A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome...

50
A brief History of PCR Dr. Richard Molenkamp Medical Molecular Microbiologist

Transcript of A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome...

Page 1: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

A brief History of PCR

Dr. Richard Molenkamp Medical Molecular Microbiologist

Page 6: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Exponential amplification

Number of cycli on an agarose gel: 10 15 20 25 30 35 40

Page 7: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Early PCR

Addition of polymerase in each cycle

Breakthrough:

Thermostable (Taq) polymerase

Integrated Thermocyclers

Page 8: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Conventional PCR = End point analysis

no quantitative data

Real-time PCR

Page 9: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Sybrgreen reactions - Intercalating

fluorescence

DNA Target Sequence

Denaturation

Drawback: a-specifc product also fluoresent!

Page 10: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Sample block

Lens

Lens

Spectrograph

CCD camera

LASER

Dichrome

Mirror

MUX

Page 13: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Detection Formats (I)

Probe-based

- Taqman technology: specific double-dyed fluorescent hydrolysis probes

- FRET (Fluorescence Resonance Energy Transfer): hybridisation probes

- Partially double stranded, single-dyed, hybridisation probes

Novel Probe Technology: Partially Double-Stranded Linear DNA Probes

EmissionEmissionExcitationExcitation

R

Q

R

Q

RR

– Long target-specific probe with fluor

– Short quencher probe

– Fluorescence quenched when probes

are hybridized

– Long probe preferentially binds target

– Short quencher probe is dissociated

– Fluorescence is detected

Page 17: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Novel Probe Technology: Partially Double-Stranded Linear DNA Probes

EmissionEmissionExcitationExcitation

R

Q

R

Q

RR

– Long target-specific probe with fluor

– Short quencher probe

– Fluorescence quenched when probes

are hybridized

– Long probe preferentially binds target

– Short quencher probe is dissociated

– Fluorescence is detected

Partially double stranded linear DNA

probes

Page 18: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Probe free: MultiCode technology (I)

MultiCode Base Pair

(isoC:isoG)

Scott C etal, Nucl. Ac. Res. 2004 Iso G

Iso C

Page 19: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

MultiCode PCR (II)

Page 20: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

MultiCode technology

Page 21: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Ct / Cp / Cq

Calling

Page 22: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

PCR positivity measured at Cycle threshold (Ct)-level

Number of cycles

0 10 20 30

Flu

ore

scen

ce

10x SD background

Threshold Cycle

Background fluorescence

Ct calling I

Page 23: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

PCR positivity measured at Cycle threshold (Ct)-level

Number of cycles

0 10 20

30

Flu

ore

scen

ce

10x SD background

Threshold Cycle

Background fluorescence

Ct calling II

Page 24: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

PCR positivity measured 2nd derivative max.

Number of cycles

0 10 20 30

Flu

ore

scen

ce

Crossing point

Background fluorescence

Calculates 2nd derivative and

determines its maximum.

CP: Where the rate of

increase of

fluorescence is greatest

Cp calling I

Page 25: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

PCR positivity measured 2nd derivative max.

Number of cycles

0 10 20 30

Flu

ore

scen

ce

Cp calling II

Page 26: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Quantification

Page 27: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Quantification with real-time PCR

Page 28: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Principles of quantification –

real time PCR

Calculation of efficiency

Page 31: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Sequence variation

Influences design of PCR

PCR can be used to detect variation

Page 32: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

HIV-1 group M sequence variation in Gag and Pol genes

Page 33: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Influence of mismatches on

hybridization temperature

tgggaggttctctccagcactagcagg

Length 27 nt

GC content 60%

Tm 69 ºC

tgggaggttctctccagcactagcagg

a t

Tm 62.6 ºC

tgggaggttctctccagcactagcagg

a t a

Tm 57.8 ºC

Page 34: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

How to deal with sequence variation

Degenerate oligos GGTAYCCATGRTCAG

Dual target assay

Dual probe assay

IUB codes

R = A or G

Y = C or T

Page 35: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Dual target real time PCR

LTR Integrase

Genome HIV

5’- -3’

If there is a mutation in either of the primer/probe sites

the other PCR will ‘take over‘

Page 36: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Realtime PCR for detection of single

mutations

Conventional Sanger sequencing: ~25%

Sensitive methods:

LIPA/DNA microarray (hybridisation) 5-10%

Allele-specific PCR ~5%

Next generation sequencing (0.5% ?)

Quantitative real-time techniques: 1-10%

LNA/MGB probes (short high affinity probes)

Digital PCR

Page 37: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Probes used for detection of single

mutations (I)

Minor groove binding probes Locked nucleic acid probes

• Due to higher affinity binding shorter probes can be defined

• Taqman probes are 22-30 nt long; LNA/MGB probes 8-20 nt long

Page 38: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Hybridization temperature:

effect in MGB and LNA probes

GGAGG(+T)T(+C)TCT(+C)CAG(+C)A Length 17 nt

Tm 69 ºC

GGAGG(+T)T(+C)TCT(+C)CAG(+C)A

A Tm 59 ºC

tgggaggttctctccagcactagcagg

Length 27 nt

Tm 69 ºC

tgggaggttctctccagcactagcagg

a t Tm 62.6 ºC

tgggaggttctctccagcactagcagg

a t a Tm 57.8 ºC

Page 39: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Detection of oseltamivir resistant

influenza A/H1N1 H274Y

by real-time discrimination PCR using

LNA probes

NTC

+ control

+ controlNTC

+ control

+ control

Wild-type

cluster

Mutant

cluster

NA: 5’atcgaaaagggaaaggttactaaatcaatagagttaaatgcacccaattttCattatgaggaatgttcctgttacccagacactggc 3’

N1274Yfpr1

(30bp)

N1274Yrpr1

(24bp)

LNA:H274Y

T (mut)

LNA:H274H

(16bp)

Page 40: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Detection of lamivudine resistance

in HBV

Pas et al., Journal of Clinical Virology 32 (2005) 166–172

Page 41: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Effect of (enzyme) mastermix

on mismatch tolerance

Page 42: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Influence of mastermix on primer

bindingsite mismatch tolerance

> 50 different mutants Stadhouders et al., J. Mol. Diag., 2010

Page 43: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Primer bindingsite mismatch tolerance

Page 44: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Influence of mastermix on primer

bindingsite mismatch tolerance

MMLV / Taqgold

combination (ABI):

RT @ 48°C

Page 45: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Influence of mastermix on primer

bindingsite mismatch tolerance

rTth based mastermix:

RT@60°C

Page 47: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Principle of digital PCR (dPCR)

Limited dilution

0 0.368

1 0.368

2 0.184

3 0.061

4 0.015

5 0.003

>5 0.001

Poisson distribution

Page 49: A brief History of PCR Molenk… · Sample block Lens Lens Spectrograph CCD camera LASER Dichrome Mirror MUX. Amplification curves . Sybrgreen reactions – melting curve analysis

Applications of dPCR

Rare sequence / mutation detection (oncology, virology drug resistance)

Copy number quantification (standardisation controls)

Low level pathogen detection (in difficult samples)

Gene-expression (absolute quant. of (un)stimulated) gene expression)