774. http://dx.doi.org/10.1074/jbc.M100732200.

21. Tsitsigiannis DI, Keller NP. 2006. Oxylipins act as determinants of nat-ural product biosynthesis and seed colonization in Aspergillus nidulans.Mol Microbiol 59:882– 892. http://dx.doi.org/10.1111/j.1365-2958.2005.05000.x.

22. Jayashree T, Subramanyam C. 2000. Oxidative stress as a prerequisite foraflatoxin production by Aspergillus parasiticus. Free Radic Biol Med 29:981–985. http://dx.doi.org/10.1016/S0891-5849(00)00398-1.

23. Mahoney N, Molyneux RJ. 2010. Rapid analytical method for thedetermination of aflatoxins in plant-derived dietary supplement and cos-metic oils. J Agric Food Chem 58:4065– 4070. http://dx.doi.org/10.1021/jf9039028.

24. Calvo AM, Hinze LL, Gardner HW, Keller NP. 1999. Sporogenic effectof polyunsaturated fatty acids on development of Aspergillus spp. ApplEnviron Microbiol 65:3668 –3673.

25. Doehlert DC, Wicklow DT, Gardner HW. 1993. Evidence implicatingthe lipoxygenase pathway in providing resistance to soybeans againstAspergillus flavus. Phytopathology 83:1473–1477. http://dx.doi.org/10.1094/Phyto-83-1473.

26. Burow GB, Nesbitt TC, Dunlap J, Keller NP. 1997. Seed lipoxygenaseproducts modulate Aspergillus mycotoxin biosynthesis. Mol Plant Mi-crobe Interact 10:8.

27. Brodhagen M, Tsitsigiannis DI, Hornung E, Goebel C, Feussner I,Keller NP. 2008. Reciprocal oxylipin-mediated cross-talk in the Aspergil-lus-seed pathosystem. Mol Microbiol 67:378 –391. http://dx.doi.org/10.1111/j.1365-2958.2007.06045.x.

28. Prost I, Dhondt S, Rothe G, Vicente J, Rodriguez MJ, Kift N, CarbonneF, Griffiths G, Esquerre-Tugaye MT, Rosahl S, Castresana C, HambergM, Fournier J. 2005. Evaluation of the antimicrobial activities of plantoxylipins supports their involvement in defense against pathogens. PlantPhysiol 139:1902–1913. http://dx.doi.org/10.1104/pp.105.066274.

29. Blee E, Wilcox AL, Marnett LJ, Schuber F. 1993. Mechanism of reactionof fatty acid hydroperoxides with soybean peroxygenase. J Biol Chem 268:1708 –1715.

30. Hanano A, Burcklen M, Flenet M, Ivancich A, Louwagie M, Garin J,Blee E. 2006. Plant seed peroxygenase is an original heme-oxygenase withan EF-hand calcium binding motif. J Biol Chem 281:33140 –33151. http://dx.doi.org/10.1074/jbc.M605395200.

31. Blee E. 2002. Impact of phyto-oxylipins in plant defense. Trends Plant Sci7:315–322. http://dx.doi.org/10.1016/S1360-1385(02)02290-2.

32. Blee E, Boachon B, Burcklen M, Le Guedard M, Hanano A, Heintz D,Ehlting J, Herrfurth C, Feussner I, Bessoule JJ. 2014. The reductaseactivity of the Arabidopsis caleosin responsive to dessication20 mediatesgibberellin-dependent flowering time, abscisic acid sensitivity, and toler-ance to oxidative stress. Plant Physiol 166:109 –124. http://dx.doi.org/10.1104/pp.114.245316.

33. Blee E, Flenet M, Boachon B, Fauconnier ML. 2012. A non-canonicalcaleosin from Arabidopsis efficiently epoxidizes physiological unsaturatedfatty acids with complete stereoselectivity. FEBS J 279:3981–3995. http://dx.doi.org/10.1111/j.1742-4658.2012.08757.x.

34. White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics, p 315–322.In PCR protocols: a guide to methods and applications. Academic Press,Inc., New York, NY.

35. Godet M, Munaut F. 2010. Molecular strategy for identification in Asper-

Fungal Caleosin/Peroxygenase

September 2015 Volume 81 Number 18 aem.asm.org 6143Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from

gillus section Flavi. FEMS Microbiol Lett 304:157–168. http://dx.doi.org/10.1111/j.1574-6968.2009.01890.x.

36. Klich MA, Mullaney EJ. 1987. DNA restriction enzyme fragment poly-morphism as a tool for rapid differentiation of Aspergillus flavus fromAspergillus oryzae. Exp Mycol 11:170 –175. http://dx.doi.org/10.1016/0147-5975(87)90002-8.

37. Ferreira de Oliveira JM, van Passel MW, Schaap PJ, de Graaff LH. 2010.Shotgun proteomics of Aspergillus niger microsomes upon D-xylose in-duction. Appl Environ Microbiol 76:4421– 4429. http://dx.doi.org/10.1128/AEM.00482-10.

38. Record E, Asther M, Moukha S, Marion D, Burlat V, Ruel K. 1998.Localization of a phosphatidylglycerol/phosphatidylinositol transfer pro-tein in Aspergillus oryzae. Can J Microbiol 44:945–953. http://dx.doi.org/10.1139/w98-092.

39. Bradford MM. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal Biochem 72:248 –254. http://dx.doi.org/10.1016/0003-2697(76)90527-3.

40. Blee E, Durst F. 1987. Hydroperoxide-dependent sulfoxidation catalyzedby soybean microsomes. Arch Biochem Biophys 254:43–52. http://dx.doi.org/10.1016/0003-9861(87)90079-8.

41. Blee E, Schuber F. 1990. Efficient epoxidation of unsaturated fatty acidsby a hydroperoxide-dependent oxygenase. J Biol Chem 265:12887–12894.

42. Vernet T, Dignard D, Thomas DY. 1987. A family of yeast expressionvectors containing the phage f1 intergenic region. Gene 52:225–233. http://dx.doi.org/10.1016/0378-1119(87)90049-7.

43. Schiestl RH, Gietz RD. 1989. High efficiency transformation of intactyeast cells using single stranded nucleic acids as a carrier. Curr Genet16:339 –346. http://dx.doi.org/10.1007/BF00340712.

44. Ninomiya Y, Suzuki K, Ishii C, Inoue H. 2004. Highly efficient genereplacements in Neurospora strains deficient for nonhomologous end-joining. Proc Natl Acad Sci U S A 101:12248 –12253. http://dx.doi.org/10.1073/pnas.0402780101.

45. Kuwayama H, Obara S, Morio T, Katoh M, Urushihara H, Tanaka Y.2002. PCR-mediated generation of a gene disruption construct withoutthe use of DNA ligase and plasmid vectors. Nucleic Acids Res 30:E2. http://dx.doi.org/10.1093/nar/30.2.e2.

46. Cheng Y, Belanger RR. 2000. Protoplast preparation and regenerationfrom spores of the biocontrol fungus Pseudozyma flocculosa. FEMS Mi-crobiol Lett 190:287–291. http://dx.doi.org/10.1111/j.1574-6968.2000.tb09300.x.

47. Whisson SC, Avrova AO, Van West P, Jones JT. 2005. A method fordouble-stranded RNA-mediated transient gene silencing in Phytophthorainfestans. Mol Plant Pathol 6:153–163. http://dx.doi.org/10.1111/j.1364-3703.2005.00272.x.

48. Rasooli I, Razzaghi-Abyaneh M. 2004. Inhibitory effects of thyme oils ongrowth and aflatoxin production by Aspergillus parasiticus. Food Control15:479 – 483. http://dx.doi.org/10.1016/j.foodcont.2003.07.002.

49. Bertuzzi T, Rastelli S, Mulazzi A, Pietri A. 2011. Evaluation and im-provement of extraction methods for the analysis of aflatoxins B1, B2, G1and G2 from naturally contaminated maize. Food Anal Methods 5:512–519.

50. Shannon GM, Shotwell OL, Kwolek WF. 1983. Extraction and thin layerchromatography of aflatoxin B1 in mixed feeds. J Assoc Off Anal Chem66:582–586.

51. Zhang B, Zhang H, Jin J, Ni Y, Chen J. 2012. PCDD/Fs-inducedoxidative damage and antioxidant system responses in tobacco cell sus-pension cultures. Chemosphere 88:798 – 805. http://dx.doi.org/10.1016/j.chemosphere.2012.03.085.

52. Beauchamp C, Fridovich I. 1971. Superoxide dismutase: improved assaysand an assay applicable to acrylamide gels. Anal Biochem 44:276 –287.http://dx.doi.org/10.1016/0003-2697(71)90370-8.

53. Azevedo RA, Alas RM, Smith RJ, Lea PJ. 1998. Response of antioxidantenzymes to transfer from elevated carbon dioxide to air and ozone fumi-

gation, in the leaves and roots of wild-type and a catalase-deficient mutantof barley. Physiol Plant 104:280 –292. http://dx.doi.org/10.1034/j.1399-3054.1998.1040217.x.

54. Gardner HW, Grove MJ, Keller NP. 1998. Soybean lipoxygenase is activeon nonaqueous media at low moisture: a constraint to xerophilic fungiand aflatoxins? J Am Oil Chem Soc 75:1801–1808. http://dx.doi.org/10.1007/s11746-998-0334-y.

55. Lie M, Pasha K. 1998. Fatty acids, fatty acid analogues and their deriva-tives. Nat Prod Rep 15:607– 629. http://dx.doi.org/10.1039/a815607y.

56. Summerer S, Hanano A, Utsumi S, Arand M, Schuber F, Blee E. 2002.Stereochemical features of the hydrolysis of 9,10-epoxystearic acid cata-lysed by plant and mammalian epoxide hydrolases. Biochem J 366:471–480. http://dx.doi.org/10.1042/BJ20011778.

57. Payne WGA, Dean RA, Nierman WC, Amedeo P, Caler EGA, FedorovaND, Maiti R, Joardar V, Inman J, Galinsky KJ, Yu J, Bhatnagar D,Cleveland TE. 2007. Genome sequence of Aspergillus flavus strain NRRL3357. Submitted (04-SEP-2007) to the INSDC. J. Craig Venter Institute,Rockville, MD.

58. Murphy DJ. 2001. The biogenesis and functions of lipid bodies in animals,plants and microorganisms. Prog Lipid Res 40:325– 438. http://dx.doi.org/10.1016/S0163-7827(01)00013-3.

59. Kim YY, Jung KW, Yoo KS, Jeung JU, Shin JS. 2011. A stress-responsivecaleosin-like protein, AtCLO4, acts as a negative regulator of ABA re-sponses in Arabidopsis. Plant Cell Physiol 52:874 – 884. http://dx.doi.org/10.1093/pcp/pcr039.

60. Abell BM, Holbrook LA, Abenes M, Murphy DJ, Hills MJ, MoloneyMM. 1997. Role of the proline knot motif in oleosin endoplasmic reticu-lum topology and oil body targeting. Plant Cell 9:1481–1493. http://dx.doi.org/10.1105/tpc.9.8.1481.

61. Reverberi M, Zjalic S, Ricelli A, Punelli F, Camera E, Fabbri C, PicardoM, Fanelli C, Fabbri AA. 2008. Modulation of antioxidant defense inAspergillus parasiticus is involved in aflatoxin biosynthesis: a role for theApyapA gene. Eukaryot Cell 7:988 –1000. http://dx.doi.org/10.1128/EC.00228-07.

62. Tsitsigiannis DI, Zarnowski R, Keller NP. 2004. The lipid body protein,PpoA, coordinates sexual and asexual sporulation in Aspergillus nidulans.J Biol Chem 279:10.

63. Nuccio ML, Thomas TL. 1999. ATS1 and ATS3: two novel embryo-specific genes in Arabidopsis thaliana. Plant Mol Biol 39:1153–1163. http://dx.doi.org/10.1023/A:1006101404867.

64. Poxleitner M, Rogers SW, Lacey Samuels A, Browse J, Rogers JC. 2006.A role for caleosin in degradation of oil-body storage lipid during seedgermination. Plant J 47:917–933. http://dx.doi.org/10.1111/j.1365-313X.2006.02845.x.

65. Scarpari M, Punelli M, Scala V, Zaccaria M, Nobili C, Ludovici M,Camera E, Fabbri AA, Reverberi M, Fanelli C. 2014. Lipids in Aspergillusflavus-maize interaction. Front Microbiol 5:74. http://dx.doi.org/10.3389/fmicb.2014.00074.

66. Calvo AM, Wilson RA, Bok JW, Keller NP. 2002. Relationship betweensecondary metabolism and fungal development. Microbiol Mol Biol Rev66:447– 459. http://dx.doi.org/10.1128/MMBR.66.3.447-459.2002.

67. Affeldt KJ, Brodhagen M, Keller NP. 2012. Aspergillus oxylipin signalingand quorum sensing pathways depend on G protein-coupled receptors.Toxins 4:695–717. http://dx.doi.org/10.3390/toxins4090695.

68. Khalil HB, Wang Z, Wright JA, Ralevski A, Donayo AO, Gulick PJ.2011. Heterotrimeric G� subunit from wheat (Triticum aestivum), GA3,interacts with the calcium-binding protein, Clo3, and the phosphoinosit-ide-specific phospholipase C, PI-PLC1. Plant Mol Biol 77:145–158. http://dx.doi.org/10.1007/s11103-011-9801-1.

69. Gao X, Shim WB, Göbel C, Kunze S, Feussner I, Meeley R, Balint-KurtiP, Kolomiets M. 2007. Disruption of a maize 9-lipoxygenase results inincreased resistance to fungal pathogens and reduced levels of contamina-tion with mycotoxin fumonisin. Mol Plant Microbe Interact 20:922–933.http://dx.doi.org/10.1094/MPMI-20-8-0922.

Hanano et al.

6144 aem.asm.org September 2015 Volume 81 Number 18Applied and Environmental Microbiology

on February 18, 2018 by guest

http://aem.asm

.org/D

ownloaded from