ENTOMOPATÓGENOS Beauveria bassiana (Bassi) Y Metarhizium ...
6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for....
Transcript of 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for....
![Page 1: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/1.jpg)
Supplementary Information for
New natural products isolated from Metarhizium robertsii ARSEF 23 by
chemical screening and identification of the gene cluster through
engineered biosynthesis in Aspergillus nidulans A1145
Hiroki Kato, Yuta Tsunematsu, Tsuyoshi Yamamoto, Takuya Namiki, Shinji Kishimoto,
Hiroshi Noguchi and Kenji Watanabe
Department of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526, Japan
*Correspondence e-mail: [email protected]
S1
![Page 2: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/2.jpg)
Table of Contents
1. Supplementary Methods ................................................................................................. S3–S51.1 Metabolic profile of Metarhizium robertsii ARSEF 23..............................................S31.2 Construction of pKW16020, pKW16025 and pKW16026 for de novo
production of 5 and 6 in Aspergillus nidulans A1145. ....................................... S4–S5
2. Supplementary Results ................................................................................................. S6–S22Supplementary Table 1. Oligonucleotide primer sequences. ............................................... S6
2.1 Chemical characterization of 3. ................................................................................ S72.2 Chemical characterization of 1. ........................................................................ S8–S122.3 Chemical characterization of 2. ...................................................................... S13–S172.4 Chemical characterization of 6........................................................................ S18–S21
3. Supplementary References ................................................................................................. S22
S2
![Page 3: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/3.jpg)
1. Supplementary Methods
1.1 Metabolic profile of Metarhizium robertsii ARSEF 23.
Supplementary Figure 1. UHPLC trace of metabolic extracts from Metarhizium robertsii
ARSEF 23 cultured in (a) YPD or (b) MYG liquid media, and (c) UV–Vis spectra of 1–3. All
UHPLC traces were monitored at 280 nm.
S3
![Page 4: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/4.jpg)
1.2 Construction of pKW16020, pKW16025 and pKW16026 for de novo production of
5 and 6 in Aspergillus nidulans A1145
For de novo production of 5 and 6 in Aspergillus nidulans A1145, we constructed five vectors
for expressing subA, subC and subD. The construction of those vectors was accomplished in
situ using the endogenous homologous recombination activity of Saccharomyces cerevisiae.
pKW200931 was linearized by restriction digestion with Swa I (10 units). subA with its
original terminator was amplified from M. robertsii ARSEF 23 genomic DNA using the
pKW16020_MAA_07496_F1/pKW16020_MAA_07496_R1 primer set (Supplementary
Table 1). These DNA fragments were simultaneously introduced into S. cerevisiae BY4741
to combine them into an intact plasmid in situ by homologous recombination. The resulting
plasmid was amplified in E. coli for restriction digestion analysis and later sequenced to
confirm its identity. This plasmid was named pKW16020 (Supplementary Figure 2).
pKW100292 was linearized by restriction digestion with Swa I (10 units). subC with
its original terminator was amplified from M. robertsii ARSEF 23 genomic DNA using the
pKW16025_F/pKW16025_R primer set (Supplementary Table 1). These DNA fragments
were simultaneously introduced into S. cerevisiae BY4741 to combine them into an intact
plasmid in situ by homologous recombination. The resulting plasmid was amplified in E. coli
for restriction digestion analysis and later sequenced to confirm its identity. This plasmid was
named pKW16025 (Supplementary Figure 2).
pKW100352 was linearized by restriction digestion with Swa I (10 units). subD with
its original terminator was amplified from M. robertsii ARSEF 23 genomic DNA using the
pKW16026_F/pKW16026_R primer set (Supplementary Table 1). These DNA fragments
were simultaneously introduced into S. cerevisiae BY4741 to combine them into an intact
plasmid in situ by homologous recombination. The resulting plasmid was amplified in E. coli
for restriction digestion analysis and later sequenced to confirm its identity. This plasmid was
named pKW16026 (Supplementary Figure 2).
S4
![Page 5: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/5.jpg)
Supplementary Figure 2. Maps of plasmids pKW16020, pKW16025 and pKW16026.
S5
![Page 6: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/6.jpg)
2. Supplementary Results
Supplementary Table 1. Oligonucleotide primer sequences. DNA primers were designed
based on the sequence information obtained from the M. robertsii ARSEF 23 genome
sequence database.
Primer name Sequence, 5'-3'
pKW16020_MAA_07496_F1 TCCCCAGCATCATTACACCTCAGCATTAATTAAATGCGTGTAAATACACCATCTCTATTGATATGC
pKW16020_MAA_07496_R1TGTCCTCCCTCGGACATACACAGAATAC
pKW16025_F ACAATAAACCCCACAGAAGGCATTTATGGCGAAGGAAGCAAAAATGAAGGCC
pKW16025_R AGACCCAACAACCATGATACCAGGGGATTTAAATATACGACAGGCGGCTCATTTAGGTC
pKW16026_F ATTACCCCGCCACATAGACACATCTAAACAATGTCCCCAAGCGCGCCAAACAC
pKW16026_R TCGAAAGGGAGTCATCCAATTTAAATTGGACAATCGTTGTGTGCTCTGTGG
S6
![Page 7: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/7.jpg)
2.1 Chemical characterization of 3.
Supplementary Table 2. NMR data of compound 3 in CD3OD. The molecular formula of 3 was established by mass data [ESI-MS: m/z 427 (M+H)+; HRESIMS: m/z 427.2841 (M+H)+, calcd. for C27H39O4
+, 427.2843, = 0.2 mmu].
S7
![Page 8: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/8.jpg)
2.2 Chemical characterization of 1.
Supplementary Table 3. NMR data of compound 1 in CD3OD. The molecular formula of 1 was established by mass data [ESI-MS: m/z 443 (M+H)+; HRESIMS: m/z 443.2791 (M+H)+, calcd. for C27H39O5
+, 443.2792, = 0.1 mmu]. [α]D22 –94.9 (c 1.2, CH3OH).
DQF–COSY: double-quantum filtered correlated spectroscopyHMBC: heteronuclear multiple bond correlationNOESY: nuclear Overhauser effect correlated spectroscopy
S8
![Page 9: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/9.jpg)
position H [ppm], XH, multi., (J [Hz])a C [ppm]b DQF–COSYa HMBCa
1 a 1.44 1H dt (13.0, 4.6) 26.3 1b, 2a, 2b b 1.58 1H dd (4.6, 13.0) 1a, 2b 2
2 a 2.07 1H m 32.1 1a, 2b, 10 1, 3, 4, 10, 19b 2.50 1H m 1a, 1b, 2a, 10 1, 3, 19
3 149.9
4 2.21 1H dd (4.6, 11.4) 56.6 20a, 20b2, 3, 5, 10, 19, 20
5 39.66 a 1.40 1H dt (2.9, 12.6) 35.9 6b, 7 5, 7, 8
b 1.91 1H ddd (1.6, 9.9, 12.6) 6a, 7 5, 7, 87 1.78 2H m 23.3 6a, 6b, 8 5, 8, 98 3.20 1H dd (3.6, 11.5) 88.8 7 6, 7, 119 45.5
10 1.77 1H dd (3.5, 13.1) 46.4 2a, 2b 1, 5, 911 1.50 1H dd (3.5, 11.3) 49.2 11b, 12 8, 9
1.96 1H m 11a, 1212 4.80 1H m 75.6 11a, 11b, 13 13, 1413 5.64 1H dd (1.8, 8.2) 128.1 12, 15, 16 11, 14, 15, 1614 138.915 3.94 2H d (1.8) 67.9 13 13, 14, 1616 1.70 3H s 14.1 13 13, 14, 1517 0.87 3H s 17.5 8, 9, 10, 1118 0.98 3H s 25.1 4, 5, 6, 1019 a 4.25 1H bs 110.6 19b 2, 3, 4
b 4.49 1H bs 19a 2, 3, 420 a 2.60 1H dd (4.6, 13.6) 22.8 4, 20b 3, 21
b 2.77 1H dd (11.4, 13.6) 4, 20a 4, 21, 2221 103.422 169.423 109.524 156.625 168.526 2.19 3H s 17.3 22, 23, 2427 1.92 3H s 10.4 22, 23, 24
aRecorded at 500 MHz. bRecorded at 125 MHz.
S9
![Page 10: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/10.jpg)
Supplementary Figure 3. 1H NMR (500 MHz) spectrum of 1 in CD3OD.
Supplementary Figure 4. 13C NMR (125 MHz) spectrum of 1 in CD3OD.
S10
![Page 11: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/11.jpg)
Supplementary Figure 5. DQF–COSY (500 MHz) spectrum of 1 in CD3OD.
Supplementary Figure 6. HMQC (500 MHz) spectrum of 1 in CD3OD.
S11
![Page 12: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/12.jpg)
Supplementary Figure 7. HMBC (500 MHz) spectrum of 1 in CD3OD.
Supplementary Figure 8. NOESY (500 MHz) spectrum of 1 in CD3OD.
S12
![Page 13: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/13.jpg)
2.3 Chemical characterization of compound 2.Supplementary Table 4. NMR data of compound 2 in CD3OD. The molecular formula of 2 was established by mass data [ESI-MS: m/z 445 (M+H)+; HRESIMS: m/z 445.2948 (M+H)+, calcd. for C27H41O5
+, 445.2949, = 0.1 mmu]. [α]D23 +57.4 (c 0.75, CH3OH).
S13
![Page 14: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/14.jpg)
positionH [ppm], XH, multi., (J
[Hz])a C [ppm]b DQF–COSYa HMBCa
1 a 1.47 1H m 26.2 2b 10b 1.59 1H m 2a, 2b 10
2 a 2.08 1H dd (3.5, 13.6) 32.1 1b, 2bb 2.50 1H dt (5.8, 13.6) 1a, 1b, 2a
3 149.84 2.19 1H m 56.6 20a, 20b5 39.66 a 1.39 1H dt (2.9, 13.3) 36.0 6b, 7 5, 10
b 1.91 1H m 6a, 7 5, 7, 107 1.80 2H m 23.4 6a, 6b, 8 6, 88 3.15 1H dd (4.3, 11.0) 88.7 7a, 7b 69 45.1
10 1.78 1H m 46.7 811 a 1.41 1H m 47.4 12
b 1.80 1H m 12 8, 12
12 4.08 1H m 78.011a, 11b, 13a, 13b
13 a 1.53 1H m 41.4 12 12, 15, 16b 1.68 1H m 12 12, 15, 16
14 1.72 1H m 34.6 15, 1615 3.41 2H m 67.9 14 13, 1616 0.95 3H d (6.8) 17.5 14 13, 14, 1517 0.87 3H s 18.2 8, 9, 10, 1118 0.96 3H s 25.2 4, 5, 6, 1019 a 4.23 1H br s 110.7 19b 2, 4
b 4.47 1H br s 19a 2, 420 a 2.59 1H dd (4.3, 13.2) 22.7 4
b 2.77 1H dd (11.9, 13.2) 4 3, 4, 21, 2221 103.822 168.123 108.924 156.825 168.226 2.18 3H s 17.3 23, 2427 1.85 3H s 10.4 22, 23, 24
aRecorded at 500 MHz. bRecorded at 125 MHz.
S14
![Page 15: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/15.jpg)
Supplementary Figure 9. 1H NMR (500 MHz) spectrum of 2 in CD3OD.
Supplementary Figure 10. 13C NMR (125 MHz) spectrum of 2 in CD3OD.
S15
![Page 16: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/16.jpg)
Supplementary Figure 11. DQF–COSY (500 MHz) spectrum of 2 in CD3OD.
Supplementary Figure 12. HMQC (500 MHz) spectrum of 2 in CD3OD.
S16
![Page 17: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/17.jpg)
Supplementary Figure 13. HMBC (500 MHz) spectrum of 2 in CD3OD.
Supplementary Figure 14. NOESY (500 MHz) spectrum of 2 in CD3OD.
S17
![Page 18: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/18.jpg)
2.4 Chemical characterization of 6.Supplementary Table 5. NMR data of compound 6 in CDCl3. The molecular formula of 6 was established by mass data [ESI-MS: m/z 413 (M+H)+; HRESIMS: m/z 413.3046 (M+H)+, calcd. for C27H41O3
+, 413.3050, = 0.4 mmu].
position H [ppm], XH, multi., (J [Hz])a C [ppm]b DQF–COSYa HMBCa
1 165.32 100.53 166.14 107.25 156.26 2.20 3H s 17.3 4, 57 1.88 3H s 9.7 3, 4, 51' 3.29 2H d (7.4) 23.4 2' 1, 2, 3, 2', 3'2' 5.32 m 120.5 1'3' 142.14' 2.13 m 39.8 5' 2', 3'5' 2.07 m 25.9 4', 6'6' 5.05 m 123.3 5'7' 136.38' 1.95 m 39.8 9'9' 2.04 m 25.8 8', 10'
10' 5.08 m 124.3 9'11' 135.112' 1.96 m 39.8 11', 13, 14', 20'13' 2.05 m 26.9 12', 14' 11', 12', 14'14' 5.09 m 124.5 13'15' 131.416' 1.68 3H s 25.8 14' 15' 17'17' 1.59 3H s 17.8 14', 15', 16'18' 1.80 3H s 16.5 2', 3', 4'19' 1.61 3H s 16.1 6', 7', 8'20' 1.61 3H s 16.1 10', 11', 12'
aRecorded at 500 MHz. bRecorded at 125 MHz.
S18
![Page 19: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/19.jpg)
Supplementary Figure 15. 1H NMR (500 MHz) spectrum of 6 in CDCl3.
Supplementary Figure 16. 13C NMR (125 MHz) spectrum of 6 in CDCl3.
S19
![Page 20: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/20.jpg)
Supplementary Figure 17. DQF–COSY (500 MHz) spectrum of 6 in CDCl3.
Supplementary Figure 18. HMQC (500 MHz) spectrum of 6 in CDCl3.
S20
![Page 21: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/21.jpg)
Supplementary Figure 19. HMBC (500 MHz) spectrum of 6 in CDCl3.
S21
![Page 22: 6-Deoxyerythronolide B (6dEB), the macrocyclic …€¦ · Web viewSupplementary Information for. N. ew. natural products isolated from . Metarhizium . robertsii . ARSEF 23 by chemical](https://reader034.fdocuments.in/reader034/viewer/2022042313/5edc146aad6a402d6666987e/html5/thumbnails/22.jpg)
3. Supplementary References
1 Tsunematsu, Y. et al. Distinct mechanisms for spiro-carbon formation reveal biosynthetic pathway crosstalk. Nat. Chem. Biol. 9, 818–825 (2013).
2 Sato, M. et al. Involvement of lipocalin-like CghA in decalin-forming stereoselective intramolecular [4+2] cycloaddition. ChemBioChem, 16, 2294–2298 (2015).
3 Lee, J. C., Lobkivsky, N, P., Pliam, N. B., Strobel, G. & Clardy, J. Subglutinols A and B: Immunosuppressive compounds from the endophytic fungus Fusarium subglutinans. J. Org. Chem. 60, 7076–7077 (1995).
S22