79fe0289840d26602035d00b8ffa4001 Understanding-Strings

10
Understanding Strings Goals and Objectives

description

U S

Transcript of 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Page 1: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Understanding StringsGoals and Objectives

Page 2: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Why Work with Strings?• Numbers are stored in a computer

• In memory, on a flash drive, on a hard drive

• .mp4 01001001 01000100 00110011 00000011 00000000 0000000000000000 00000000 00000000 01010000 01010100 0100001101001111 01001110 00000000 00000000 00000000 0000011000000000 00000000 00000000 01000010 01101100 0111010101100101 01110011 01010100 01000001 01001100 01000010

10001001 01010000 01001110 01000111 00001101 0000101000011010 00001010 00000000 00000000 00000000 0000110101001001 01001000 01000100 01010010 00000000 0000000000000001 00101100 00000000 00000000 00000000 1100100000001000 00000110 00000000 00000000 00000000 01010010

01010100 01101000 01100101 00100000 01000011 0110000101110011 01101011 00100000 01101111 01100110 0010000001000001 01101101 01101111 01101110 01110100 0110100101101100 01101100 01100001 01100100 01101111 0000101001000101 01100100 01100111 01100001 01110010 00100000

Page 3: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Why Work with Strings?• Numbers are stored in a computer

• In memory, on a flash drive, on a hard drive

• .mp4

• .png

01001001 01000100 00110011 00000011 00000000 0000000000000000 00000000 00000000 01010000 01010100 0100001101001111 01001110 00000000 00000000 00000000 0000011000000000 00000000 00000000 01000010 01101100 0111010101100101 01110011 01010100 01000001 01001100 01000010

10001001 01010000 01001110 01000111 00001101 0000101000011010 00001010 00000000 00000000 00000000 0000110101001001 01001000 01000100 01010010 00000000 0000000000000001 00101100 00000000 00000000 00000000 1100100000001000 00000110 00000000 00000000 00000000 01010010

01010100 01101000 01100101 00100000 01000011 0110000101110011 01101011 00100000 01101111 01100110 0010000001000001 01101101 01101111 01101110 01110100 0110100101101100 01101100 01100001 01100100 01101111 0000101001000101 01100100 01100111 01100001 01110010 00100000

Page 4: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Why Work with Strings?• Numbers are stored in a computer

• In memory, on a flash drive, on a hard drive

• .mp4

• .png

• .txt

01001001 01000100 00110011 00000011 00000000 0000000000000000 00000000 00000000 01010000 01010100 0100001101001111 01001110 00000000 00000000 00000000 0000011000000000 00000000 00000000 01000010 01101100 0111010101100101 01110011 01010100 01000001 01001100 01000010

10001001 01010000 01001110 01000111 00001101 0000101000011010 00001010 00000000 00000000 00000000 0000110101001001 01001000 01000100 01010010 00000000 0000000000000001 00101100 00000000 00000000 00000000 1100100000001000 00000110 00000000 00000000 00000000 01010010

01010100 01101000 01100101 00100000 01000011 0110000101110011 01101011 00100000 01101111 01100110 0010000001000001 01101101 01101111 01101110 01110100 0110100101101100 01101100 01100001 01100100 01101111 0000101001000101 01100100 01100111 01100001 01110010 00100000

Page 5: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Information Is Often Readable• We use Strings to store readable data

• Readable by … you, or a computer

• Find patterns, knowledge, information>JX477166v1CGGACACACAAAAAGAAAAAAGGTTTTTTAAGATTTTTTGTGTGCGAGTAACTATGAGGAAGATTAACAGTTTTCCTCAGTTTAAGGTATACACTGAAATTGAGATTGAGATTCTCCTCTTTGCTATTCTGTAACTTTCCCTGGTTGTGACAATTGAATCAGTTTTATCTATTACCAATTACCATCAACATGGTATGTCTAGTGATCTTGGGACTCTTCTTCATCTGGTTTTTCCTAGAGCTCTGAATCTATTTTGTGAGAAGTTCATCCAAACGACCCA

<div class="split-3-layout layout theme-base"><h2 class="section-heading"></h2><div class="column"> <article class="story theme-summary

cdatetime,address,district,beat,grid,crimedescr,ucr_ncic_code,latitude,longitude1/1/06 0:00,2082 EXPEDITION WAY,5,5A,1512,459 PC BURGLARY RESIDENCE,2204,38.47350069,-121.49018581/1/06 0:00,4 PALEN CT,2,2A,212,10851(A)VC TAKE VEH W/O OWNER,2404,38.65784584,-121.46210091/1/06 0:00,22 BECKFORD CT,6,6C,1443,476 PC PASS FICTICIOUS CHECK,2501,38.50677377,-121.4269508

Page 6: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Information Is Often Readable• We use Strings to store readable data

• Readable by … you, or a computer

• Find patterns, knowledge, information>JX477166v1CGGACACACAAAAAGAAAAAAGGTTTTTTAAGATTTTTTGTGTGCGAGTAACTATGAGGAAGATTAACAGTTTTCCTCAGTTTAAGGTATACACTGAAATTGAGATTGAGATTCTCCTCTTTGCTATTCTGTAACTTTCCCTGGTTGTGACAATTGAATCAGTTTTATCTATTACCAATTACCATCAACATGGTATGTCTAGTGATCTTGGGACTCTTCTTCATCTGGTTTTTCCTAGAGCTCTGAATCTATTTTGTGAGAAGTTCATCCAAACGACCCA

<div class="split-3-layout layout theme-base"><h2 class="section-heading"></h2><div class="column"> <article class="story theme-summary

cdatetime,address,district,beat,grid,crimedescr,ucr_ncic_code,latitude,longitude1/1/06 0:00,2082 EXPEDITION WAY,5,5A,1512,459 PC BURGLARY RESIDENCE,2204,38.47350069,-121.49018581/1/06 0:00,4 PALEN CT,2,2A,212,10851(A)VC TAKE VEH W/O OWNER,2404,38.65784584,-121.46210091/1/06 0:00,22 BECKFORD CT,6,6C,1443,476 PC PASS FICTICIOUS CHECK,2501,38.50677377,-121.4269508

>JX477166v1CGGACACACAAAAAGAAAAAAGGTTTTTTAAGATTTTTTGTGTGCGAGTAACTATGAGGAAGATTAACAGTTTTCCTCAGTTTAAGGTATACACTGAAATTGAGATTGAGATTCTCCTCTTTGCTATTCTGTAACTTTCCCTGGTTGTGACAATTGAATCAGTTTTATCTATTACCAATTACCATCAACATGGTATGTCTAGTGATCTTGGGACTCTTCTTCATCTGGTTTTTCCTAGAGCTCTGAATCTATTTTGTGAGAAGTTCATCCAAACGACCCA

Page 7: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Information Is Often Readable• We use Strings to store readable data

• Readable by … you, or a computer

• Find patterns, knowledge, information>JX477166v1CGGACACACAAAAAGAAAAAAGGTTTTTTAAGATTTTTTGTGTGCGAGTAACTATGAGGAAGATTAACAGTTTTCCTCAGTTTAAGGTATACACTGAAATTGAGATTGAGATTCTCCTCTTTGCTATTCTGTAACTTTCCCTGGTTGTGACAATTGAATCAGTTTTATCTATTACCAATTACCATCAACATGGTATGTCTAGTGATCTTGGGACTCTTCTTCATCTGGTTTTTCCTAGAGCTCTGAATCTATTTTGTGAGAAGTTCATCCAAACGACCCA

<div class="split-3-layout layout theme-base"><h2 class="section-heading"></h2><div class="column"> <article class="story theme-summary

cdatetime,address,district,beat,grid,crimedescr,ucr_ncic_code,latitude,longitude1/1/06 0:00,2082 EXPEDITION WAY,5,5A,1512,459 PC BURGLARY RESIDENCE,2204,38.47350069,-121.49018581/1/06 0:00,4 PALEN CT,2,2A,212,10851(A)VC TAKE VEH W/O OWNER,2404,38.65784584,-121.46210091/1/06 0:00,22 BECKFORD CT,6,6C,1443,476 PC PASS FICTICIOUS CHECK,2501,38.50677377,-121.4269508

<div class="split-3-layout layout theme-base"><h2 class="section-heading"></h2><div class="column"> <article class="story theme-summary

Page 8: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Information Is Often Readable• We use Strings to store readable data

• Readable by … you, or a computer

• Find patterns, knowledge, information>JX477166v1CGGACACACAAAAAGAAAAAAGGTTTTTTAAGATTTTTTGTGTGCGAGTAACTATGAGGAAGATTAACAGTTTTCCTCAGTTTAAGGTATACACTGAAATTGAGATTGAGATTCTCCTCTTTGCTATTCTGTAACTTTCCCTGGTTGTGACAATTGAATCAGTTTTATCTATTACCAATTACCATCAACATGGTATGTCTAGTGATCTTGGGACTCTTCTTCATCTGGTTTTTCCTAGAGCTCTGAATCTATTTTGTGAGAAGTTCATCCAAACGACCCA

<div class="split-3-layout layout theme-base"><h2 class="section-heading"></h2><div class="column"> <article class="story theme-summary

cdatetime,address,district,beat,grid,crimedescr,ucr_ncic_code,latitude,longitude1/1/06 0:00,2082 EXPEDITION WAY,5,5A,1512,459 PC BURGLARY RESIDENCE,2204,38.47350069,-121.49018581/1/06 0:00,4 PALEN CT,2,2A,212,10851(A)VC TAKE VEH W/O OWNER,2404,38.65784584,-121.46210091/1/06 0:00,22 BECKFORD CT,6,6C,1443,476 PC PASS FICTICIOUS CHECK,2501,38.50677377,-121.4269508

cdatetime,address,district,beat,grid,crimedescr,ucr_ncic_code,latitude,longitude1/1/06 0:00,2082 EXPEDITION WAY,5,5A,1512,***,2204,38.47350069,-121.49018581/1/06 0:00,4 PALEN CT,2,2A,212,***,2404,38.65784584,-121.46210091/1/06 0:00,22 BECKFORD CT,6,6C,1443,***,2501,38.50677377,-121.4269508

Page 9: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Goals for Lesson

Page 10: 79fe0289840d26602035d00b8ffa4001 Understanding-Strings

Goals for Lesson• Learn about the Java String class

• Details, idioms, programming experience

• Common String methods

• Learn about Java types and operators

• Numeric types and operators as well as String• int and double types

• Finding patterns and information

• Searching, repeating, reasoning


Heart Strings and Purse Strings: Carryover Effects of ...gruberpeplab.com/.../Lecture13_Lerner2004_Heartstringspursestrings.pdfHeart Strings and Purse Strings avoid taking in anything

Heart Strings and Purse Strings: Carryover Effects of ...gruberpeplab.com/.../Lecture13_Lerner2004_Heartstringspursestrings.pdfHeart Strings and Purse Strings avoid taking in anything

Strings: Strings? concatenate (join) + make multiple copies using * compare: > =

Strings: Strings? concatenate (join) + make multiple copies using * compare: > =

Connection Strings

Connection Strings

C# Strings

C# Strings

1 Strings and String Operations What is a Strings? Internal Representation of Strings Getting Substrings from a String Concatenating Strings

1 Strings and String Operations What is a Strings? Internal Representation of Strings Getting Substrings from a String Concatenating Strings

Structures of String Matching and Data Compression · strings are texts (strings of letters and punctuation marks), programs (strings of operations), and genetic data (strings of

Structures of String Matching and Data Compression · strings are texts (strings of letters and punctuation marks), programs (strings of operations), and genetic data (strings of

BOWED STRINGS REQUIREMENTS AND INFORMATION · Bowed strings requirements and information. 8 Page-turns: Examiners will be understanding if a page-turn causes a lack of continuity

BOWED STRINGS REQUIREMENTS AND INFORMATION · Bowed strings requirements and information. 8 Page-turns: Examiners will be understanding if a page-turn causes a lack of continuity

Drop2 Voicing minor - joey-web.com · © jazz guitar style master 3-6 strings 3-6 strings 2-5 strings 2-5 strings 1-4 strings 1-4 strings 2-6

Drop2 Voicing minor - joey-web.com · © jazz guitar style master 3-6 strings 3-6 strings 2-5 strings 2-5 strings 1-4 strings 1-4 strings 2-6

Puppet Strings

Puppet Strings

09. Strings

09. Strings

Broken Strings

Broken Strings

ARM Assembler - rigwit.co.ukrigwit.co.uk/ARMBook/slides/slides07.pdfARM Assembler Strings Strings – p. 1/16. Characters or Strings

ARM Assembler - rigwit.co.ukrigwit.co.uk/ARMBook/slides/slides07.pdfARM Assembler Strings Strings – p. 1/16. Characters or Strings

EXCELLENCE AWARD WINNER* iTAS Best Analytics & Reporting ... · Understanding Basic Syntax Data Types & Variables Operators Conditional Statments Loops Functions R Objects - Strings

EXCELLENCE AWARD WINNER* iTAS Best Analytics & Reporting ... · Understanding Basic Syntax Data Types & Variables Operators Conditional Statments Loops Functions R Objects - Strings

Heart strings

Heart strings

Coupled Currents in Cosmic Strings fileOutline 1. How do cosmic strings arise? 2. Some numbers on cosmic strings. 3. How do cosmic strings evolve? 4. Cosmic strings in eld theory.

Coupled Currents in Cosmic Strings fileOutline 1. How do cosmic strings arise? 2. Some numbers on cosmic strings. 3. How do cosmic strings evolve? 4. Cosmic strings in eld theory.

Manipulating Strings. 2 Topics Manipulate strings Manipulate strings Parse strings Parse strings Compare strings Compare strings Handle form submissions.

Manipulating Strings. 2 Topics Manipulate strings Manipulate strings Parse strings Parse strings Compare strings Compare strings Handle form submissions.

  · Web viewof Strings, Hours String Methods, String Testing Methods, Formatting the Strings, Working with Characters, Sorting Strings, Searching in the Strings, Finding Number

  · Web viewof Strings, Hours String Methods, String Testing Methods, Formatting the Strings, Working with Characters, Sorting Strings, Searching in the Strings, Finding Number

STRINGS & STRING HANDLING FUNCTIONS STRINGS & STRING HANDLING FUNCTIONS.

STRINGS & STRING HANDLING FUNCTIONS STRINGS & STRING HANDLING FUNCTIONS.

Human and Machine Understanding of normal Language (NL) Character Strings Presented by Peter Tripodes.

Human and Machine Understanding of normal Language (NL) Character Strings Presented by Peter Tripodes.

Algorithms and Data Structures for Strings, Points and ... · Algorithms and Data Structures for Strings, Points and Integers or, Points about Strings and Strings about Points Vind,

Algorithms and Data Structures for Strings, Points and ... · Algorithms and Data Structures for Strings, Points and Integers or, Points about Strings and Strings about Points Vind,