Development 115, 213-219 (1992)Printed in Great Britain © The Company of Biologists Limited 1992

213

A 102 base pair sequence of the nicotinic acetylcholine receptor delta-

subunit gene confers regulation by muscle electrical activity

KENNETH G. CHAHINE, WADE WALKE and DANIEL GOLDMAN*

Menial Health Research Institute and Department of Biological Chemistry, The University of Michigan, Ann Arbor, MI 48109, USA

•To whom correspondence should be addressed

Summary

Muscle electrical activity suppresses expression of theembryonic-type (a, P, y, and 8) nicotinic acetylcholinereceptor (nAChR) genes. The molecular mechanism bywhich electrical activity regulates these genes is notknown. One approach to this problem is to identifyregions of the nAChR genes that mediate electricalregulation. Here we report results from such a study ofthe nAChR d-subunit gene. We cloned the rat d-subunitpromoter region and created an expression vector inwhich this DNA controlled the expression of a down-stream luciferase structural gene. The effect that muscleelectrical activity had on the expression from thispromoter was assayed by introducing this expressionvector into electrically stimulated and tetrodotoxin(TTX)-treated rat primary myotubes, and assaying forluciferase activity. These myotubes, when stimulated

with extracellular electrodes, suppressed endogenousembryonic-type nAChR gene expression compared tothose treated with TTX. Transfection of these cells withd-promoter-luciferase expression vectors resulted in thed-promoter conferring electrical regulation on luciferaseexpression. Additional experiments using deletions fromthe 5' end of the ^-promoter region have identified anelement between -677 and -550 bp that suppressed 6-promoter activity and a minimal 102 bp sequence thatpromotes and regulates luciferase expression in responseto muscle electrical activity. This latter sequence alsocontains all the necessary elements to confer tissue anddevelopmental stage-specific expression.

Key words, muscle, nicotinic acetylcholine receptor,promoter, gene expression, electrical activity.

Introduction

The muscle nAChR is a pentameric integral membraneprotein that mediates communication between nerveand muscle (Schuetze and Role, 1987). Prior toinnervation nAChRs are distributed throughout themuscles surface. However, after innervation they areconcentrated beneath the neuromuscular junction(NMJ). The loss of receptors from extrajunctionalregions of the muscle fiber is largely a result of nerve-induced muscle activity suppressing nAChR geneexpression (Goldman et al., 1988; Merhe and Korn-hauser, 1989). This activity-dependent regulation isreversible, since denervation of adult skeletal musclecauses these receptors to reappear throughout themuscle fiber's surface (Goldman et al., 1985; Merlie etal., 1984; Shieh et al., 1987).

The molecular mechanism by which muscle activitycontrols nAChR gene expression is not well under-stood. One approach to this problem is to identify thenAChR genes and characterize DNA sequences confer-ring activity-dependent regulation on their expression.This approach has resulted in the cloning of the chick a-

and S-, and mouse y- and <5-subunit gene promoters(Klarsfeld et al., 1987; Wang et al., 1990; Gardner etal., 1987; Baldwin and Burden, 1988). However,convenient systems for characterizing activity-depen-dent gene expression have been lacking. To date,transgenic animals have provided the only system forstudying electrical regulation of nAChR promoteractivity. These studies have shown that electricalregulation of the chick a^subunit promoter is mediatedby sequences located within 850 bp 5' to position +20 ofthe chick <*-subunit gene (Merlie and Kornhauser,1989).

In order to rapidly analyze nAChR promoters foractivity-dependent regulation we have identified a ratprimary muscle culture system whose nAChR genesrespond to muscle electrical activity in a fashion similarto that observed in vivo. We report here the cloning ofthe rat nAChR 6-subunit gene promoter and the use ofthis system to map a minimal 102 bp sequence thatallows muscle electrical activity to regulate expressionfrom this promoter. In addition, we show that this sameDNA retains tissue and developmental stage-specificexpression.

214 AT. G. Chahine, W. Walke and D. Goldman

Materials and methods

Cloning of the rat S-subunit nAChR promoterApproximately 5 x 10s phage from a Fisher rat genomic DNAlibrary (Stratagene) were screened with a rat nAChR 8-subunit, 32P-labelled, cDNA probe. A 7 kb fragment,containing exon 1, was subcloned into the pBS SK(+) vector(Stratagene) and charactenzed by Southern blot analysis fororientation and position of exon 1. A combination ofrestnction enzyme digestions and Southern blotting analysisresulted in the cloning of a 1.3 kb fragment of DNAcontaining part of the first intron and exon 1 at its 3' end. Thisclone is called BSSK(+)<5-l.

DNA sequencingUnidirectional deletions were generated by either exonu-clease m or Bal 31 digestions of restricted DNA (Maniatis etal., 1982) Single-stranded DNA was isolated from phagemidsaccording to manufactures directions (Stratagene) andsequenced using the dideoxy chain termination method ofSanger et al , 1977.

Expression vector constructs<5-gene sequences were subcloned into the pXPl or pXP2expression vectors 5' to the luciferase reporter gene (Nor-deen, 1988). Internal controls were the mouse creatine kinase(MCK) promoter (Jaynes et al., 1986) driving chlorampheni-col acetyltransferase expression (Luckow and Schutz, 1987)(MCKCAT), the SV40 promoter (Gorman et al., 1982)driving /3-galactosidase expression (SV4O/3gal) or the CMVpromoter (Boshart et al., 1985) dnving CAT expression

Cell culture and electrical stimulationPrimary rat muscle cell cutures were prepared as previouslydescribed (Goldman et al., 1991). Cells were plated oncollagen coated culture dishes at a density of 2000 cells/mm2

and grown in 20 mM HEPES, 2% chick embryo extract, 10%fetal calf serum, 10% horse serum, and 25 /Yg/ml gentamycin.Cultures were placed in a 37°C incubator with 8% CO2Generally, by day 4 myotubes have formed and the cultureswere treated with 3 £(g/ml cytosine arabinoside for 24 hours toinhibit fibroblast proliferation. Cultures were either treatedwith TTX (10 ̂ M) or stimulated on day 5 using previouslydescnbed conditions (Goldman et al., 1988). Bnefly, stimu-lating electrodes were immersed in the culture medium andthe muscles stimulated chronically for 3-7 days in 100 Hztrains, 1 sec duration, applied once every 100 sec Stimuluspulses within trains were of alternating polarity, their durationwas 0.5 msec, and their strength was 8 mA.

The mouse muscle cell line, C2C12, was cultured aspreviously described (Evans et al., 1987).

NIH 3T3 cells were grown in DMEM supplemented with10% calf serum and 25 /ig/ml gentamycin.

Transfections; lucif erase, CAT and fi-galactosidaseassaysTransfection of muscle cells in culture was performed byCaPO4 precipitation of DNA as previously descnbed (Gra-ham and Van der Eb, 1973), with the addition of a 2 minglycerol shock after 4 hours (Parker and Stark, 1979). Cellswere harvested 48-72 hours later. Luciferase, chlorampheni-col acetyltransferase (CAT) and /3-galactosidase assays wereperformed as previously described (Brasier et al , 1989;Neumann et al., 1987; Bradford, 1976)

RNA isolationRNA from cell culture and tissue was isolated using theguanidinium isothiocyanate procedure as previously de-scnbed (Chirgwin et al , 1979).

Primer extension assayA 25 nucleotide long oligodeoxynbonucleotide complemen-tary to a portion of exon 1 (+48 to +72) of the 5-subunit gene(see Fig. 1) was used for primer extensions as previouslydescnbed (Maniatis et al., 1982).

RNase protection assayRNase protection assays were carried out as previouslydescnbed (Goldman and Staple, 1989). The delta cloneBSSK6-1087/+96 linearized with PvuU generates a 440 bpprobe which spans most of exon 1 and extends 344 bp upsteamof the transcriptional start site. The muscle creatine kinaseclone, BSSKII(+) MCK, is a 292 nucleotide long BglU/Hindlll fragment corresponding to nucleotides 857-1149 ofthe mouse muscle creatine kinase subclone pMCKm36(Jaynes et al., 1986). The MCK probe protects two fragmentsin the RNase protection assay that reflects slight sequencedifferences between mouse and rat creatine kinase RNAs

Results

Analysis of the 6-subunit genes 5' flanking sequenceand identification of the transcriptional start siteThe 6-subunit promoter region was isolated from a ratgenomic library as described in Materials and methods.DNA sequencing revealed subclone BSSK(+)6-l is1,317 nucleotides long and contains part of the firstintron and all of exon 1 at its extreme 3' end (Fig. 1).The nucleotides corresponding to the start site oftranscription were mapped by RNase protection andprimer extension experiments (Fig. 2). The primerextension experiments showed denervated muscle andprimary rat myotubes initiate 6-subunit gene transcrip-tion at the A and T residues marked with an asterisk atpositions +1 and +2, respectively, in Fig. 1. Inaddition, denervated muscle also initiated transcriptionat position — 1. Consistent with these results were thoseobtained with RNase protections. Since RNase A onlycleaves 3' to pyrimidine residues and the probe is anantisense sequence, the high relative molecular massband on the gel is consistent with transcripts starting atnucleotide - 1 (RNase cleavage 3' to the C residuecomplementary to nucleotide —5 in Fig. 1) and theintermediate band is consistent with transcripts startingat nucleotides +1 and +2 (RNase cleavage 3' to the Tresidue complementary to nucleotide +1 in Fig. 1). Thelowest band is a result of probe secondary structure(data not shown).

No canonical TATA or CAAT boxes were foundupstream of the start site of transcription, although thestart site is centered at an 8 nucleotide stretch that isidentical to the 8 central nucleotides of the munneterminal deoxynucleotidyltransferase (TdT) genes in-itiator sequence (Smale and Baltimore, 1989). Thislatter sequence has been implicated to play a role inbasal promotion and proper initiation of transcription.

Comparison of the rat 6-subunit genes 5' flanking

Electrical regulation of nAChR 6-promoter activity 215

-1087 CACCCTCTCT

-1007 GAGGTGTGGC

-927 AGTCTGTTCC

-847 CCCACCTGAA

-7 67 GGTGTCAGTT

-687 CGGGGGAAAA

-607 GCTCACCTCA

-52 7 TAAATAGAAT

-4 4 7 CACACATGTA

-3 67 TAAAAGAAGC

-287 TATGTGTCAC

-207 CACCCTCTGC

-127 CCCTTAGGCT

-4 7 TCTTTCCAAA

+34 AACCCCAGTC

| W -1030TGGGAATTAA AGGTGTTGTG ATGGTTTGCA CATGCTTGGC CCAGGGAGTG GCACTATTAG

AAAGTGTGTC ACTGTGGTGG TGGGCTTGGA GACCCTCCTC CTAGCTGCCT AAGGATGCTC

I—• "89°CAGGTGAAGA TGTAGAACTC AGCTCCTCCT GCACCATGCC GGCCTAGATG CTGTCATGCT

TCTGAACCTG TAAGCCAGCC CCAATTAAAT GTTGTCCTTT ATAAAACTTA CATTGGTCAT

AGACCTGACT AAGGCAGGTG TGCACTGCCA CTCCTGGGTT AAGTGTAATA TTTTTAAAGA

CAGGTACAGC ACCAGCAAGA TGGTGCAATA AGTAACAGTT GCCTGCTGTG ACAAGCCTGG

I—• ~550

TAGAGAGAGA GAAAAACAAC TGTCACACAC ACACACACAC ACACACACAC ACACCAATAT

AAATGATAAA ATCGTCGAAC AATAGACTGT TTGATTTCCA CAGAACCACC TACAAACAGA

,-•-423 - 3 7 3 , — •

ACACATATAT ACACACTCCG TACACACATG TACACACTCC ATACACATAT ACCACATGCA

IGCAGCTGCTA ACATGTCTTT CACTTCAGTC CTTTAAGGAC TGAAGTGGCA GTAACTGACC

ACAGCTACCA GCATGCCACA CAGACACACA GAGACACATA CACACACACC ATTTGTCCCC

TACCAGGCCC CACCCTACCA ACTAGCAGTG GCAGTCCCTG CCTGGGATCT TTGCATTCTG

,-• -102 ,-• ~82CTGGCAAACC CCACCCTCTC ATCACCAGCC TTCAAGTATC AGATTGCGTT TCCGGCCTCT

* *GCCAGCACCT GTCCCCTTGC TTGCCTCATT CCACAGCCAA CAGGCTGAAG GGGAGACATA

+1 +11GGGGATGGCA GGGCCTGTGC CCACACTGGG GCTGCTGGCT GCCCTTGTTG

+104 TGTGTGgtaagggtggaaatgactcccttcctgggggccttctatgcccacctgggcccctcaccgcatggt

+17 6 gcccaccctcacatcatgcctaattcccactcccactcggccctttctaacccta

Fig. 1. DNA sequence of the 5' end of the rat nAChR 8- subunit gene. At the 3' end of the sequence is intron 1 typed insmall case lettering. Preceding intron 1 is exon 1 extending 5' to nucleotide + 1. Within this exon beginning with theinitiator ATG codon, in bold type, and extending to nucleotide +109 is the translated sequence typed in larger lettering.The transcnptional start sites (+1 and +2) are indicated by astensks(**) The oligonucleotide sequence (+48 to +72) usedin primer extention experiments is indicated with a thick underline, putative myogenic regulatory consensus sequences aredouble underlined and putative AP-2 consensus sequences are marked with a single thin underline The SHUE box (—139to —162) is marked with an overhead bracket A pahndromic sequence centered around the T residue at position —314 isindicated by a dashed underline. Vanous deletions used in this study are marked with arrows above the sequence withcorresponding si2e next to the arrow.

sequence with that of the published mouse and chick <5-subunit sequences (Baldwin and Burden, 1988; Wang etal., 1990) showed about 90% identity with the mousesequence for the 246 nucleotides upstream of the startsite of transcription. In contrast, the chick sequenceshowed little homology with the rat sequence except fortwo regions: one centered around postions -22 of therat (relative to transcriptional start site) and -110 of thechick (relative to translation inititiator ATG), whichcontains a consensus sequence for binding myogenicregulators and shows a 12/14 bp match; and the secondcentered around positions —147 of the rat and -192 ofthe chick, which contains part of the SHUE box(Crowder and Merlie, 1988) and is identical for 8nucleotides.

Upstream of the transcriptional start site, centered

around nucleotides -550 and —223, are two regions ofDNA that contain 15 and 12 CA repeats, respectively.CA repeats have also been found in the mouse 8- and y-subunit genes. Finally, there is a 27 bp palindromicregion centered around base pair -314 (dashed under-line in Fig. 1).

Identification of 102 bp sequence containing anelement conferring regulation by muscle electricalactivityWe have found that muscle activity appropriatelyregulates nAChR gene expression in rat primary musclecells. This effect is most pronounced when onecompares cells stimulated with extracellular electrodesto those treated with the sodium channel blocker, TTX.Specifically, the a-, f3-, y- and 6-subunits of the nAChR

216 K. G. Chahine, W. Walke and D. Goldman

SEQUENCING LADDERRNase

PROTECTIONS

Fig. 2. Identification of the 6-subunit genes transcriptionalstart site. Primer extension andRNase protections were used toidentify the transcriptional startsite of the rat nAChR 6-subunitgene. Sizes of bands weredetermined by comparing with aDNA sequencing ladder. Theextended products fromdenervated RNA correspond tonucleotides —1, +1 and +2(Fig 1), while those fromprimary culture myotubescorrespond to residues atpositions +1 and +2 (Fig. 1).The lowest band in the RNaseprotections is a result of probesecondary structure (data notshown). The next middle bandis consistent with transcriptioninitiating at nucleotides +1and/or +2 (Fig 1). The upperband is consistent withtranscripts initiating atnucleonde — 1.

are all suppressed by electrical activity, while theelectrically insensitive e-subunit and muscle creatinekinase genes are unaffected (K. G. Chahine and D.Goldman, unpublished data). Fig. 3A, shows the 6-subunit RNA is suppressed nearly 10-fold by electricalstimulation, while the creatine kinase gene (MCK) isslightly increased. Therefore, with a system in which tostudy muscle electrical activity established we isolatedthe 6-subunit promoter and began to identify cw-actingelements that mediate this effect.

The first intron and most of exon 1, including theinitiator ATG, were removed from the 3' end ofBSSK(+)6-l by digestion with Bal 31 exonuclease. Oneof the clones generated from this digestion,BSSK(+)61087/4, had its 3' end at nucleotide +11 andextended 1098 nucleotides in the 5' direction asdetermined by DNA sequencing (Fig. 1). This cloneserved as the parent for all further deletions. Unidirec-tional deletions were created from the 5' end of thisDNA using ExoIIl. The precise 5' end of each of thesedeletions was determined by DNA sequencing. Cloneswere named according to the number of 5' nucleotidesremaining upstream of the start site of transcription.These deleted prompters were subcloned into the pXPluciferase expression vector and transfected into ratprimary myotube cultures that were either stimulated tocontract with extracellular electrodes or kept inactiveby addition of TTX for 3-5 days. Following transfec-tion, the cells were returned to the stimulator orretreated with TTX and harvested 48-72 hours later.Transfection efficiency was normalized by co-transfect-ing cultures with MCKCAT. The MCK promoter likethe endogenous gene is not suppressed by muscleelectrical activity (unpublished data).

These experiments showed pXP61087/4 contained allthe necessary elements to, confer electrical regulation

on promoter activity (-1087/4 in Fig. 3B). The minimalcts-acting region that allowed promotion and stillretained electrical regulation was 102 bp upstream ofthe transciptional start site (Fig. 3B). Deletion of anadditional 20 bp from the 5' end of pXP6102/4 resultedin loss of promoter activity. Within these 20 bp resides aputative AP-2 consensus sequence which may berequired for promoter activity. These experiments alsoindicated that there is a negative element locatedbetween positions —1087 and —550. Removal of thiselement increased the activity of the promoter about 4-fold in TTX-treated cells. Additional deletions haveshown this element to reside between nucleotides -677and -550 (data not shown). There was a gradualdecrease in promoter activity down to deletionpXP6102/4. Further deletions resulted in a dramaticloss of promoter activity. Deletion pXP6102/4 retainedapproximately 65% of the activity observed inpXP 6550/4.

Elements conferring tissue and developmental stage-specific expression are contained within the same 102bp fragment that confers regulation by muscle activityThe muscle nAChR genes are specifically expressed inmuscle cells after myoblasts fuse into multinucleatedmyotubes. Thus these genes are expressed in a tissueand developmental stage-specific manner. We assessedwhether our various 6-subunit promoter deletionsretained tissue and developmental stage-specific ex-pression by comparing their promoter activity intransfected C2 myoblasts and myotubes, and NIH 3T3cells (Fig. 4). Transfection efficiency was normalized toa co-transfected SV4Oy3-gal expression vector. Theseexperiments revealed that all 6-promoter deletions thatcontained a minimum of 82 bp upstream of the start siteof transcription (pXP682/4) had a significantly higher

Electncl regulation of nAChR 6-promoter activity 217

MCK

A

B16000,

STIMULATEDTTX

550/41218/41

171/4 I139/4 1

102/4

STIM TTXS2/4|

Fig. 3. A 102 bp region of the 6-subunit promoter is regulated by muscle electrical activity (A) RNase protection assayshowing muscle electrical activity suppresses <5-subunit, but not creatine kinase RNA levels in primary muscle cultures.Primary muscle cultures were either stimulated to contract with extracellular electrodes (STIM) or paralyzed withtetrototoxin (TTX) for 5 days Total RNA (10 /xg) was used in RNase protection assays as described in Materials andmethods. The autoradiogram was exposed to X-ray film with an intensifying screen at -70°C for 15 hours. Graphs showquantitation of these RNase protections. Values are arbitrary optical density units determined from scanning densitometryError bars are ± standard deviation. (B) Graph showing promoter activity of various S-promoter deletions aftertransfection of expression vectors into stimulated or TTX-treated cells. Transfections were earned out with 15 ng of thepXP<5- luciferase expression vector (various promoter deletions shown as horizontal bars below the graph) and 15 fig ofMCKCAT. Luciferase activity was normalized to protein, however normalization to CAT activity gave similar results. Bargraphs are the average of quadruplicate transfections normalized to total protein, error bars are ± standard deviation

level of expression in myotubes than in myoblasts orNIH3T3 cells (Fig. 4). However, this level of expressionis significantly lower than constructs containing ad-ditional 5' DNA.

As was observed in transfected primary musclecultures a negative element is located between nucleo-tides -1087 and -550. This element is promiscuous inthat it is active in all cell lines and primary culturestested. Interestingly, <5-promoter activity increased over20-fold in C2 myoblasts and myotubes when thenegative element was removed as compared to a 6-foldincrease in NIH3T3 cells. These results are similar tothose observed with the chick 6-promoter (Wang et al.,1990).

Finally, we noticed two significant differences con-cerning 6-promoter activity in the C2 muscle cell linecompared to primary muscle cultures. First the negativeelement had a larger effect on 6-promoter activity in theCZ cell line than it did in the primary rat musclecultures. Therefore, its removal increased promoteractivity over 20-fold in C2 cultures (Fig. 4), but only byabout 3-fold in primary muscle cultures (Fig. 3).Second, the largest 5' deletion tested that still gavesignificant promoter activity in the C2 cells waspXP682/4 (Fig. 4), while in primary cells this constructwas at background levels of expression (Fig. 3). Thislatter result was not due to differences in transfectionefficiency (data not shown).

Discussion

We have presented data showing that rat primarymuscle cultures can be used to study mechanisms bywhich muscle electrical activity regulates nAChR geneexpression. In order to characterize the DNA se-quences conferring activity-dependent regulation onthese genes we cloned and sequenced the 6-subunitgenes 5' flanking DNA (Fig. 1). When 6-promoter/luci-ferase expression vectors were introduced into ratprimary muscle cultures that were either stimulatedwith extracellular electrodes or made inactive by TTX-treatment, the 6-promoter conferred activity-depen-dent regulation on luciferase expression (Fig. 3). Aseries of deletions from the 5' end of the 6-promoteridentified a minimal 102 bp sequence that was sufficientfor conferring this regulation on promoter activity.Further deletions resulted in loss of promoter activity,perhaps due to deletion of a putative AP2 site (Fig. 1).Expression from the MCKCAT vector used as aninternal control, like the endogenous gene, was notsuppressed by muscle electrical activity (data notshown).

One significant difference between the endogenousand transfected genes are the degree of regulation bymuscle electrical activity. Generally, we can suppressthe endogenous 6-RNA about 10-fold by electricalstimulation, yet the transfected 6-promoter is only

218 K. G. Chahine, W. Walke and D. Goldman

25

0 C2/MT• C2/MB

NIH 3T3

Fig. 4. An 82 bp region of the 6-subunit promoter retainstissue and developmental stage-specific expression. C2myoblasts (C2/MB), C2 myotubes (C2/MT) and NIH3T3cells were transfected with expression vectors containingthe luciferase structural gene driven by various 6-promoterdeletions. Transfections were earned out with 10 /ig of thepXP<5-luciferase construct (indicated on x-axis) and 10 /igof SV4O/3-gal or CMVCAT. Values are reported as theactivity relative to the full length pXP(51087/4 promoterconstruct expressed in myotubes. Data are the average oftriplicate transfections normalized to SV40/3-gal Myoblastand NIH3T3 transfections were also normalized toCMVCAT or protein with similar results. Error bars are ±standard deviation

suppressed about 4-fold (Fig. 3). Although this differ-ence may indicate additional post-transcriptional con-trols regulating <5-RNA levels, we believe it may beaccounted for by the observation that following calciumphosphate transfection the primary muscle culturesexperienced a 12-16 hour period of inactivity. Thiswould result in a higher level of promoter activity instimulated cells causing a reduction in the observedeffects of TTX. We have tried other transfectiontechniques, such as DEAE-dextran and lipofection,without success.

It is interesting that as we deleted DNA from the 5'end of the (5-promoter its activity was consistentlyaffected to a greater extent in TTX-treated cells than instimulated cells (Fig. 3B). Perhaps the proteins thatbind these upstream regulatory elements interact with asecond protein that is expressed at low levels or not atall in active muscle. This would be consistent with theobservation that ongoing protein synthesis is requiredto maintain the elevated level of nAChR expressionseen in inactive muscle (Duclert et al., 1990).

The nAChR a, ft, y, and <5-genes are all suppressedby muscle electrical activity. The sequences mediatingthis effect may be common among these differentgenes. We compared the electrically responsive 102 bpsequence of the rat (5-promoter to the other nAChRgene sequences. Except for the mouse and chick 6-promoters the other nAChR promoters showed littlesequence similarity to this 102 bp region. However, it isimportant to note that within this 102 bp region at

position —22 is a consensus sequence binding site formyogenic regulators (Lassar et al., 1991). Both thechick 5-(sense strand) and a-promoter (antisensestrand) sequences show a 12/14 and 10/14 match withthe rat (5-promoter sequence in this region. Myogenicregulatory sequences are found in all the nAChRpromoters characterized to date (Baldwin and Burden,1988; Gardner et al., 1987; Klarsfeld et al., 1987; Wanget al., 1990). Although these sequences play animportant role in activating muscle specific genes duringdevelopment (Wright et al., 1989) they may alsoparticipate in other regulatory mechanisms.

That this myogenic regulatory sequence at position—22 might participate in developmental regulation ofnAChR 5-subunit expression is supported by theobservation that pXP682/4 is expressed at significantlyhigher levels in C2 myotubes than myoblasts orN1H3T3 cells (Fig. 4). Albeit this level of expression isabout 5-fold lower than pXP6102/4. The reason for thislatter decrease in expression is likely due to removal ofa putative AP2 consensus sequence located within the20 bp deleted from pXP(5102/4 (Fig. 1).

Since the amount of expression drops as we deleteDNA from pXP6218/4 (Figs 3 and 4), it is likely thatadditional sequences involved in tissue and develop-mental stage-specific expression exist within this regionof DNA. Consistent with this interpretation, one findspXP(5218/4 contains an additional myogenic regulatorysequence (position —218) and 2 additional AP2 se-quences (positions —211 and —104) compared topXP<582/4. The reason we do not detect pXP<582/4expression in primary muscle cultures (Fig. 3) but dodetect it in C2 myotubes may simply reflect a differencein the level of expression of trans-acting factors in thesetwo sources of muscle cells.

Surprisingly, we find a low but above backgroundlevel of expression of various (5-promoter constructs inNIH3T3 cells (Fig. 4). The reason for this is not known.Clearly, the endogenous gene is not expressed in thesecells. One possibility is that there are additional cis-acting sequences required for tissue specific expression.Alternatively, as has been found for the skeletal o--actinpromoter (Yisraeli et al., 1986), appropriate DNAmethylation may be important for completely suppress-ing 6-promoter activity in non-muscle cells.

There are many parallels between myogenesis andmuscle inactivity: (1) they both cause induction ofnAChR gene expression (Evans et al., 1987); (2)myogenic regulators are induced in a developmentalstage-specific manner (Wright et al., 1989) and sup-pressed by muscle activity (Eftimie et al., 1991) as arethe nAChR genes (Evans et al., 1987; Goldman et al.,1988), and (3) DNA elements conferring developmen-tal stage-specific expression and regulation by electricalactivity have been localized to the same 102 bp region ofDNA that contains a consensus binding site formyogenic regulators (this report). Therefore, it istempting to speculate that this latter sequence partici-pates in both induction of muscle specific genes duringmyotube formation and responsiveness of the nAChRgenes to muscle activity. Since the trans-acting pro-

Electricl regulation of nAChR 6-promoter activity 219

tein(s) that binds this regulatory sequence may be oneof many hetero-dimers (Lassar et al., 1991), one mightbe able to obtain differential effects (developmentalversus electrical) depending on which dimer is bound tothis site.

We thank Suparna Bhalla for help with DNA sequencing,Dr. Jeffrey Chamberlain for the MCK promoter and cDNAfragment and we are grateful to Linda Harper for her help inisolating rat primary muscle cells and maintaining cellcultures. We would also like to thank members of the MHRIelectronics shop for their help in setting-up stimulators formuscle stimulation and the MHRI computing facility for helpwith quantitating autoradiograms.

ReferencesBaldwin, T. J. and Burden, S. J. (1988). Isolation and

characterization of the mouse acetylchobne receptor delta subunitgene. Identification of a 148-bp as-acting region that confersmyotube-speafic expression J Cell Biol 107, 2271-2279

Boshart, M., Weber, F., Jahn, G., Dorsch-Hasler, K., Fleckenstein,B. and Schaffner, W. (1985). A very strong enhancer is locatedupstream of an immediate early gene of human cytomegalovirusCell 41, 521-530.

Bradford, M. M. (1976) A rapid and sensitive method for thequanutation of rrucrogram quantities of protein utilizing theprinciple of protein-dye binding Anal Bwchem 72, 248-254

Brasier, A. R., Tate, J. E. and Habener, J. F. (1989) Optimized useof the firefly assay as a reporter gene in mammalian cell lines.BioTechmques 7, 1116-1122

Chlrgwin, J. M., Przybyla, A. E., MacDonald, R. J. and Rutter, W. J.(1979) Isolation of biologically active nbonucleic acid from sourcesenriched in nbonuclease. Biochemistry 18, 5294-5299

Crowder, M. C. and Merlie, J. P. (1988) Stepwise activation of themouse acetylchohne receptor 8- and y-subunit genes in clonal celllines Mol and Cell Biol 8, 5257-5267

Duclert, A., Piette, J. and Changeux, J. P. (1990). Induction ofacetylchohne receptor o^subunit gene expression in chick myotubesby blocking electrical activity requires ongoing protein synthesisProc Natl Acad Sci USA 87, 1391-1395.

Eftlmle, R., Brenner, H. R. and Buonanno, A. (1991) Myogenin andMyoD join a family of skeletal muscle genes regulated by electricalactivity Proc Nail Acad Sci USA 88, 1349-1353.

Evans, S., Goldman, D., Heinemann, S. and Patrick, J. (1987)Muscle acetylchohne receptor biosynthesis / Biol Chem 262,4911^916

Gardner, P. D., Heinemann, S. and Patrick, J. (1987).Transcnptional regulation of nicotinic acetylchohne receptorgenes Identification of control elements of a y-subunit gene MolBrain Res 3, 69-76

Goldman, D., Boulter, J., Heinemann, S. and Patrick, J. (1985)Muscle denervation increases the levels of two mRNAs coding forthe acetylchohne receptor a^subumt J Neurosci 5, 2553-2558.

Goldman, D., Brenner, H. R. and Heinemann, S. (1988)Acetylchohne receptor a-, /S-, y- and 6-subumt mRNA levels areregulated by muscle activity Neuron 1, 117-125

Goldman, D., Carison, B. M. and Staple, J. (1991). Induction ofadult-type nicotinic acetylchohne receptor gene expression innoninnervated regenerating muscle. Neuron 7, 649-658.

Goldman, D. and Staple, J. (1989) Spatial and temporal expression ofacetylchohne receptor RNAs in innervated and denervated ratsoleus muscle. Neuron 3, 219-228

Gorman, C. M., Moffat, L. F. and Howard, B. M. (1982)Recombinant genomes which express chloramphemcolacetyltransferase in mammalian cells Mol Cell. Biol 2,1044-1051

Graham, F. L. and Van der Eb, A. J. (1973). A new technique for theassay of infectivity of human adenovirus 5 DNA Virology 52,456-467.

Jaynes, J. B., Chamberlain, J. S., Buskin, J. N., Johnson, J. E. andHauschka, S. D. (1986) Transcnptional regulation of the musclecTeatine kinase gene and regulated expression in transfected mousemyoblasts Mol and Cell Biol 6, 2855-2864

Klarsfeld, A., Daubas, P., Bourachot, B. and Changeux, J. P. (1987)A 5'-flanking region of the chicken acetylchohne receptora^subunit gene confers tissue specificity and developmental controlof expression in transfected cells Mol and Cell Biol 7, 951-955

Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C ,Voronova, A., Baltimore, D. and Weintraub, H. (1991) Functionalactivity of myogemc HLH protems requires hetero-ohgomenzationwith E12/E47-like proteins in vivo. Cell 66, 305-315

Luckow, B. and Schutz, G. (1987) CAT constructions with multipleunique restriction sites for the functional analysis of eukaryoticpromoters and regulatory elements Nucleic Acids Res 15, 5490

Manlatis, T., Fritsch, E. F. and Sambrook, J. (1982) MolecularCloning A Laboratory Manual (Cold Spring Harbor, New York.Cold Spring Harbor Laboratory).

Merile, J. P., Isenberg, K. E., Russell, S. D. and Sanes, J. R. (1984)Denervation supersensitivity in skeletal muscle Analysis with acloned cDNA probe J Cell Biol 99, 332-335

Merlie, J. P. and Komhauser, J. M. (1989) Neural regulation of geneexpression by an acetylchohne receptor promoter in muscle oftransgenic mice Neuron 2, 1295-1300

Neumann, J. R., Morency, C. A. and Russian, K. O. (1987) A novelrapid assay for chloramphemcol acetyltransferase gene expressionBioTechmques 5, 444-447

Nordeen, S. K. (1988). Luciferase reporter gene vectors for analysis ofpromoters and enhancers. BioTechmques 6, 454-457

Parker, B. A. and Stark, G. R. (1979) Regulation of simian virus 40transcription' sensitive analysis of the RNA present early ininfections by virus or virus DNA J Virology 31, 360-369

Sanger, F., Nicklen, S. and Coulson, A. R. (1977) DNA sequencingwith chain-terminating inhibitors Proc Natl Acad Sci USA 74,5463-5467

Schuetze, S. M. and Role, L. W. (1987) Developmental regulation ofnicotiruc acetylchohne receptors Ann Rev Neurosci 10, 403-457

Shieh, B. H., Ballivet, M. and S<Junidt, J. (1987) Quanutation of analpha-subumt splicing intermediate' Evidence for transcnptionalactivation in the control of acetylchohne receptor expression indenervated chick skeletal muscle J Cell Biol 104, 1337-1341

Smale, S. T. and Baltimore, D. (1989) The "initiator" as atranscnptional control element Cell 57, 103-113.

Wang, X-M., Tsay, H-J. and Schmidt, J. (1990). Expression of theacetylchohne receptor 6-subumt gene in differentiating chickmuscle cells is activated by an element that contains two 16 bpcopies of a segment of the o"-subunit enhancer EMBO J 9, 783-790

Wright, W. E., Sassoon, D. A. and Lin, V. K. (1989) Myogenin, afactor regulating myogenesis, has a domain homologous to MyoDCell 56, 607-617

Ylsraeii, J., Adelsteln, R. S., MeUoul, D., Nudel, U., Yaffe, D. andCedar, H. (1986) Muscle-specific activation of a methylatedchimenc actin gene Cell 46, 409-416

{Accepted 22 January 1992)