A Blocking Antibody to Nerve Growth Factor Attenuates Skeletal Pain … · A Blocking Antibody to...

A Blocking Antibody to Nerve Growth Factor Attenuates Skeletal

Pain Induced by Prostate Tumor Cells Growing in Bone

Kyle G. Halvorson,1Kazufumi Kubota,

1Molly A. Sevcik,

1Theodore H. Lindsay,

1

Julio E. Sotillo,1Joseph R. Ghilardi,

1,2Thomas J. Rosol,

3Leila Boustany,

4

David L. Shelton,4and Patrick W. Mantyh

1,2

1Neurosystems Center and Departments of Diagnostic and Biological Sciences, Psychiatry, Neuroscience, and Cancer Center, University ofMinnesota; 2Research Service, Veteran’s Affairs Medical Center, Minneapolis, Minnesota; 3College of Veterinary Medicine andOffice of Research, The Ohio State University, Columbus, Ohio; and 4Rinat Neuroscience, Corp., Palo Alto, California

Abstract

Prostate cancer is unique in that bone is often the onlyclinically detectable site of metastasis. Prostate tumors thathave metastasized to bone frequently induce bone pain whichcan be difficult to fully control as it seems to be drivensimultaneously by inflammatory, neuropathic, and tumori-genic mechanisms. As nerve growth factor (NGF) has beenshown to modulate inflammatory and some neuropathic painstates in animal models, an NGF-sequestering antibody wasadministered in a prostate model of bone cancer wheresignificant bone formation and bone destruction occursimultaneously in the mouse femur. Administration of ablocking antibody to NGF produced a significant reduction inboth early and late stage bone cancer pain–related behaviorsthat was greater than or equivalent to that achieved withacute administration of 10 or 30 mg/kg of morphine sulfate.In contrast, this therapy did not influence tumor-inducedbone remodeling, osteoblast proliferation, osteoclastogenesis,tumor growth, or markers of sensory or sympatheticinnervation in the skin or bone. One rather unique aspect ofthe sensory innervation of bone, that may partially explainthe analgesic efficacy of anti-NGF therapy in relieving prostatecancer–induced bone pain, is that nearly all nerve fibersthat innervate the bone express trkA and p75, and these arethe receptors through which NGF sensitizes and/or activatesnociceptors. The present results suggest that anti-NGF therapymay be effective in reducing pain and enhancing the qualityof life in patients with prostate tumor–induced bone cancerpain. (Cancer Res 2005; 65(20): 9426-35)

Introduction

The most frequent presenting symptom of prostate metastasis tothe skeleton is bone pain (1). Pain originating from these bonymetastases usually increases in intensity with the evolution of thedisease and is commonly divided into three categories: ongoingpain, spontaneous breakthrough (incident) pain, and movement-evoked breakthrough pain (2, 3). Ongoing pain, which is the mostfrequent initial symptom of bone cancer, begins as a dull, constant,throbbing pain that increases in intensity with time and isexacerbated by use of involved portions of the skeleton (4). As bone

cancer progresses, intermittent episodes of extreme pain can occurspontaneously, or more commonly, after weight-bearing ormovement of the affected limb (4). Of these types of pain,breakthrough pain is the most difficult to control, as the dose ofopioids required to control this pain are usually significantlygreater than that needed to control ongoing pain and are oftenaccompanied by significant unwanted side effects such as sedation,somnolence, respiratory depression, and constipation (4, 5).In an effort to develop mechanism-based therapies that attenuate

bone cancer pain due to tumors, such as those from the prostate,which commonly metastasize to the skeleton and induce both boneformation and bone destruction, canine prostate tumor cells wereinjected and confined to the intramedullary space of the femur ofnude mice. Significant tumor-induced, pain-related behaviors werefirst observed at 9 days following injection of prostate tumor cellsand continued to increase until 19 days post injection, at whichtime the mice were euthanized. Similar to humans with skeletalpain due to prostate tumors that have metastasized to bone, therewas significant bone formation and bone destruction. This newlyformed ‘‘woven’’ bone tended to isolate individual tumor-bearingcompartments, which, when viewed radiologically, present thecharacteristic scalloped appearance seen in the bones of patientswith prostate tumor metastases to the skeleton (6).Previous studies have shown that nerve growth factor (NGF)

plays a significant role in the generation of pain and hyperalgesia ina variety of acute and chronic pain states in rodents (7–9). NGFexpression is enhanced in injured and inflamed tissue, where it isexpressed by activated macrophages and neutrophils which candirectly activate and/or sensitize primary afferent neurons thatexpress the NGF receptors, trkA and/or p75 (10, 11). NGF also hasbeen shown to induce hyperalgesia associated with mast celldegranulation (12). Previous studies have also suggested that NGFmay be involved in the survival and proliferation of some tumortypes (13). In the present report, we examine whether a blockingantibody to NGF may be therapeutically useful in attenuating bonepain, tumor growth, and tumor-induced bone remodeling due to aprostate tumor, which simultaneously induces significant boneformation and bone destruction.

Materials and Methods

Mice. Experiments were done on a total of 89 adult male athymic nude

mice (8-10 weeks old, Harlan Laboratories, Madison, WI), weighing 20 to32 g. The mice were housed in accordance with the NIH guidelines under

specific pathogen-free conditions in autoclaved cages maintained at 22jCwith a 12-hour alternating light and dark cycle and were given autoclavedfood and water ad libitum . All procedures were approved by the

Institutional Animal Care and Use Committee at the University of

Minnesota.

Requests for reprints: Patrick W. Mantyh, Department of Diagnostic andBiological Sciences, 18-208 Moos Tower, University of Minnesota, 515 DelawareStreet Southeast, Minneapolis, MN 55455. Phone: 612-626-0180; Fax: 612-626-2565;E-mail: [email protected].

I2005 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-05-0826

Cancer Res 2005; 65: (20). October 15, 2005 9426 www.aacrjournals.org

Research Article

Research. on November 4, 2020. © 2005 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

Culture and injection of tumor cells. Canine prostate carcinoma

(ACE-1, Dr. Thomas J. Rosol, Ohio State University) cells were maintained

and injections of tumor cells were done as previously described (14).

Following induction of general anesthesia with sodium pentobarbital (50

mg/kg, i.p.), an arthrotomy was done exposing the condyles of the distal

femur. Hank’s buffered sterile saline (20 AL, Sigma Chemical Co., St. Louis,

MO; sham, n = 7) or Hank’s containing 105 ACE-1 cells (20 AL, ACE-1,n = 60) was injected into the intramedullary space of the left mouse femur

and the injection site was sealed with dental amalgam (Dentsply, Milford,

DE), followed by irrigation with sterile filtered water. A 19-day post injection

end point was used, as this is the point when the tumor is still confined to

the bone and there is maximal presentation of cancer-related pain

behaviors and tumor-induced bone remodeling. Sham mice were used for

control analysis for behavioral experiments and bone histology/immuno-

histochemistry, as naı̈ve mice were not significantly different from sham,

both behaviorally or histologically, 9 days post tumor injection.

Characterization and treatment with anti–nerve growth factorantibody. Previously, the sequestering antibody, anti-NGF, (monoclonal

antibody 911, Rinat Neuroscience Corporation, Palo Alto, CA) was

characterized and shown to be effective in blocking the binding of NGFto the trkA and p75 NGF receptors and inhibiting trkA autophosphorylation

(15). Anti-NGF binds both human and rodent NGF, and does not bind to

other members of the neurotrophin family (15). Pharmacokinetic experi-

ments in rodents indicate a terminal half-life of 5 to 6 days in plasma afteri.v. injection in the mouse (16).

To assess the effect of the anti-NGF therapy on pain-related behaviors,

tumor growth, bone formation, and bone destruction, the anti-NGF

antibody was administered (three 10-mg/kg injections, i.p. at days 7, 12,and 17 post-sham or ACE-1 injection) when tumor-induced bone

remodeling was first evident ensuring a high concentration of antibody

through the duration of the study. As in previous experiments, using C3H/HeJ mice (14), the dose regime used in the present experiment caused no

adverse effects such as hypoalgesia in naı̈ve mice, as assessed by thermal

and mechanical sensitivity experiments. The general health of the mice was

closely monitored using food consumption and body weight as generalhealth indicators throughout the experiments.

Mice were randomly placed into treatment groups receiving either

injections of sterile saline (ACE-1 + vehicle, n = 21; 1.4 AL/kg, i.p.) or anti-NGF antibody, (ACE-1 + anti-NGF, n = 9; 10 mg/kg, i.p.). For behavioralcomparison of anti-NGF antibody to morphine sulfate, mice were given an

acute dose of morphine sulfate 15 minutes prior to behavioral testing

(naı̈ve, n = 6; sham, n = 7; ACE-1 + vehicle, n = 7; ACE-1 + anti-NGF, n = 7;

ACE-1 + morphine sulfate 10 mg/kg, s.c., n = 8; ACE-1 + morphine sulfate 30mg/kg, s.c., n = 8). For thermal and mechanical sensitivity testing and the

assessment of hindpaw skin innervation, naı̈ve mice were divided into two

treatment groups receiving either sterile saline (naı̈ve + vehicle, n = 8; threeinjections, i.p. at days 7, 12, and 17) or anti-NGF antibody (naı̈ve + anti-NGF,

n = 8; three 10-mg/kg injections, i.p. at days 7, 12, and 17).

Euthanasia and processing of tissue. Mice were euthanized and

perfused 19 days post tumor injection. Following radiologic examination,the femurs and hindpaw skin were processed for immunohistochemical

analysis as previously described (14, 17). Femoral sections were stained with

tartrate-resistant acid phosphatase (TRAP) and H&E to visualize the

histologic features of normal bone marrow, tumor, osteoclasts, osteoblasts,and macrophages. Skin sections were stained with antibodies raised against

calcitonin gene–related peptide (CGRP), neurofilament 200 (RT97), and

tyrosine hydroxylase (TH).Radiographical analysis of bone. Radiographs (Faxitron X-ray Corp.,

Wheeling, IL) of dissected femora were obtained at the day 19 end point to

assess the extent of bone formation and bone destruction. Images were

captured on Kodak Min-R 2000 mammography film (Eastman Kodak Co.,Rochester, NY; exposure settings: 7 seconds, 21 kVp). Analysis of bone

density was used to assess the extent of tumor-induced bone remodeling

radiographically of whole bone images at 5� magnification. Tumor and

non–tumor-bearing femurs (naı̈ve + vehicle, sham + vehicle, ACE-1+ vehicle,and ACE-1 + anti-NGF; n = 8 for each group) were analyzed using ImageJ

(Research Services Branch, National Institute of Mental Health, Bethesda,

MD) as previously described (18). Briefly, blank radiograph films and astandard step tablet (Eastman Kodak) were used to develop a calibration

curve. ImageJ was used to measure absorbance and subsequently converted

to transmission as follows: transmission = 1/[antilog10(Optical Density)].

Given data are determined from a negative image, transmission is directlyproportional to bone density. An HP ScanJet 7400c (Hewlett Packard, Palo

Alto, CA) scanner was used to capture subsaturation femoral radiographs

and readings were recorded in duplicate from each femora. Results are

presented as normalized transmission mean F SEM.Histologic analysis of osteoblasts, osteoclasts, and macrophages,

tumor growth and bone remodeling. Osteoblast proliferation was

analyzed by quantifying the number of osteoblasts in contact with regions

of both tumor-induced new bone formation contained within the femur and

cortical bone throughout the entire diaphyseal intramedullary space for

naı̈ve, sham-injected, and tumor-bearing mice. Diaphyseal intramedullary

space was defined as the area between the distal and proximal trabeculae

and was selected for quantification as the predominant active bone

remodeling occurs in this region. Osteoblasts were identified as those cells

in direct contact with the newly advancing bone matrix that display typical

cuboidal or columnar epithelial layer and are connected to one another via

thin processes identifiable at high magnification (200� or greater; ref. 19).

Results are presented as the number of osteoblasts/mm2 of diaphyseal

intramedullary space. Osteoclast proliferation was determined by quanti-

fying the number of TRAP-stained osteoclasts at the bone/tumor interface

and at the normal marrow/bone interface for naı̈ve, sham-injected, and

ACE-1-injected mice on TRAP-stained femoral sections throughout the

diaphyseal intramedullary space. Osteoclasts are histologically differentiat-

ed cells appearing as TRAP-stained and which are closely associated with

regions of bone resorption. These cells are multinucleate and are found

in Howship’s lacunae along the cortical and trabecular bone (19).

Macrophage proliferation was determined by quantifying the number of

TRAP-stained cells that were dispersed throughout the tumor and normal

marrow not associated with the endosteal surface of the mineralized

bone. Macrophages within the bone become activated due to tumor-released

factors that stimulate the cells, and the cellular appearance of these activated

macrophages is marked by their highly irregular surface, multiple lamelli-

podia, and phagocytic vacuoles (19). Results are expressed as the mean

number of osteoclasts per square millimeter or macrophages per square

millimeter of diaphyseal intramedullary space, respectively.

Femora containing ACE-1 cells were imaged using bright-field micros-

copy on a Nikon E600 microscope equipped with a SPOT II digital camerausing SPOT image capture software (Diagnostic Instruments, Sterling

Heights, MI). The total area of intramedullary space and the percentage of

intramedullary space occupied by tumor, bone formation, and remaining

hematopoietic cells was calculated using Image Pro Plus v3.0 software(Media Cybernetics, Silver Spring, MD; ref. 20). Bone formation was

analyzed using the same H&E-stained femora sections used to quantify

tumor growth viewed under polarized light to identify regions of woven andlamellar bone formation. Results are presented as a percentage of total

intramedullary area.

Quantification of sensory fibers in bone and skin. The number of

sensory nerve fibers in bone was determined as previously described(14, 21). CGRP-immunoreactive (CGRP-IR) nerve fiber counts were done

on six femoral sections per mouse and included only fibers >30 Am in

length. Results are presented as the number of CGRP-IR fibers counted

per total section area. Quantification of epidermal innervation densitywas done on four randomly selected plantar hindpaw skin sections per

mouse as previously described. The total number of CGRP, TOH, and

RT97-IR nerve fibers were counted using a 20� objective. Countingcriteria were established to count only single intraepidermal fibers and

not multiple branches of the same fiber, as previously described (17).

Results are given as the mean number of intraepidermal nerve fibers per

millimeter.Behavioral analysis. Mice were tested for pain-related behaviors both

prior to and at 7, 9, 11, 13, 15, 17, and 19 days following ACE-1 or sham

injections to assess the efficacy of the anti-NGF antibody over the

progression of the disease. Briefly, ongoing nocifensive behaviors were

Anti-NGF Therapy and Prostate Tumor–Induced Bone Pain

www.aacrjournals.org 9427 Cancer Res 2005; 65: (20). October 15, 2005



evaluated by measuring the time spent spontaneously guarding andflinching over a 2-minute observation period. The number of flinches was

defined as lifting the tumor-injected limb while stationary and time spent

guarding was defined as the length of time the tumor-injected limb was

held aloft (22).Following a 15-minute acclimation period, thermal and mechanical

sensitivity were measured in naı̈ve and naı̈ve + anti-NGF mice to assess

whether the normal pain threshold responses were altered with anti-NGF

treatment. Thermal sensitivity was measured using a Thermal PawStimulator (University of California, San Diego, San Diego, CA) as previously

described (14). Mechanical sensitivity was measured using a previously

validated method (14, 23).

RT-PCR analysis of mRNA levels of nerve growth factor in theprostatic ACE-1 cell line. Total RNA from dog brain tissue samples or

ACE-1 prostate cells were prepared using the RNeasy micro kit (Qiagen,

Valencia, CA), and the RNA was quantified using Ribogreen reagent(Molecular Probes, Eugene, OR). Two-step RT-PCR was done using the

TaqMan Gold RT-PCR kit (Applied Biosystems, Foster City, CA). The

RNA was reverse-transcribed using random hexamers, and the cDNA was

amplified using a primer/probe set specific for NGF (AACAGGACTCA-CAGGAGCAA, CGGCACTTGGTCTCAAAGAA, and AATGTTCACCTCTCC-

CAGCACCATCA). The samples were analyzed in duplicate from the reverse-

transcription step and normalized to total RNA input.

Statistical analysis. The Statview computer statistics package (SASInstitute, Inc., Cary, NC) was used to perform statistical tests. One-way

ANOVA was used to compare behavioral results, bone histologic results, and

immunohistochemical measures among the experimental groups. Formultiple comparisons, Fisher’s protected least significant difference post

hoc test was used. Significance level was set at P < 0.05. The individual

investigator responsible for behavior, immunohistochemical analysis, and

scoring bone remodeling was blind to the experimental situation of eachanimal. Results are presented as mean F SEM.

Results

Anti–nerve growth factor therapy attenuated bone cancerpain to a greater extent than morphine sulfate but did notaffect baseline thermal or mechanical thresholds. Ongoing painwas analyzed by measuring spontaneous guarding and flinchingover a 2-minute time period. ACE-1 + vehicle mice showed agreater time spent guarding (7.7 F 0.8 seconds, day 19) ascompared with the sham + vehicle controls (0.6 F 0.3 seconds, day19; Fig. 1A). Additionally, ACE-1 + vehicle mice exhibited anincreased number of flinches (11.9 F 1.2, day 19) as compared withsham + vehicle controls (1.0 F 0.4, day 19; Fig. 1B). Administrationof anti-NGF in ACE-1-injected mice significantly attenuatedspontaneous guarding (1.2 F 0.4 seconds, day 19) as comparedwith ACE-1 + vehicle mice (Fig. 1A). Anti-NGF treatment alsosignificantly reduced spontaneous flinching in ACE-1-injected mice(2.1 F 0.7, day 19) as compared with ACE-1 + vehicle (Fig. 1B). Inpreliminary studies, no significant behavioral differences or sideeffects were observed between sham-operated controls receivingeither vehicle or anti-NGF (results not shown).Anti-NGF therapy had no effect on either normal thermal

response (10.2 F 0.4 seconds, day 19) as compared with naı̈ve +vehicle (11.2 F 0.4 seconds, day 19; Fig. 1C) or normal mechanicalresponse (5.4 F 0.3 g, day 19) as compared with naı̈ve + vehicle(5.2 F 0.4 g, day 19; Fig. 1D).Mice were tested to compare the efficacy of morphine sulfate to

the anti-NGF antibody in reducing bone cancer–related painbehaviors. Behavioral assessment on days 11 and 19 post-tumorinjection revealed that ACE-1 + vehicle mice showed statisticallylonger time guarding of the injected limb (6.0 F 1.0 and 7.6 F 1.2seconds, days 11 and 19, respectively) compared with sham +

vehicle mice (0.4 F 0.2 and 0.6 F 0.3 seconds, days 11 and 19,respectively; Fig. 1E). ACE-1 + vehicle also showed a significantlylarger number of flinches of the injected limb (8.6 F 1.2 and 11.7 F1.7, days 11 and 19, respectively) compared with sham + vehiclemice (0.7 F 0.3 and 1.0 F 0.4, days 11 and 19, respectively; Fig. 1F).Ongoing guarding was significantly reduced by either chronictreatment with anti-NGF (2.1 F 1.1 and 1.4 F 0.4 seconds, days 11and 19, respectively), acute 10 mg/kg morphine sulfate (3.5 F 0.3and 4.0F 0.5 seconds, days 11 and 19, respectively) or acute 30 mg/kg morphine sulfate (2.2 F 0.3 and 2.0 F 0.4 seconds, on days 11and 19, respectively), as compared with ACE-1 + vehicle mice(Fig. 1E). Ongoing flinching was also significantly reduced by eitherchronic treatment with anti-NGF (3.4 F 1.7 and 2.6 F 0.6, days 11and 19, respectively), acute 10 mg/kg morphine sulfate (5.6 F 0.5and 6.8 F 0.7, days 11 and 19, respectively) or acute 30 mg/kgmorphine sulfate (3.6 F 0.5 and 3.5 F 0.7, days 11 and 19,respectively), as compared with ACE-1 + vehicle mice (Fig. 1F).Anti-NGF therapy significantly attenuated the bone cancer–relatedpain behaviors more effectively than acute 10 mg/kg morphinesulfate. No differences in terminal weights were observed betweensham + vehicle (27 F 1 g), ACE-1 + vehicle (27 F 1 g), and ACE-1 +Anti-NGF (26 F 1 g) mice. In these studies, no significant sideeffects, such as ataxia, illness, or lethargy, were observed betweenmice receiving either vehicle or anti-NGF.Anti–nerve growth factor therapy had no affect on markers

of disease progression or tumor-induced bone formation. Theeffects of anti-NGF therapy on bone formation and destruction,tumor growth (Fig. 2), and osteoclast proliferation (Fig. 3) wereexamined 19 days post-tumor injection (Table 1). Sham-injectedmice did not show significant bone remodeling (Fig. 2A), osteoclastproliferation throughout the entire intramedullary space (Fig. 3A)or tumor cells (Fig. 2D), as assessed by radiologic, TRAP, and H&Eanalysis, respectively, when compared with ACE-1-injected mice. InACE-1 + vehicle mice, there was extensive bone formation, butnearly equivalent destruction as observed and characterized bymultifocal diaphyseal bridging and radiolucencies (Fig. 2B), markedincrease in the number of osteoclasts (Fig. 3B) and osteoblaststhroughout the diaphyseal intramedullary area and the tumor hadfilled most of the intramedullary space (Fig. 2E). Treatment oftumor-bearing mice with anti-NGF from day 7 post-tumor injectionresulted in no significant change in bone remodeling (Fig. 2C), noreduction in ACE-1-induced osteoclast (Fig. 3C) or osteoblastproliferation throughout the diaphyseal intramedullary area ortumor growth as compared with ACE-1 + vehicle mice (Fig. 2F).Nineteen days following tumor injection, ACE-1 + vehicle mice

displayed an increase in macrophages as compared with sham +vehicle control mice. Anti-NGF treatment of ACE-1-injected micedid not significantly alter macrophage infiltration, as seen in theACE-1 + vehicle mice (Table 1).Anti–nerve growth factor therapy has no observable effect

on sensory or sympathetic innervation in bone or skin. Thinlymyelinated or unmyelinated peptidergic sensory nerve fibers(CGRP-IR), large myelinated sensory fibers (RT97-IR), and norad-renergic sympathetic nerve fibers (TH-IR) were analyzed in theACE-1-injected femora or the hindpaw plantar skin by immuno-histochemistry using antibodies raised against CGRP, RT-97, andTH, respectively. CGRP-IR nerve fibers were found throughout theentire bone (periosteum, mineralized bone, bone marrow andtumor) of the ACE-1 + vehicle and ACE-1 + anti-NGF mice (Fig. 4)as well as in naı̈ve + vehicle mice or naı̈ve + anti-NGF mice. Therewas no significant difference between the intensity or density of

Cancer Research




CGRP-IR fibers in ACE-1 + vehicle and ACE-1 + anti-NGF hindpawskin samples (Fig. 5C and D). Similarly, there was no significantdifference between the intensity or density of CGRP-IR fibersin naı̈ve + vehicle and naı̈ve + anti-NGF hindpaw skin samples(Fig. 5A and B). Differences in the density and intensity of RT97-IRand TH-IR fibers were also undetectable in naı̈ve + vehicle andnaı̈ve + anti-NGF–treated mice. There were no significantobservable differences between the intensity or density of CGRP,RT97 or TH-IR fibers in the skin samples of ACE-1 + vehicle andACE-1+ anti-NGF versus the naı̈ve + vehicle and naı̈ve + anti-NGFmice (Table 1).Expression of nerve growth factor mRNA by ACE-1 cells as

compared with dog brain. In order to determine whether theACE-1 tumor cells were a possible source of NGF, five independentsamples of ACE-1 cells grown in culture were assessed for theirlevel of NGF mRNA by RT-PCR. These levels were compared withthose found in the brain. ACE-1 cells in vitro do not contain NGF

mRNA at levels detectable by current RT-PCR techniques. NGFmRNA in brain crossed the detection threshold at cycle 35.2 of a40-cycle experiment, whereas the ACE-1 samples failed to cross thethreshold after 40 cycles. Therefore, NGF expression in the ACE-1samples is at least 27.8-fold less than expression in brain.

Discussion

Prostate cancer is the most commonly diagnosed cancer and thesecond leading cause of cancer-related deaths in men in the U.S.(24). Whereas tumor metastasis to bone is common in lung, breast,and prostate cancers, prostate cancer is unique in that bone isoften the only clinically detectable site of metastasis and prostatetumors tend to be primarily bone-forming rather than bone-destroying (25, 26). The most common presenting symptomindicating that tumor cells have metastasized to the skeleton isbone pain (4, 27). Although bone is not a vital organ, prostate

Figure 1. Anti-NGF therapy attenuatesprostate tumor–induced bone cancer pain(A and B ). Anti-NGF treatment (10 mg/kg,i.p., given on days 7, 12, and 17 post-tumorinjection) attenuated ongoing bonecancer pain behavior on days 7 to 19post-tumor injection. The time spentguarding and number of spontaneousflinches of the afflicted limb over a 2-minuteobservation period were used as measuresof ongoing pain (A and B). Anti-NGF (n)significantly reduced ongoing painbehaviors in tumor-injected mice ascompared with ACE-1 + vehicle (5), andwas reduced to sham (.) levels at day 9 forall variables. Both guarding and flinchingin the sham + vehicle mice are significantlydifferent from ACE-1 + vehicle miceacross disease progression. Anti-NGFtherapy has no effect on baseline thermalor mechanical thresholds (C and D ).Anti-NGF treatment had no effect on basalthermal or mechanical responses asmeasured by latency of paw withdrawal toa thermal stimulus or increase in thresholdof mechanical stimulation (C and D).Anti-NGF is also more effective orequivalent to acute morphine sulfatetherapy in reducing bone cancerpain–related behaviors. Anti-NGFtreatment produced a greater reduction inongoing pain behaviors at day 19 than10 or 30 mg/kg morphine sulfate(i.p., 15 minutes prior to testing; E and F ).Bars, SEM; *, P < 0.05 versus sham +vehicle; #, P < 0.05 versus ACE-1 +vehicle; +, P < 0.05 versus ACE-1 +morphine sulfate 10 mg/kg.





metastasis to bone is a major cause of morbidity as it usuallyresults in anemia, increased susceptibility to infection, pain, andbone fractures—all of which compromise the patient’s survival andquality of life (27). Once tumor cells have metastasized to bone,the tumor cells induce significant bone remodeling that iscorrelated with an ongoing pain and is usually described as dullin character, constant in presentation, and gradually increasing inintensity with time (4). As bone remodeling progresses, acutepain is frequently observed if the remodeled bone is moved orif pressure is applied to it (28). Breakthrough pain, which is anintermittent episode of extreme pain, can occur spontaneously or

more commonly by weight-bearing or movement (2, 3). In humans,the extent of bone remodeling is correlated with the severity ofthe pain.Currently, the treatment of pain from bone metastases involves

the use of different complementary approaches including radio-therapy, chemotherapy, bisphosphonates, and analgesics (4). How-ever, bone cancer pain is one of the most difficult of all persistent

Figure 2. Anti-NGF had no effect on tumor burden or tumor-induced boneremodeling. Sham mice, given vehicle (A ), show no radiographically orhistologically (H&E; D ) apparent bone destruction at day 19, whereas ACE-1 +vehicle mice (B and E ) and ACE-1 + anti-NGF mice (C and F ) showedsignificant tumor growth and bone remodeling when examined radiologically andhistologically. Boxes, radiographed regions (A-C ) which are enlarged in thecorresponding H&E-stained sections (D-F); H, hematopoietic cells; T, tumor;WB, ACE-1-induced woven bone formation; bar, 1.5 mm.

Figure 3. Anti-NGF therapy did not significantly reduce tumor-inducedosteoclastogenesis. TRAP-stained images of sham + vehicle (A ), ACE-1 +vehicle (B ), and ACE-1 + anti-NGF (C) illustrate that osteoclast proliferationoccurs in this model along regions of tumor-induced bone remodeling and anincrease in the number of osteoclasts per square millimeter of diaphysealintramedullary area in both the anti-NGF and vehicle-treated mice as comparedwith sham + vehicle and naı̈ve + vehicle mice was observed. Sham + vehiclemice (A) present osteoclast numbers, morphology, and macrophages which arenot significantly different from naı̈ve mice. There is no observable difference inhistologic appearance of the osteoclasts along the tumor/bone interface ormacrophages throughout the tumor when anti-NGF-treated mice (C ) arecompared with vehicle-treated mice (B). Arrows, osteoclasts; arrowheads,macrophages; MB, mineralized bone; H, hematopoietic cells; T, tumor;bar, 50 Am.

Cancer Research




pains to adequately control (4). A major reason bone cancer painis so difficult to control is that bone metastases are generallynot limited to a single site and the analgesics that are mostcommonly used to treat bone cancer pain, the nonsteroidal anti-inflammatory drugs and opioids, are limited by significant adverseside effects and the complex nature of interactions betweenneuropathic and inflammatory mediators (29). For example, thenonselective nonsteroidal anti-inflammatory drugs could causeintestinal bleeding, whereas some selective cyclooxygenase-2inhibitors, although causing less bleeding, have significantcardiovascular and renal safety issues (30, 31). Opioids are effectivein attenuating bone cancer pain, but these frequently causeconstipation, sedation, nausea, vomiting, and respiratory depres-sion (32). Because prostate tumors metastasize primarily to bone,and not the other vital organs such as lung, liver, or brain, patientswith prostate tumor metastases tend to live for a significant periodof time (on average, 55 months) beyond their initial diagnosis (33),making it essential that new therapies be developed that can beadministered over years and control bone pain without the sideeffects commonly encountered with high-dose opiates. Althoughthe studies reported here are relatively short-term rodent studies,no signs of adverse events were observed with administrationof anti-NGF. The most likely origin of any side effects due to anti-NGF treatment would arise in the three most well-characterized

NGF-responsive cell populations, sympathetic, peptidergic sensory,and basal forebrain cholinergic neurons. There was no observablechange in sensory or sympathetic innervation density of the skin orbone or in tactile or thermal sensitivity in this or other studiesusing this antibody (14). The IgG used to inhibit NGF would not beexpected to cross the blood-brain barrier under normal circum-stances, making it unlikely that there would be adverse events dueto anti-NGF in the central nervous system. Longer-term humanstudies will be required to further clarify any adverse event profilepossibly due to anti-NGF therapy.Previously, we and others have attempted to develop novel

mechanism-based therapies to treat bone cancer pain using avariety of tumor types implanted into the rat or mouse bone(34–36). Although these studies have provided insight into themechanisms that generate and maintain bone cancer pain, thetumor cells that were employed were primarily osteolytic or bone-destroying in nature (34–36). A major question is whether thesestudies will accurately predict the mechanisms that generate thebone pain driven by tumor cells, such as prostate, that areprimarily bone-forming rather than bone-destroying resulting froman upset in the balance between osteoblastic or osteolytic activityin the tumor-bearing femur (37). For this reason, we focused on theACE-1 canine prostate tumor cells, as when these cells areimplanted into the femur of nude mice, significant new ‘‘woven’’

Table 1. Histologic, radiologic, and immunohistochemical quantification of bone remodeling, tumor progression, and hindpawskin innervation in anti-NGF and vehicle-treated ACE-1 mice

Naı̈ve + vehicle Sham + vehicle ACE-1 + vehicle ACE-1 + anti-NGF

Bone histomorphometry

Osteoclasts (OC #/mm2 diaphyseal intramedullary space) 7 F 1 16 F 10 47 F 3*,c 47 F 5Osteoblasts (OB #/mm2 diaphyseal intramedullary space) 81 F 4 72 F 5 127 F 7*,c 118 F 15*,c

Macrophages (macrophages/mm2 diaphyseal intramedullary space) 2 F 1 2 F 1 27 F 2*,c 24 F 3*,c

Tumor-induced new bone formation (% diaphysealintramedullary space occupied)

0 F 0 0 F 0 14 F 2*,c 13 F 1*,c

Tumor cells (% intramedullary space occupied) 0 F 0 0 F 0 60 F 7*,c 57 F 6*,c

Hematopoetic cells (% intramedullary space occupied) 100 F 0 100 F 0 26 F 8*,c 30 F 6*,c

Radiologic bone density score% Normalized transmission [(1/[antilog

(Optical Density)])/naı̈ve transmission] � 100%

100 F 2 115 F 2 109 F 5 106 F 9

Immunohistochemistry

Hindpaw skinCGRP-IR (# fibers/mm) (small diameter unmyelinated) 14.4 F 0.4 14.2 F 1.9 13.9 F 0.6 15.0 F 0.5

TH-IR (# fibers/mm) (sympathetics) 3.0 F 0.4 2.6 F 0.2 2.4 F 0.6 2.8 F 0.6

RT97-IR (# fibers/mm) (large diameter myelinated) 9.6 F 1.3 8.0 F 0.6 7.4 F 0.5 7.3 F 0.6

FemurCGRP-IR (# fibers/mm2) (small diameter unmyelinated) 21.6 F 2.1 23.1 F 1.9 23.5 F 1.9 21.0 F 1.9

NOTE: Anti-NGF therapy did not have a significant effect on measures of bone histomorphometry as compared with vehicle-treated mice. Tumor-

injected mice treated with either vehicle or anti-NGF therapy showed a significant increase in the number of osteoclasts, osteoblasts, and macrophages

throughout the diaphyseal intramedullary space as compared with sham + vehicle or naı̈ve + vehicle mice (per mm2). The percentage of tumor cells andhematopoietic cells remaining were not significantly reduced in ACE-1-injected mice treated with anti-NGF therapy. Tumor-induced bone formation as

a percentage of intramedullary space occupied was not reduced with anti-NGF therapy as compared with ACE-1 + vehicle mice. All histomorphometric

variables in tumor-injected mice were significantly elevated from both sham + vehicle and naı̈ve + vehicle mice. Normalized transmission values for

ACE-1-injected mice were not significantly elevated from either sham or naı̈ve + vehicle mice. There was no statistical difference in the number of CGRP,TH, or RT97-IR (neurofilament 200) epidermal fibers/mm in hindpaw skin between naı̈ve + vehicle, sham + vehicle, ACE-1 + vehicle, or ACE-1 + anti-

NGF–treated mice. Results presented include mean F SEM.

*P < 0.05 versus naı̈ve.cP < 0.05 versus sham + vehicle (one-way ANOVA, Fisher’s protected least significant difference).





bone is formed in local compartments, giving the bone a uniquescalloped appearance similar to what is observed in humans withprostate tumor metastases to bone (6). Nearly equivalentnormalized transmission values suggest that ACE-1-induced wovenbone formation has a decreased mineral content as compared withlamellar bone which is consistent with human prostate tumor–induced bone remodeling (38). The concurrent bone destructionand formation in the present model is quite distinct from thatobserved in tumors such as sarcoma or breast, where the tumorwas primarily osteolytic as bone destruction predominates (39).One of the findings of the present study was that administration

of anti-NGF was not only highly efficacious in reducing both earlyand late stage bone cancer pain-related behaviors, but that thisreduction was greater than that achieved with acute administra-tion of 10 or 30 mg/kg of morphine sulfate. In light of thesefindings, a critical question is: what are the mechanisms thatcontribute to the efficacy of anti-NGF in blocking prostate tumor–induced bone pain? One important concept that has emerged overthe past decade is that in addition to NGF being able to directlyactivate sensory neurons that express the trkA receptor, NGFmodulates expression and function of a wide variety of molecules

and proteins expressed by sensory neurons that express the trkA orp75 receptor, which include: neurotransmitters (substance P andCGRP), receptors (bradykinin R), channels (P2X3, TRPV1, ASIC-3,and sodium channels), activating transcription factors (ATF-3), andstructural molecules (neurofilaments and the sodium channelanchoring molecule p11; refs. 40–47). Additionally, NGF has beenshown to modulate the trafficking and insertion of sodiumchannels such as Nav 1.8 (44) and TRPV1 (45) in the sensoryneurons as well as modulating the expression profile of supportingcells in the dorsal root ganglia and peripheral nerve, such asnonmyelinating Schwann cells and macrophages (48). Therefore,anti-NGF therapy may be particularly effective in blocking bonecancer pain as NGF seems to be integrally involved in the up-regulation, sensitization, and disinhibition of multiple neuro-transmitters, ion channels, and receptors in the primary afferentnerve and dorsal root ganglia fibers that synergistically increasenociceptive signals originating from the tumor-bearing bone.Importantly, anti-NGF therapy did not significantly influencetumor-induced bone remodeling, osteoblast proliferation, osteo-clastogenesis, tumor growth, or markers of sensory or sympatheticinnervation in the skin or bone, suggesting anti-NGF–induced

Figure 4. Anti-NGF therapy did not influence the density of CGRP-IR sensory fibers in the tumor femur. There was no observable difference in the levels ofimmunofluorescence or density of CGRP-IR fibers between ACE-1 + vehicle mice (A) and ACE-1 + anti-NGF mice (B ) at day 19. Also, note that there was maintenanceof CGRP-IR fibers with anti-NGF therapy. H&E-stained serial sections are included for orientation reference (A and C , B and D ). T, tumor; bar, 50 Am.

Cancer Research




disease modification or denervation of the sensory/sympatheticinnervation were not the primary mechanism(s) by which anti-NGFexerted its analgesic effects in the present model of bone cancerpain. The above data may suggest that anti-NGF should be anexcellent anti-hyperalgesic, yet in other pain models, such as theBrennan incision model (49), anti-NGF seems to block only certaincomponents of the pain state ( for example, thermal but notmechanical hyperalgesia).One rather unique aspect of the sensory innervation of bone,

which may explain the analgesic efficacy of anti-NGF therapy inrelieving prostate tumor–induced bone pain, is that unlike skin,nearly all nerve fibers that innervate the bone express CGRP (20).Previous studies have shown that nearly all CGRP-IR fiberscoexpress trkA and p75, which are the receptors by which NGFsensitizes and/or activates nociceptors (50, 51). In both rodentsand humans, fibers from primary afferent sensory neurons thatinnervate bone marrow, mineralized bone, and periosteum (52), areCGRP-IR fibers with few, if any, of the nonpeptidergic IB4/RET-IRnerve fibers being present (21). Within the marrow and mineralizedbone, sensory fibers are generally associated with the blood vessels

(21), and nearly all of these fibers express CGRP (21). Thus, thegreat majority of sensory fibers that innervate the bone are CGRP/trkA-IR fibers. If the sensitization and activation of these fibers isblocked by anti-NGF therapy, there would not be anotherpopulation of nociceptors, such as the nonpeptidergic IB4/RET-IRnerve fibers, to take their place in signaling nociceptive events inthe tumor-bearing bone.It is interesting to speculate the cellular source of NGF which is

normally involved in driving pain in the present model given thein vitro observation that ACE-1 cells express undetectabe levels ofNGF mRNA or protein. Previous studies conducted primarily in theskin have shown that macrophages and neutrophils express highlevels of NGF mRNA and protein and are a major source of NGFthat drives inflammatory pain following tissue injury (53). Athymicnude mice lack T lymphocytes, but have macrophages and otherimmune and inflammatory cells maintained, and it is these cells,as in the skin, that could be an important source of NGF whichis driving the ACE-1 prostate tumor–induced bone pain. Previousdata concerning the receptor type that is important in drivingNGF-induced bone cancer pain has shown that the anti-NGF

Figure 5. Anti-NGF therapy did not influence the density of CGRP-IR sensory fibers in the hindpaw skin. There was no observable difference in the levels ofimmunofluorescence or density of CGRP-IR fibers in skin between naı̈ve + vehicle (A ) and naı̈ve + anti-NGF (B ) mice. Similarly, there was no difference in the levels ofimmunofluorescence or density of CGRP-IR nerve fibers between ACE-1 + vehicle (C) mice and ACE-1 + anti-NGF (D ) mice. Also note that there was no difference inCGRP-IR nerve fibers between the naı̈ve and ACE-1-injected mice (A , B versus C , D ). Bar, 50 Am.





antibody used in the present study inhibits the interaction ofNGF with both the trkA and p75 neurotrophin receptor (15).NGF is capable of causing acute hyperalgesia in p75 knock-outmice, showing that trkA is sufficient to mediate the NGF effect inthis setting (54). However, it is known that the p75 receptor iscritical for NGF regulation of bradykinin receptors (55). In thecomplex setting of a growing tumor in the bone, with theaccompanying presence of multiple inflammatory mediators, it isnot clear whether it is the interaction of NGF with trkA, p75, orboth, that is important for the behavioral and histologic effectsseen here.Whether anti-NGF therapy can inhibit prostate tumor–induced

bone pain in humans remains to be determined. The mechanismof tumor-induced bone pain is thought to be similar in mouse andhuman as both are mediated by excessive bone remodeling,release of algogenic inflammatory and tumor products. Previousstudies have shown the presence of nerve fibers in bones of rats(52), cats (56), dogs (57), and horses (58) in addition to humans

(59), and this pain mechanism could also be mediated by tumor-induced injury to nerve fibers that innervate the bone. If anti-NGFtherapies can block tumor-induced bone pain, retain theiranalgesic efficacy with disease progression, and provide significantopioid-sparing action without significant unwanted side effects,they may provide significant advantages over the analgesics thatare currently used to treat bone cancer pain. Given the relativelylong and increasing survival times in patients with prostatemetastasis to bone, anti-NGF therapy may be particularly useful inreducing the pain and improving the quality of life in this patientpopulation.

Acknowledgments

Received 3/10/2005; revised 6/9/2005; accepted 8/11/2005.Grant support: NIH grants (NS23970, NS048021), the MinCREST program at the

University of Minnesota, and a Merit Review from the Veterans Administration.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

Cancer Research


References1. Olson KB, Pienta KJ. Pain management in patientswith advanced prostate cancer [discussion 49–50passim]. Oncology 1999;13:1537–49.

2. Mercadante S, Arcuri E. Breakthrough pain in cancerpatients: pathophysiology and treatment. Cancer TreatRev 1998;24:425–32.

3. Portenoy RK, Hagen NA. Breakthrough pain: definition,prevalence and characteristics. Pain 1990;41:273–81.

4. Mercadante S. Malignant bone pain: pathophysiologyand treatment. Pain 1997;69:1–18.

5. Portenoy RK. Managing cancer pain poorly responsiveto systemic opioid therapy. Oncology 1999;13:25–9.

6. Body JJ. Tumor bone diseases and osteoporosis incancer patients. 1st ed. New York: Marcel Dekker, Inc.;2000. p. 561.

7. Shu XQ, Mendell LM. Neurotrophins and hyperalgesia.Proc Natl Acad Sci U S A 1999;96:7693–6.

8. Koltzenburg M. The changing sensitivity in the life ofthe nociceptor. Pain 1999;Suppl 6:S93–102.

9. Andreev NY, Dmitrieva N, Koltzenburg M, McMahonSB. Peripheral administration of nerve growth factor inthe adult rat produces a thermal hyperalgesia thatrequires the presence of sympathetic post-ganglionicneurones. Pain 1995;63:109–15.

10. Mendell LM, Albers KM, Davis BM. Neurotrophins,nociceptors, and pain. Microsc Res Tech 1999;45:252–61.

11. Susaki Y, Shimizu S, Katakura K, et al. Functionalproperties of murine macrophages promoted by nervegrowth factor. Blood 1996;88:4630–7.

12. Lewin GR, Rueff A, Mendell LM. Peripheral andcentral mechanisms of NGF-induced hyperalgesia. Eur JNeurosci 1994;6:1903–12.

13. Descamps S, Toillon RA, Adriaenssens E, et al. Nervegrowth factor stimulates proliferation and survival ofhuman breast cancer cells through two distinctsignaling pathways. J Biol Chem 2001;276:17864–70.

14. Sevcik MA, Ghilardi JR, Peters CM, et al. Anti-NGFtherapy profoundly reduces bone cancer pain and theaccompanying increase in markers of peripheral andcentral sensitization. Pain 2005;115:128–41.

15. Hongo JS, Laramee GR, Urfer R, et al. Antibodybinding regions on human nerve growth factor identi-fied by homolog- and alanine-scanning mutagenesis.Hybridoma 2000;19:215–27.

16. Shelton DL, Zeller J, Ho W-H, Pons J, Rosenthal A.Nerve growth factor mediates hyperalgesia and cachexiain auto-immune arthritis. Pain 2005;116:8–16.

17. McCarthy BG, Hsieh ST, Stocks A, et al. Cutaneousinnervation in sensory neuropathies: evaluation by skinbiopsy. Neurology 1995;45:1848–55.

18. Corey E, Quinn JE, Bladou F, et al. Establishment andcharacterization of osseous prostate cancer models:intra-tibial injection of human prostate cancer cells.Prostate 2002;52:20–33.

19. Fawcett DW. A Textbook of Histology. In: DreibelbisD, editor. Bone. 11th ed. Philadelphia (PA): W.B.Saunders Company; 1986. p. 211–3.

20. Sevcik MA, Luger NM, Mach DB, et al. Bone cancerpain: the effects of the bisphosphonate alendronate onpain, skeletal remodeling, tumor growth and tumornecrosis. Pain 2004;111:169–80.

21. Mach DB, Rogers SD, Sabino MC, et al. Origins ofskeletal pain: sensory and sympathetic innervation ofthe mouse femur. Neuroscience 2002;113:155–66.

22. Luger NM, Honore P, Sabino MA, et al. Osteoprote-gerin diminishes advanced bone cancer pain. CancerRes 2001;61:4038–47.

23. Chaplan SR, Bach FW, Pogrel JW, Chung JM, YakshTL. Quantitative assessment of tactile allodynia in therat paw. J Neurosci Methods 1994;53:55–63.

24. Berruti A, Dogliotti L, Bitossi R, et al. Incidence ofskeletal complications in patients with bone metastaticprostate cancer and hormone refractory disease:predictive role of bone resorption and formationmarkers evaluated at baseline. J Urol 2000;164:1248–53.

25. Logothetis CJ, Lin SH. Osteoblasts in prostate cancermetastasis to bone. Nat Rev Cancer 2005;5:21–8.

26. LeRoy BE, Bahnson RR, Rosol TJ. Canine prostateinduces new bone formation in mouse calvaria: a modelof osteoinduction by prostate tissue. Prostate 2002;50:104–11.

27. Coleman RE. Skeletal complications of malignancy.Cancer 1997;80:1588–94.

28. Clohisy DR, Mantyh PW. Bone cancer pain. Cancer2003;97:866–73.

29. Walsh TD. Prevention of opioid side effects. J PainSymptom Manage 1990;5:362–7.

30. Mukherjee D, Nissen SE, Topol EJ. Risk of cardiovas-cular events associated with selective COX-2 inhibitors.JAMA 2001;286:954–9.

31. Davies NM, Jamali F. COX-2 selective inhibitorscardiac toxicity: getting to the heart of the matter.J Pharm Pharm Sci 2004;7:332–6.

32. Mercadante S. Problems of long-term spinal opioidtreatment in advanced cancer patients. Pain 1999;79:1–13.

33. Jemal A, Murray T, Ward E, et al. Cancer statistics,2005. CA Cancer J Clin 2005;55:10–30.

34. Guise TA, Chirgwin JM. Role of bisphosphonates inprostate cancer bone metastases. Semin Oncol 2003;30:717–23.

35. Schwei MJ, Honore P, Rogers SD, et al. Neurochemicaland cellular reorganization of the spinal cord in amurine model of bone cancer pain. J Neurosci 1999;19:10886–97.

36. Medhurst SJ, Walker K, Bowes M, et al. A rat model ofbone cancer pain. Pain 2002;96:129–40.

37. Revilla M, Arribas I, Sanchez-Chapado M, Villa LF,Bethencourt F, Rico H. Total and regional bone massand biochemical markers of bone remodeling inmetastatic prostate cancer. Prostate 1998;35:243–7.

38. Adler CP. Bone diseases: macroscopic, histological,and radiological diagnosis of structural changes in theskeleton. 2nd ed. Berlin: Springer-Verlag; 2000.

39. Schwei MJ, Honore P, Rogers SD, et al. Neurochemicaland cellular reorganization of the spinal cord in amurine model of bone cancer pain. J Neurosci 1999;19:10886–97.

40. Rueff A, Dawson AJ, Mendell LM. Characteristics ofnerve growth factor induced hyperalgesia in adult rats:dependence on enhanced bradykinin-1 receptor activitybut not neurokinin-1 receptor activation. Pain 1996;66:359–72.

41. Verge VM, Tetzlaff W, Bisby MA, Richardson PM.Influence of nerve growth factor on neurofilament geneexpression in mature primary sensory neurons.J Neurosci 1990;10:2018–25.

42. Averill S, Michael GJ, Shortland PJ, et al. NGF andGDNF ameliorate the increase in ATF3 expressionwhich occurs in dorsal root ganglion cells in responseto peripheral nerve injury. Eur J Neurosci 2004;19:1437–45.

43. Donnerer J, Schuligoi R, Stein C. Increased contentand transport of substance P and calcitonin gene-related peptide in sensory nerves innervating inflamedtissue: evidence for a regulatory function of nervegrowth factor in vivo . Neuroscience 1992;49:693–8.

44. Gould HJ III, Gould TN, England JD, Paul D, Liu ZP,Levinson SR. A possible role for nerve growth factor inthe augmentation of sodium channels in models ofchronic pain. Brain Res 2000;854:19–29.

45. Ji RR, Samad TA, Jin SX, Schmoll R, Woolf CJ. p38MAPK activation by NGF in primary sensory neuronsafter inflammation increases TRPV1 levels and main-tains heat hyperalgesia. Neuron 2002;36:57–68.

46. Ramer MS, Bradbury EJ, McMahon SB. Nerve growthfactor induces P2X(3) expression in sensory neurons.J Neurochem 2001;77:864–75.

47. Mamet J, Lazdunski M, Voilley N. How nerve growthfactor drives physiological and inflammatory expres-sions of acid-sensing ion channel 3 in sensory neurons.J Biol Chem 2003;278:48907–13.





48. Heumann R, Korsching S, Bandtlow C, Thoenen H.Changes of nerve growth factor synthesis in non-neuronal cells in response to sciatic nerve transection.J Cell Biol 1987;104:1623–31.

49. Zahn PK, Subieta A, Park SS, Brennan TJ. Effect ofblockade of nerve growth factor and tumor necrosisfactor on pain behaviors after plantar incision. J Pain2004;5:157–63.

50. Averill S, McMahon SB, Clary DO, Reichardt LF,Priestley JV. Immunocytochemical localization oftrkA receptors in chemically identified subgroupsof adult rat sensory neurons. Eur J Neurosci 1995;7:1484–94.

51. Walsh GS, Krol KM, Kawaja MD. Absence of the p75neurotrophin receptor alters the pattern of sympatho-sensory sprouting in the trigeminal ganglia of mice

overexpressing nerve growth factor. J Neurosci 1999;19:258–73.

52. Bjurholm A, Kreicbergs A, Brodin E, Schultzberg M.Substance P- and CGRP-immunoreactive nerves inbone. Peptides 1988;9:165–71.

53. Foster PA, Wicks S, Foster M, Brain SD.Cellular pathology changes in rat skin following intra-dermal injection of nerve growth factor: neutrophil-dependent and -independent events. J Pathol 2002;197:245–55.

54. Bergmann I, Reiter R, Toyka KV, Koltzenburg M.Nerve growth factor evokes hyperalgesia in mice lackingthe low-affinity neurotrophin receptor p75. NeurosciLett 1998;255:87–90.

55. Petersen M, Segond von Banchet G, Heppelmann B,Koltzenburg M. Nerve growth factor regulates the

expression of bradykinin binding sites on adult sensoryneurons via the neurotrophin receptor p75. Neurosci-ence 1998;83:161–8.

56. Tokunaga J. The innervation of the diaphysis of thecat tibia. J Anat 1967;101:125–36.

57. Seike W. Electrophysiological and histological studieson the sensibility of the bone marrow nerve terminal.Yonago Acta Med 1976;20:192–211.

58. Cornelissen BP, Buma P, Rijkenhuizen AB, BarneveldA. Innervation of the equine mature and immatureproximal sesamoid bone by calcitonin gene-relatedpeptide and substance P-containing nerves. Am J VetRes 1998;59:1378–85.

59. Gronblad M, Liesi P, Korkala O, Karaharju E, Polak J.Innervation of human bone periosteum by peptidergicnerves. Anat Rec 1984;209:297–9.



2005;65:9426-9435. Cancer Res Kyle G. Halvorson, Kazufumi Kubota, Molly A. Sevcik, et al. BoneSkeletal Pain Induced by Prostate Tumor Cells Growing in A Blocking Antibody to Nerve Growth Factor Attenuates

Updated version

http://cancerres.aacrjournals.org/content/65/20/9426

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/65/20/9426.full#ref-list-1

This article cites 53 articles, 10 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/65/20/9426.full#related-urls

This article has been cited by 10 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/65/20/9426To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/content/65/20/9426.full#ref-list-1

http://cancerres.aacrjournals.org/content/65/20/9426.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



A Blocking Antibody to Nerve Growth Factor Attenuates Skeletal Pain … · A Blocking Antibody to...

Documents

Transcript of A Blocking Antibody to Nerve Growth Factor Attenuates Skeletal Pain … · A Blocking Antibody to...