5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf ·...
Transcript of 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf ·...
![Page 1: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/1.jpg)
Chapter 5: Community genomics.........
137
5.1 Introduction
Industrial estates, situated within the ‘Golden Corridor’ (a highly industrialized zone
from Vapi to Mehsana in Gujarat, India) manufacture dyes, paints and pigments,
pharmaceuticals, textiles and many other commercial products. These industries
release liquid wastes containing dyes, xenobiotic compounds and many other
unnatural products in the environment and thus are the major cause of ground and
surface water pollution in these areas. Dyestuff effluents are one of the major
pollutants that are released into the environment. Even very low concentrations of
dyes (less than 1 mg/l) can be highly visible in solutions. Synthetic dyes are very
soluble in water and are recalcitrant to microbial degradation because they contain
substituents such as azo, nitro or sulfo groups. They are frequently found in a
chemically unchanged form even after waste-water treatment and hence they are
regarded as recalcitrant pollutants (Pagga and Brown, 1986; Shaul et al., 1991). Azo
dyes are the largest class of dyes and are widely used in the textile, leather, food,
cosmetic and dyestuff manufacturing industries (Anliker, 1979; Reisch, 1996; Blumel
et al., 2002) because of their chemical stability, ease of synthesis and versatility
(Nakanishi et al., 2001). In year 2000, more than 7×105 tons of these dyes were
produced worldwide (Suzuki et al., 2001). Azo dyes, characterized by the presence of
one or more azo groups (-N=N-), have become a great concern in effluent treatment
due to their colour, bio recalcitrance and potential toxicity to animals and human.
The treatment system of effluents based on physico-chemical methods is effective but
suffers from shortcomings such as high cost, formation of hazardous by-products,
intensive energy requirements and production of a large amount of sludge. In contrast,
biological degradation of these dyes does not have similar problems. To establish
biological waste-water treatment of azo dyes, it is essential to discover the
microorganisms that encode azo dye-degrading enzymes (Sugiura et al., 2006).
Diverse set of enzymes like azoreductases and peroxidases have so far been reported
in dye degradation. Azoreductases of microorganisms are favourable for the
development of biodegradation systems for azo dyes, because these enzymes catalyze
reductive cleavage of azo groups (-N=N-) under mild conditions. In addition, bacterial
enzymes can be readily overproduced (Nakanishi et al., 2001). The most generally
![Page 2: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/2.jpg)
Chapter 5: Community genomics.........
138
accepted hypothesis is that many bacterial strains possess cytoplasmic enzymes,
which act as ‘azoreductases’ when under the pressure of azo dyes.
Azo bonds in azo dyes are reduced, under anaerobic conditions, leading to formation
of corresponding amines. Intermediate aromatic amines are further mineralized under
aerobic conditions (Nakayama et al., 1983; Blumel at al., 2002; Chen et al., 2005).
Till now mainly combined anaerobic-aerobic microbial treatments of dye wastes have
been used, due to limited knowledge about microorganisms having oxygen tolerant
enzymes that are involved in decolourization of azo dyes. Aerobic treatment of
dyestuff containing wastewaters possess significant potential, however, the aerobic
metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which
catalyze the NAD(P)H-dependent reduction of azo compounds to the corresponding
amines (Blumel et al., 2002; Chen et al., 2005). Very few aerobic bacteria which can
grow on/with azo compounds have been reported such as azoreductase from Bacillus
sp. OY1-2 (Suzuki et al., 2001) and Xenophilus azovorans (Blumel et al., 2002).
Moreover, Flavobacterium can aerobically degrade 4,4’-dicarboxyazobenzene ring
(Overney, 1979; Blumel et al., 2002) and Sphingomonas sp. azoreductases can cleave
several sulphonated naphthol and benzol rings (Stolz, 1999).
Any individual microorganism is incapable of processing all the metabolic reactions
to degrade any of the environmental pollutants, however a group of diverse organisms
form a community and collectively process all the metabolic reactions for
bioremediation. The individual strains may attack the dye molecule at different
positions or may use decomposition products produced by another strain for further
decomposition. To gain insights into these processes, it becomes inevitable to identify
and characterize the dye decolorizing genetic machinery.
One approach is metagenomics or community genomics, which aims to access the
genomic potential of an environmental sample either directly or after enrichment for
specific purpose, respectively. Soil metagenome can be enriched in various ways
keeping in mind specific gene targets that have potential applications in
bioremediation, industry, medicine or agriculture. Bacteria capable of xenobiotic
degradation are widely distributed in the environment. These bacteria have evolved to
![Page 3: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/3.jpg)
Chapter 5: Community genomics.........
139
utilize a variety of compounds that are present in the environment. Another approach,
direct cloning of gene fragments from dye degrading bacterial consortia wherein
genes can be targeted by carrying out PCR using gene specific/degenerate primers,
may also give better insights. Moreover, transformation of azoreductase expressing
clones to an easily manipulative host can serve for large-scale enzyme production or
setting of a bioreactor with known parameters.
In order to search for azoreductases which can withstand the aerobic conditions and
possess broad range of substrate specificity, attempts were made to clone oxygen
tolerant azoreductases from dye decolourizing enriched mixed cultures.
5.2 Materials and methods
5.2.1 Bacterial strains, plasmids and growth conditions
E. coli strains DH5α, DH10B and BL21(DE3) were cultured at 37°C in Luria Broth
(Himedia, Mumbai, India). Recombinant strains were also cultured under similar
conditions with appropriate antibiotics (ampicillin-100 µg/ml and kanamycin-50
µg/ml). The pGEM-T kit (Promega, Madison, USA) was used for cloning of the
azoreductase gene. The plasmids pUC19 and pET28a+ were used for expression
studies of the azoreductase gene. All plasmid isolations were carried out using
plasmid preparation kit obtained from Qiagen (Hilden, Germany).
5.2.2 Chemicals
Co-factors (FAD, FMN, NAD, NADP.Na2, NADH.DPNH and NADPH.Na4) were
obtained from Sigma-Aldrich (Missouri, USA); restriction and modification enzymes
were obtained from NEB (Ipswich, USA); antibiotics were obtained from Himedia
(Mumbai, India); agarose and DNA molecular weight markers from Bangalore Genei
(Bangalore, India); primers from MWG Biotech (Edersburg, Germany) and dNTPs
from Bioron (Ludwigshafen, Germany). Reactive Violet 5 (RV5) was of commercial
grade. All other essential chemicals were of molecular biology grade.
5.2.3 Contaminated site
The soil samples were collected from contaminated banks of the Khari-cut canal (N
22° 57. 878′; E 072° 38. 478′), flowing through GIDC (Vatva, Ahmedabad, Gujarat,
India) and into the Khari river.
![Page 4: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/4.jpg)
Chapter 5: Community genomics.........
140
5.2.4 Development of V9 consortium
Soil samples were inoculated (10%) in Bushnell Haas Minimal medium (BHM: 1.7
mM MgSO4, 0.2 mM CaCl2, 7.4 mM KH2PO4, 5.7 mM K2HPO4, 12.5 mM NH4NO3
and 0.3 mM FeCl3) supplemented with glucose and yeast extract and under selective
pressure of the azo dye (Reactive Violet 5). For dye degradation under anoxic (static)
condition, BHM with Reactive Violet 5 (100 ppm) was supplemented with glucose
(0.1% w/v) and yeast extract (0.1% w/v). For dye degradation under aerobic (120
rpm) condition, BHM with Reactive Violet 5 (100 ppm) was supplemented with
glucose (0.1% w/v) and yeast extract (0.5% w/v). Once the dye was decolourized,
parts of these cultures were used as inoculum (10%) in fresh medium. Fifty transfers
were carried out and each time dye decolourization was observed. The stabilized
consortia were used for further studies. Dye degradation was monitored visually and
also by determining the absorbance of the supernatant at 558 nm (λmax of RV5) using
an UV-visible spectrophotometer (Analytik Jena AG Specord®
210, Jena, Germany).
5.2.5 Characterization of V9 consortium
5.2.5.1 Determination of carbon source
BHM supplemented with yeast extract (0.1% w/v) along with different carbon sources
such as glucose, sucrose, lactose, pyruvate and starch (0.1% w/v) and Reactive Violet
5 (100 ppm) were inoculated with V9 consortium (10% v/v) and incubated at 37°C. A
control, without any carbon source, was kept under similar conditions. To find the
minimum amount required for dye decolourization, various concentrations (0.01,
0.05, 0.1, 0.2, 0.3 and 0.5% w/v) of the selected carbon source were studied.
5.2.5.2 Determination of nitrogen source
BHM supplemented with glucose (0.1% w/v) along with different nitrogen sources
such as yeast extract, peptone, ammonium nitrate, sodium nitrate, potassium nitrate
and urea (0.1% w/v) and Reactive Violet 5 (100 ppm) were inoculated with V9
consortium (10% v/v) and incubated at 37°C. A control, without any nitrogen source,
was kept under similar conditions. To find the minimum amount required for dye
decolourization, various concentrations (0.01, 0.05, 0.1, 0.2, 0.3 and 0.5% w/v) of the
selected nitrogen source were studied.
![Page 5: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/5.jpg)
Chapter 5: Community genomics.........
141
5.2.5.3 Optimum temperature for dye decolourization
BHM supplemented with glucose (0.1% w/v), yeast extract (0.1% w/v) and Reactive
Violet 5 (100 ppm) was inoculated with V9 consortium (10% v/v) and incubated at
different temperatures such as 4°C, 20°C, 30°C, 37°C, 45°C and 55°C.
5.2.5.4 Effect of salinity on dye decolourization
BHM supplemented with glucose (0.1% w/v), yeast extract (0.1% w/v) and Reactive
Violet 5 (100 ppm) along with various NaCl concentrations (0, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 20 and 30 g/l) were inoculated with V9 consortium (10% v/v) and incubated at
37°C.
5.2.5.5 Spectrum of dyes as substrates
BHM supplemented with glucose (0.1% w/v), yeast extract (0.1% w/v) and twenty
four kinds of dyes (100 ppm), respectively were inoculated with V9 consortium (10%
v/v) and incubated at 37°C. Decolourization was determined at respective absorbance
maxima of dyes.
5.2.6 Isolation and identification of cultivable bacteria constituting the V9
consortium
The appropriate dilutions of enriched consortium were spreaded on rich medium
(Luria agar) as well as minimal media (BHM agar and R2A) and incubated at various
temperatures (20°C, 28°C and 37°C) for various growth periods (1 day, 2 days, 5
days, 10 days and 20 days). Based on morphological characteristics different colonies
were picked and subsequently maintained on Luria agar plates.
The 16S rRNA genes were amplified from the bacterial cultures by colony PCR.
Amplification was carried out in a 30 l PCR reaction consisting of 1X buffer (10
mM Tris pH 9.0, 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100), 0.33 mM each of
dNTPs, 0.66 þmoles each of custom synthesized universal primers 27F (5’-
GAGTTTGATCCTGGCTCA-3’) and 1385R (5’-CGGTGTGTRCAAGGCCC-3’),
and 1.5 U of Taq DNA polymerase. Amplification program was performed with
initial denaturation step at 94°C for 5 min; followed by 30 cycles of 1 min
denaturation step at 94°C, 1 min annealing step at 55°C, and 1.2 min elongation step
at 72°C and a final extension step at 72°C for 20 min using Biorad iCycler version
![Page 6: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/6.jpg)
Chapter 5: Community genomics.........
142
4.006 (Biorad, CA, USA). The ~1.5 kb PCR product was sequenced by automated
DNA Analyzer 3730 using BigDyeTM
Terminator 3.1 sequencing chemistry (Applied
Biosystems, Foster City, CA). Full length 16S rRNA gene sequences were analyzed
using SEQMATCH tool of the Ribosomal Database Project (RDP-II) to identify the
bacteria. The 16S rRNA gene sequences have been submitted to GenBank and the
obtained accession numbers have been described in section 5.3.2.
5.2.7 Isolation of consortial DNA
The V9 consortium, after dye decolourization, was used for total community DNA
preparation using Zhou et al. (1996) protocol with some modifications. The
precipitation was done differently by adding polyethylene glycol (PEG) 10,000 at a
final concentration of 5% followed by incubation at 4°C overnight. DNA
concentration was measured using NanoDrop ND-1000 spectrophotometer
(NanoDrop Technologies Inc., Delaware, USA) and further analysed by gel
electrophoresis.
5.2.8 Amplification, cloning and sequencing of azoreductase gene
In order to clone the azoreductase gene, three sets of primers were designed from the
sequences available in NCBI database [(1) AZR1F 5’-
ATGAAACTAGTCGTTATTAAC-3’ and AZR1R 5’-
TCACTCCACTCCTAGTTGTTTTTT-3’; (2) AZR2F 5’-
TAGCAAAACTTGAAGTGG-3’ and AZR2R 5’-CGTATCATTTTGAACAGG-3’;
(3) AZR3F 5’-GGAATTCATATGAACATGTTAGTCATAAA-3’ and AZR3R 5’-
CGGGATCCAACAAATCCCGGCGTTYAGA-3’]. Amplification of the
azoreductase gene from consortial DNA was carried out as described in section 5.2.6.
The amplified products were purified by adding a solution (20% PEG 8000 in 2.5 M
NaCl) to the reaction mixture in a ratio of 1:0.66 and incubating at 37°C for 1 hour
followed by two 70% ethanol washes. All the centrifugations (Kubota 6500, Bunkyo-
Ku, Tokyo, Japan) were carried out at 20,000 x g for 20 minutes at 4°C. The pellet
was air-dried and resuspended in Milli-Q water (Millipore, Billerica, USA). The
electrocompetent cells were prepared as described in section 2.2.4.4.2 of chapter 2.
Purified amplified products were ligated into pGEM-T vector (according to manual of
pGEM-T vector) and transformed into E. coli DH5α competent cells by
![Page 7: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/7.jpg)
Chapter 5: Community genomics.........
143
electroporation as described in section 2.2.4.5.2 of chapter 2. Recombinant plasmids
were isolated and subjected to sequencing using M13 primers by automated DNA
Analyser 3730 using ABI PRISM® BigDye
TM Terminator Cycle Sequencing 3.1
(Applied Biosystems, CA, USA). The sequence has been submitted to GenBank and
the accession number is described in section 5.3.4. DNA and protein sequences with
homology to the sequenced gene were searched using BLASTn and BLASTx in
NCBI databases, respectively.
5.2.9 Phylogenetic analysis
Three hundred sequences of each of azoreductase genes and proteins were
downloaded from NCBI database in February 2010. The sequenced gene and ORF of
its translated product were aligned with downloaded azoreductase genes and proteins
sequences, respectively using Clustal W 1.6 program at
(http://www.ebi.ac.uk/clustalw/). Phylogenetic analyses was performed (for both
DNA and protein sequences) using aligned sequences by the neighbour joining
algorithm (Saitou and Nei, 1987) using Kimura 2 parameter distance and
bootstrapping with 550 replicates (Felsenstein, 1985) in MEGA 4.0 software (Tamura
et al., 2007). Branches corresponding to partitions reproduced in less than 50%
bootstrap replicates were collapsed. The resulting tree was drawn to scale, with
branch lengths in the same units as those of the evolutionary distances used to infer
the phylogenetic tree. The evolutionary distances were computed using the Maximum
Composite Likelihood method (Tamura et al., 2004) and the Poisson correction
method (Zuckerlandl and Pauling, 1965) for DNA and protein sequences,
respectively. All positions containing alignment gaps and missing data were
eliminated only in pair wise sequence comparisons.
5.2.10 Expression of an azoreductase gene in E. coli
To facilitate cloning of azoreductase gene in expression vectors, BamHI and HindIII
restriction site sequences were added in set 1 primers (AZR1FB 5’-
GGCGGATCCATGAAACTAGTCGTTATTAAC-3’ and AZR1RH 5’-
GGCAAGCTTTCACTCCACTCCTAGTTGTTTTTT-3’). The underlined bases in
AZR1FB and AZR1RH represent sites for BamHI and HindIII, respectively.
Amplified azoreductase gene and vectors pUC19 and pET28a+ were digested with
![Page 8: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/8.jpg)
Chapter 5: Community genomics.........
144
BamHI and HindIII enzymes. The ligations were performed in 10 μl reactions
containing 50 ng vector, 150-200 ng insert DNA and 3 units of T4 DNA ligase in T4
DNA ligase buffer at 16ºC overnight. Two μl of the reaction was used for
transformation of 100 μl E. coli DH10B competent cells by electroporation (Bio-Rad
MicroPulser, Hercules, California, USA) at a voltage of 1.8 kV and 2.5 kV for 0.1 cm
and 0.2 cm cuvettes, respectively. The preparation of competent cells and
electroporation are described in detail in section 2.2.4.4.2 and 2.2.4.5.2, respectively
of chapter 2. For facilitating expression of the azoreductase gene, a second
transformation of recombinant plasmid isolated from E. coli DH10B clone pET1 was
carried out in E. coli BL21(DE3) competent cells.
5.2.11 Whole cell extract preparation
Cells were harvested and washed with 20 mM sodium phosphate buffer (pH 7.0). All
the centrifugations were carried out at 20,000 x g for 20 minutes at 4°C. The cells
were resuspended in the same buffer and two freeze-thaw cycles at -20ºC and 4ºC
were carried out followed by disruption using an Ultrasonic probe (Sonics Vibra Cell
500, USA) at 35% amplitude and 9 second pulses with 5 second intervals for 15 times
or till complete cell lysis (clear lysate). The lysate was then centrifuged and the
obtained supernatant was collected and termed as crude extract.
5.2.12 Azoreductase activity assay
Enzyme assay was carried out in 2 ml 20 mM sodium phosphate buffer system
containing 2 mg protein (crude extract), 50 ppm Reactive Violet 5 dye and 1 mM co-
factor. The experimental reactions were incubated at 37°C till dye degradation and
control reactions under similar conditions for three hours. Dye degradation was
measured by the absorbance of the supernatant at 558 nm (λmax). The amount of
protein was calculated according to the method of Lowry et al. (1951).
5.2.13 Studies on suitable co-factor
To find out the co-factor required by the cloned azoreductase gene, enzyme assays
were carried out with different co-factors (FAD, FMN, NAD, NADP.Na2,
NADH.DPNH and NADPH.Na4) at a concentration of 1.5 mM. To determine the
![Page 9: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/9.jpg)
Chapter 5: Community genomics.........
145
minimum amount of the selected co-factor required for expression, enzyme assays
were carried out with different concentrations (0 mM, 0.5 mM, 1 mM and 1.5 mM).
5.2.14 Azoreductase assay of whole cell crude extracts of E. coli strains, strains
with vectors and strains with recombinant vectors
Azoreductase assay were performed for cell extracts of E. coli DH10B clone pUC1,
E. coli DH10B clone pET1 and E. coli BL21(DE3) clone pET1. As controls, assays
were also performed for cell extracts of E. coli DH5α, E. coli DH10B, E. coli
BL21(DE3) and E. coli strains with vectors pUC19 and pET28a+. The assays were
carried out as described in section 5.2.12.
5.3 Results and discussion
5.3.1 Contaminated site
The persistent release of toxic pollutants from industrial units (situated in GIDC,
Vatva, Ahmedabad, Gujarat, India) manufacturing dyes, chemicals, solvents and other
xenobiotic compounds have contaminated the surrounding water and soil bodies. The
soil samples collected from contaminated banks of the Khari-cut canal, flowing
through Vatva and into the Khari river were used for developing consortium, enriched
with bacterial cultures capable of either degrading dye or growing in presence of dye
stress.
5.3.2 V9 consortium
Reactive Violet 5 was chosen as a model dye on account of its complexity. It contains
three aromatic rings, three sulphonated groups as well as copper as a metal ion. The
structure of Reactive Violet 5 is shown in Fig. 5.1.
Fig. 5.1: Chemical structure of Reactive Violet 5 (RV5) dye.
![Page 10: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/10.jpg)
Chapter 5: Community genomics.........
146
b
a
The developed bacterial V9 consortium was able to decolourize 100 ppm of Reactive
Violet 5 (RV5) within 24 h at 37ºC. The degradation of dye was observed visibly
(Fig. 5.2a) as well as by the decrease in the absorbance at 558 nm (λmax of RV5)
(Fig. 5.2b).
Fig. 5.2: Dye decolourization profile depicted by (a) photograph and (b) UV-Visible
overlay spectra. ( Inoculated and Dye degraded)
![Page 11: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/11.jpg)
Chapter 5: Community genomics.........
147
To achieve efficient dye decolourization, various biotic and abiotic parameters were
studied. V9 consortium was characterized for carbon source as well as nitrogen source
and their concentrations. Various carbon sources such as glucose, sucrose, lactose,
pyruvate and starch were screened for dye degradation studies and amongst them
glucose was found to be the best (Fig. 5.3a). As observed from Fig. 5.3a, 95% of dye
was decolourized within 24 h in presence of glucose. To find the minimum amount of
glucose required for dye decolourization, various concentrations (0.01, 0.05, 0.1, 0.2,
0.3 and 0.5% w/v) were studied (Fig. 5.3b). From Fig. 5.3b, it can be observed that
when glucose concentration was 0.1% w/v, 95% of dye was decolourized within 24 h.
Various nitrogen sources such as yeast extract, peptone, ammonium nitrate, sodium
nitrate, potassium nitrate and urea were screened for dye degradation studies and
amongst them yeast extract was found to be the best (Fig. 5.4a). As observed from
Fig. 5.4a, 95% of dye was decolourized within 24 h in presence of yeast extract. It
was observed that peptone leads to even faster rapid degradation of dye, however the
dye decolourization is temporary and after further 24 h, colour reappears.
Consequently, yeast extract was preferred over peptone. To find the minimum amount
of yeast extract required for dye decolourization, various concentrations (0.01, 0.05,
0.1, 0.2, 0.3 and 0.5% w/v) were studied (Fig. 5.4b, c). Amount of nitrogen source
requirement varied for anoxic and aerobic conditions. In anoxic conditions, 90% of
dye was decolourized within 24 h in presence of 0.1% yeast extract (Fig. 5.4b).
Conversely, in aerobic conditions 90% of dye was decolourized within 30 h in
presence of 0.5% yeast extract (Fig. 5.4c). Lesser concentrations of yeast extract did
not lead to optimum dye degradation in aerobic conditions. Thus, the minimum
essential amount of yeast extract required was higher in aerobic (0.5%) than in anoxic
(0.1%) conditions. Reasons can be attributed to the fact, that oxygen might be
competing for the electrons. Moreover, one peculiar phenomenon was observed that
for dye degradation, presence of yeast extract in medium is inevitable whereas,
absence of glucose did not hamper the metabolic process.
![Page 12: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/12.jpg)
Chapter 5: Community genomics.........
148
Fig. 5.3: (a) Effect of various carbon sources on decolourization of RV5 by V9
consortium under anoxic condition at 37ºC; (b) Effect of different glucose
concentrations on decolourization of RV5 by V9 consortium under anoxic condition
at 37ºC.
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48
% D
ecolo
uri
zati
on
Time (h)
No Carbon
Glucose
Sucrose
Lactose
Pyruvate
Starch
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48
% D
ecolo
uri
zati
on
Time (h)
0.01%
0.05%
0.10%
0.20%
0.30%
0.50%
a
b
![Page 13: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/13.jpg)
Chapter 5: Community genomics.........
149
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48
% D
ecolo
uri
zati
on
Time (h)
No Nitrogen
Peptone
Yeast Extract
Ammonium Nitrate
Sodium Nitrate
Potassium Nitrate
Urea
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48
% D
ecolo
uri
zati
on
Time (h)
0.01%
0.05%
0.10%
0.20%
0.30%
0.50%
a
b
![Page 14: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/14.jpg)
Chapter 5: Community genomics.........
150
Fig. 5.4: (a) Effect of various nitrogen sources on decolourization of RV5 by V9
consortium under anoxic condition at 37ºC; (b) Effect of different yeast extract
concentrations on decolourization of RV5 by V9 consortium under anoxic condition
at 37ºC; (c) Effect of different yeast extract concentrations on decolourization of RV5
by V9 consortium under aerobic condition at 37ºC.
Moreover, optimum temperature required for efficient and faster dye decolourization
was characterized. Optimized BHM medium with Reactive Violet 5 (100 ppm) was
inoculated with V9 consortium (10% v/v) and incubated at different temperatures
such as 4°C, 20°C, 30°C, 37°C, 45°C and 55°C (Fig. 5.5). The decolourization ability
of V9 consortium was highest at 37°C showing 93% decolourization of RV5 within
24 h.
Fig. 5.5: Effect of different temperatures on decolourization of RV5 by V9
consortium under anoxic condition.
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48
% D
ecolo
uri
zati
on
Time (h)
0.01%
0.05%
0.10%
0.20%
0.30%
0.50%
0
10
20
30
40
5060
70
80
90
100
0 6 12 18 24 30 36 42 48
% D
ecolo
uri
zati
on
Time (h)
4°C
20°C
30°C
37°C
45°C
55°C
c
![Page 15: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/15.jpg)
Chapter 5: Community genomics.........
151
Fig. 5.6 shows overall decolourization profile of RV5 and growth pattern of V9
consortium under anoxic (Fig. 5.6a) and aerobic (Fig. 5.6b) conditions. Under anoxic
conditions V9 consortium was able to decolourize 95% of RV5 within 24 h, while in
aerobic conditions (120 rpm) 85-90% of RV5 was decolourized within 30-36 h at
37ºC.
Fig. 5.6: Dye decolourization and growth profile of V9 consortium under (a) anoxic
and (b) aerobic conditions at 37ºC.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48A
bso
rban
ce (
600 n
m)
% D
ecolo
uri
zati
on
Time (h)
% Decolourization
Growth
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
0
10
20
30
40
50
60
70
80
90
100
0 6 12 18 24 30 36 42 48
Ab
sorb
an
ce (
600 n
m)
% D
ecolo
uri
zati
on
Time (h)
% Decolourization
Growth
a
b
![Page 16: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/16.jpg)
Chapter 5: Community genomics.........
152
The V9 consortium was able to efficiently decolourize dye upto 500 ppm
concentration and tolerate dye up to 2000 ppm. Moreover, generally contaminated
sites are reported to have high salinity. Consequently, dye decolourization efficiency
of V9 consortium in presence of high salinity was determined. BHM supplemented
with glucose (0.1% w/v), yeast extract (0.1% w/v) and Reactive Violet 5 (100 ppm)
along with various NaCl concentrations (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 and 30 g/l)
were inoculated with V9 consortium (10% v/v) and incubated at 37°C (Fig. 5.7). The
consortium showed more than 90% dye decolourization even at higher concentrations
of NaCl, which demonstrated its ability of decolourizing dye RV5 over a wide range
of saline conditions.
Fig. 5.7: Effect of salinity on decolourization of RV5.
To determine whether developed V9 consortium can decolourize broad range of
substrates, various kinds of azo dyes (having different - groups, metal ions, ring
formations, etc.) were used as substrates in the study. BHM supplemented with
glucose (0.1% w/v), yeast extract (0.1% w/v) and twenty four kinds of dyes (100
ppm), respectively were inoculated with V9 consortium (10% v/v) and incubated at
37°C (Fig. 5.8). Decolourization was determined at respective absorbance maxima of
dyes. Decolourization in the range of 85-95% within 24 h was observed for 22 out of
24 dyes used in the study.
![Page 17: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/17.jpg)
Chapter 5: Community genomics.........
153
Fig. 5.8: Spectrum of dyes decolourized by the V9 consortium.
Determination of azo-dye degrading organisms is essential for developing new
bioremediation strategies in waste-water treatment plants (Suzuki et al., 2001).
Consequently, cultivable organisms constituting the V9 consortium and playing a role
in dye degradation were identified. Based on morphological characteristics seven
different cultures were isolated. Subsequently their 16S rRNA genes were amplified
(Fig. 5.9) and sequenced.
Fig. 5.9: 16S rRNA genes amplified by colony PCR. Lanes 1 to 7: 16S rRNA genes
from seven different pure cultures; Lane 8: Supermix DNA ladder.
1.5 kb
1 2 3 4 5 6 7 8
![Page 18: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/18.jpg)
Chapter 5: Community genomics.........
154
These 16S rRNA gene sequences were analyzed using SEQMATCH tool of
Ribosomal Database Project (RDP-II). The organisms were identified as
Pseudomonas citronellolis V91DM (JN400328), Lysinibacillus fusiformis V92DM
(JN400329), Gordonia cholesterolivorans V93DM (JN400330), Ochrobactrum
pseudintermedium V94DM (JN400331), Stenotrophomonas sp. V95DM (JN400332),
Enterococcus casseliflavus V96DM (JN400333) and Citrobacter sp. V97DM
(JN400334). The genera Pseudomonas, Stenotrophomonas and Citrobacter belong to
class Gammaproteobacteria of phylum Proteobacteria. The genus Ochrobactrum
belongs to class Alphaproteobacteria of phylum Proteobacteria. The genera
Enterococcus and Lysinibacillus belong to class Bacilli of phylum Firmicutes. The
genus Gordonia belongs to class Actinobacteria (class) of phylum Actinobacteria.
Many reports are available describing the roles of strains, belonging to genera
identified in V9 consortium, in azo dye degradation. Azo reduction activity by strain
Pseudomonas putida MET94 (Mendes et al., 2011) and decolourization of adsorbed
textile dyes by mixed cultures of Pseudomonas sp. SUK1 and Aspergillus ochraceus
NCIM-1146 (Kadam et al., 2011) have been reported. Lysinibacillus sp. strain AK2 is
capable of decolourizing sulfonated azo dye Metanil Yellow (Anjaneya et al., 2011).
Ochrobactrum intermedium ANKI is able to decolourize azobenzene (Vakkerov-
Kouzova, 2007). Azoreductase (AzoA) from Enterococcus faecalis is a very active
enzyme with broad spectrum of substrate specificity (Chen et al., 2008). Macwana et
al. (2010) have isolated and identified an azoreductase from Enterococcus faecium
which is 67% similar to azoreductase from Enterococcus faecalis but uses different
co-factors NADH and NADPH instead of FMN. A bacterial strain Stentrophomonas
maltophilia AAP56 isolated from a polluted soil was able to decolorize recalcitrant
dyes of an industrial effluent: SITEX Black (Said et al., 2010). Petty et al. (2010)
sequenced complete genome of Citrobacter rodentium and they have identified an
azoR gene (FMN dependent NADH-azoreductase).
5.3.3 Consortial DNA
The stabilized V9 consortium (transferred 50 times and each time dye was
decolourized) was used for extraction of total consortial DNA. The DNA isolation
was carried out according to protocol described by Zhou et al. (1996) with some
![Page 19: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/19.jpg)
Chapter 5: Community genomics.........
155
modifications. The consortium besides bacterial cultures also contained aromatic
amines and other dye degradation products. Thus it was essential that these
contaminants were removed from the extracted DNA as they would have interfered in
further molecular experiments. Consequently, the precipitation was done using 5%
PEG 10,000 and incubated at 4°C overnight. The advantage of using PEG 10,000 was
that no additional purification step such as gel permeation chromatography was
required. The extracted DNA (Fig. 5.10) was free of impurities and amenable to PCR,
ligation and other molecular studies. The quantity and quality of extracted DNA is
described in Table 5.1.
Fig. 5.10: Consortial genomic DNA electrophoresed on 0.8% (w/v) agarose gel. Lane
1: Supermix DNA ladder; Lanes 2 and 3: Consortial genomic DNA.
Table 5.1: Details of consortial genomic DNA.
V9 consortium after dye degradation 200 ml
Extracted consortial genomic DNA 3.2 µg
A260 0.188
A280 0.098
A230 0.093
260/280 1.92
260/230 2.02
33.5/24.5 kb
1 2 3
![Page 20: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/20.jpg)
Chapter 5: Community genomics.........
156
5.3.4 Azoreductase gene
Three sets of primers were designed from the sequences of azoreductases available in
the NCBI database. Azoreductase gene was amplified (Fig. 5.11), by set 1 primers –
AZR1F and AZR1R, from consortial DNA as template. The other two sets of primers
could not amplify azoreductase gene from V9 consortium. The amplified
azoreductase gene was cloned into the pGEM-T vector and sequenced. Amplified
azoreductase gene (JN400335) had a length of 537 bp (Fig. 5.12) containing an ORF
of 178 amino acids. BLASTn analysis of the sequence showed 97% identity to
azoreductase gene of Rhodobacter sphaeroides, while BLASTx analysis showed 98%
identity to azoreductase of Bacillus cereus G9241.
Fig. 5.11: Azoreductase gene amplified from consortial genomic DNA. Lanes 1 and
2: Azoreductase gene; Lane 3: Supermix DNA ladder.
atgaaactagtcgttattaacggtacaccaagaaaatttggtagaactcgcgtggtggcaaaatatattgcggatcaatttgaa
ggggagttatatgatttagcatttgaggagttacctttatacaatagagaagagtcacaacgtgatttagaggcagtgaaaaa
attaaaaacgttagtgaaagctgcggatggggttgtattatgtacaccagaatatcataatgcgatgagcggtgcgctgaaa
gactctttagattacttaagtagtaatgaatttattcataaaccagttgctttgttagcggttgctggtggcggtaaaggtggaat
aaatgcattaaacagcatgcgaacggtcgctagaggtgtttatgcaaatgcaattccaaaacaagttgttcttgatggattaca
cgtgcaagatggtgaacttggggaagatgcaaaaccattaattcatgatgtagttaaagaattgaaagcatatatgagcgtat
ataaagaggtgaaaaaacaactaggagtggagtga
Fig. 5.12: Nucleotide sequence of the amplified azoreductase gene (JN400335).
1 2
3
0.5 kb
1 2 3
![Page 21: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/21.jpg)
Chapter 5: Community genomics.........
157
To find out the phylogenetic affiliation of the gene, 300 sequences each of
azoreductase gene and protein were downloaded from the NCBI database. However,
similar sequences from each cluster were removed to make the resulting trees less
complex. The phylogenetic tree for azoreductase genes (Fig. 5.13a) and proteins (Fig.
5.13b) showed that the sequenced gene was clustered with the azoreductases of
phylum Firmicutes. The gene is closely related to azoreductase of Bacillus cereus Q1.
Within the phylogenetic tree of azoreductase genes, genes from
Gammaproteobacteria class were not near to each other and were interspersed with
azoreductase genes from Firmicutes. Conversely, within the phylogenetic tree of
azoreductase proteins, those of Gammaproteobacteria and Firmicutes were not
interspersed and cluster clearly apart.
The above observation can be explained by the fact that several enzymes are endowed
with promiscuous activities, azoreductases being one of them. The term 'catalytic
promiscuity' describes the capability of an enzyme to catalyse different chemical
reactions, called secondary activities, at the responsible active site. Many of the
enzymes active in degradation pathways are linked from their protein phylogeny and
not strictly linked to the taxonomical affiliation of the bacteria (Perez-Pantoja et al.,
2009), indicating that the genes encoding those catabolic enzymes are involved in
very dynamic events. To characterize the catabolic potential for biodegradation it is
necessary to take into consideration the broad diversity of catabolic routes evolved by
microorganisms and also the diversity of enzymes of a given gene family or even
between gene families.
![Page 22: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/22.jpg)
Chapter 5: Community genomics.........
158
Escherichia coli CFT073 Escherichia coli str K-12 Klebsiella pneumoniae Citrobacter sp 30
Salmonella enterica serovar Enterobacter sp 638 Enterobacter sakazakii ATCC BAA-894 Cronobacter turicensis
Sodalis glossinidius Yersinia pestis biovar Yersinia enterocolitica
Serratia proteamaculans 568 Erwinia tasmaniensis Et1/99 Dickeya zeae Ech1591 Pectobacterium carotovorum Erwinia carotovora
Pectobacterium wasabiae WPP Photorhabdus asymbiotica Aggregatibacter actinomycete Haemophilus parasuis SH0165 Burkholderia cenocepacia J2 Klebsiella pneumoniae 342
Acinetobacter baumannii AB3 Vibrio harveyi ATCC BAA-1116 Vibrio parahaemolyticus RIM
Vibrio vulnificus YJ016 Tolumonas auensis DSM 9187
Photobacterium profundum SS Shewanella sediminis HAW-EB Shewanella loihica PV-4
Shewanella denitrificans OS2 Shewanella frigidimarina NC
Shewanella putrefaciens CN-3 Shewanella sp MR-7 Shewanella oneidensis MR-1
Rhodopirellula baltica SH 1 Aspergillus fumigatus Af293
Colwellia psychrerythraea 3 Marinomonas sp MWYL1
Pseudovibrio sp JE062 Teredinibacter turnerae T79 Rhizobium leguminosarum bv
Acinetobacter baumannii AB00 Escherichia coli UMN026
Acaryochloris marina MBIC110 Pseudovibrio sp JE062 Chitinophaga pinensis DSM 2 Teredinibacter turnerae T79
Rhodococcus erythropolis PR4 Burkholderia cenocepacia J23
78Herminiimonas arsenicoxydans Erythrobacter litoralis HTC
Rhodobacter sphaeroides KD1 Granulibacter bethesdensis
Sulfitobacter sp EE-36 Roseobacter sp GAI101
Burkholderia mallei ATCC 103 Burkholderia multivorans AT Bradyrhizobium sp BTAi1 Stenotrophomonas sp SKA14
Methylobacterium extorquens Burkholderia multivorans
Ricinus communis Pseudomonas aeruginosa PAO1 Pseudomonas mendocina
Pseudomonas fluorescens Pf-5 Pseudomonas entomophila L48 Pseudomonas putida W619 Pseudomonas putida GB-1
Rhodobacteraceae bacterium K Colwellia psychrerythraea 34
Mycoplasma pulmonis UAB CTI Mycoplasma penetrans HF-2 Mycoplasma mobile 163K Mycoplasma conjunctivae
Bacillus weihenstephanensis Bacillus cereus
Bacillus clausii KSM-K16 Bacillus anthracis strain Ames Bacillus weihenstephanensis Bacillus halodurans C-125 Listeria monocytogenes EGD-e
Listeria innocua Clip11262 Lysinibacillus sphaericus
Bacillus licheniformis Bacillus halodurans C-125 Brevibacillus brevis NBRC 10 Exiguobacterium sibiricum 2 Coprothermobacter proteolyticus Lactococcus lactis
Clostridium botulinum B Listeria monocytogenes HCC23
Paenibacillus sp JDR-2 Bacillus cereus
Exiguobacterium sibiricum 2 Staphylococcus haemolyticus Staphylococcus aureus Mu50
Geobacillus kaustophilus HTA Bacillus licheniformis Bacillus halodurans C-125 Bacillus subtilis Bacillus pumilus SAFR-032
Bacillus cereus G9241 Bacillus subtilis strain 168
Leptospira interrogans Staphylococcus epidermidis
Staphylococcus aureus MRSA2 Bacillus licheniformis
Bacillus cereus Q1 Cloned azoreductase gene
Bacillus cereus B4264 Bacillus cereus G9842 Bacillus weihenstephanensis
Bacillus cereus cytotoxis N Bacillus cereus E33L Bacillus cereus ATCC 10987 Bacillus thuringiensis
Gamma proteobacterium NOR5-3 Shewanella amazonensis SB2B
Shewanella loihica PV-4 Shewanella piezotolerans WP
Shewanella sp MR-7 Shewanella sp ANA-3
Shewanella oneidensis MR-1 Ricinus communis
Dickeya dadantii Ech586 Azoarcus sp BH72
Stenotrophomonas maltophilia
99
99
99
99
99
9599
99
8599
99
99
99
98
98
98
98
70
97
96
5896
87
95
95
95
89
62
53
95
94
78
90
57
51
88
8284
93
78
91
90
89
89
85
81
74
67
53
71
77
76
59
73
73
72
54
53
93
0.2
a
![Page 23: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/23.jpg)
Chapter 5: Community genomics.........
159
Escherichia coli SE11 Escherichia coli CFT073 Klebsiella pneumoniae Citrobacter sp 30 2 Salmonella enterica Citrobacter koseri ATCC BAA-895 Enterobacter sakazakii Cronobacter turicensis Enterobacter sp 638
Sodalis glossinidius Yersinia pestis CO92 Yersinia enterocolitica Serratia proteamaculans 568 Pectobacterium wasabiae WPP Dickeya zeae Ech1591
Photorhabdus asymbiotica Erwinia tasmaniensis Et1/99
Aggregatibacter actinomycete Photobacterium profundum SS Vibrio harveyi ATCC BAA-1116
Vibrio sp Ex25 Vibrio vulnificus YJ016
Shewanella frigidimarina NC Shewanella loihica PV-4 Shewanella sediminis HAW-EB Shewanella denitrificans OS2 Shewanella sp MR-7 Shewanella sp W3-18-1 Shewanella baltica OS155
Acinetobacter baumannii AB3 Burkholderia cenocepacia J2 Klebsiella pneumoniae 342
Haemophilus parasuis SH0165 Tolumonas auensis DSM 9187
Pseudovibrio sp JE062 Teredinibacter turnerae T79
Rhodobacteraceae bacterium K Burkholderia multivorans ATCC17616 Burkholderia mallei JHU Sulfitobacter sp EE-36 Roseobacter sp. GAI101
Colwellia psychrerythraea 34 Erythrobacter litoralis HTC Rhodobacter sphaeroides KD1
Herminiimonas arsenicoxydans Granulibacter bethesdensis
Chitinophaga pinensis DSM 2 Colwellia psychrerythraea 3
Marinomonas sp MWYL1 Pseudovibrio sp JE062 Rhizobium leguminosarum bv Burkholderia multivorans Acaryochloris marina MBIC110
Rhodococcus erythropolis PR4 Escherichia coli UMN026
Methylobacterium extorquens Stenotrophomonas sp SKA14 Bradyrhizobium sp BTAi1
Ricinus communis Acinetobacter baumannii AB0057 Pseudomonas aeruginosa PAO1 Pseudomonas aeruginosa PA7 Pseudomonas mendocina ymp
Pseudomonas syringae pv Pseudomonas fluorescens Pf-5
Pseudomonas entomophila L48 Pseudomonas putida F1 Pseudomonas putida W619
Bacillus cereus G9241 ORF of cloned azoreductase gene
Bacillus cereus Q1 Bacillus cereus 03BB102 Bacillus weihenstephanensis Bacillus cereus Bacillus licheniformis ATCC14580
Staphylococcus epidermidis Staphylococcus aureus
gamma proteobacterium NOR5-3 Leptospira interrogans serovar
Shewanella amazonensis SB2B Shewanella piezotolerans WP3
Shewanella loihica PV-4 Shewanella sp ANA-3 Shewanella sp MR-7
Shewanella oneidensis MR-1 Azoarcus sp BH72 Stenotrophomonas maltophilia
Rhodopirellula baltica SH 1 Aspergillus fumigatus Af293
Burkholderia cenocepacia J23 Mycoplasma penetrans HF-2 Mycoplasma pulmonis UAB CTIP Mycoplasma mobile 163K
Mycoplasma conjunctivae Bacillus licheniformis ATCC14580 Bacillus amyloliquefaciens
Bacillus pumilus SAFR-032 Geobacillus kaustophilus HTA426 Bacillus halodurans C-125
Staphylococcus aureus Staphylococcus haemolyticus Paenibacillus sp JDR-2 Exiguobacterium sibiricum 255-15 Exiguobacterium sp AT1b
Bacillus cereus Bacillus anthracis Bacillus cereus G9842 Listeria monocytogenes HCC23
Clostridium botulinum B Coprothermobacter proteolyticus
Lactococcus lactis Exiguobacterium sibiricum 255-15 Lysinibacillus sphaericus C3-41
Listeria monocytogenes EGD-e Listeria innocua Clip11262
Brevibacillus brevis NBRC 10 Bacillus halodurans C-125
Bacillus licheniformis ATCC14580 Bacillus subtilis Bacillus halodurans C-125 Bacillus anthracis strain Ames Bacillus cereus G9842
Bacillus clausii KSM-K16 Bacillus cereus
Bacillus thuringiensis Bacillus cereus ATCC 14579 Bacillus cereus B4264
Bacillus cereus AH187 Bacillus subtilis
Ricinus communis Dickeya dadantii Ech586
896799
100
8295
100
100
100
6698
58
100
80
80
100
100
100100
100
9890
100
100
100100
95100
100
100
100
87
66
95
100
100
100
100
100
67
99
91555298
99
98
86
85
99
6499
99
97
97
6169
97
6289
96
8888
57
97
84
5472
53
90
73
88
79
74
69
65
63
61
61
59
56
56
52
50
0.2
b
![Page 24: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/24.jpg)
Chapter 5: Community genomics.........
160
Fig. 5.13: Phylogenetic relationship of the cloned gene sequence (a) and its deduced
amino acid sequence (b) with gene and protein sequences of azoreductases available
in database, respectively. The trees were constructed using neighbour joining
algorithm with Kimura 2 parameter distances in MEGA 4.0 software. Numbers at
nodes indicate percent bootstrap values above 50 supported by 550 replicates. The bar
indicates the Jukes-Cantor evolutionary distance. The names of the downloaded
sequences are as described in GenBank. The cloned gene is named as cloned
azoreductase gene in (a) and as ORF of cloned azoreductase gene in (b).
5.3.5 Expression of the azoreductase
In order to clone the azoreductase gene, BamHI and HindIII sites were added in
forward and reverse primers of set 1, respectively. The azoreductase gene, amplified
using modified set 1 primers, was digested with BamHI and HindIII enzymes. The
vectors pUC19 and pET28a+ were isolated and digested with Bam HI and Hind III
enzymes (Fig. 5.14). The digested products were ligated into digested vectors. The
constructs were transformed in E. coli DH10B. The presence of inserts in pUC19 was
verified by carrying out amplification of azoreductase gene using M13 primers as
shown in Fig. 5.15.
The resulting recombinant clones were named as E. coli DH10B clone pUC1 (pUC19
with azoreductase gene) and E. coli DH10B clone pET1 (pET28a+ with azoreductase
gene). Moreover, for higher expression of the azoreductase gene, a second
transformation of recombinant plasmid, isolated from E. coli DH10B clone pET1, was
carried out in E. coli BL21(DE3) cells and the recombinant clone was named as E.
coli BL21(DE3) clone pET1. The recombinant strains were checked for their in vivo
azo dye degradation capabilities. However, no degradation was observed and reason
can be attributed to the fact that recombinant E. coli strains were unable to uptake
sulphonated azo dyes. This result corroborates with earlier similar observations by
Blumel et al. (2002). Moreover, they had also suggested that besides uptake other
limitation factor could be availability of NADPH, essential for the reduction of azo
dyes. Consequently, for measuring in vitro enzyme activity, assays were carried out
with 2 mg crude cell extracts (enzyme) in presence of co-factor and 50 ppm substrate
(Reactive Violet 5 dye). The experimental reactions were incubated till dye
degradation and control reactions were incubated for an extended period of three
hours.
![Page 25: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/25.jpg)
Chapter 5: Community genomics.........
161
Fig. 5.14: Agarose gel (1%) analysis of vectors. Lane 1: Supermix DNA ladder; Lane
2: Isolated pUC19 vector; Lane 3: pUC19 vector digested with BamHI and HindIII
enzymes; Lane 4: Isolated pET28a+ vector; Lane 5: pET28a+ vector digested with
BamHI and HindIII enzymes.
Fig. 5.15: Amplification of azoreductase gene using M13 primers. Lane 1:
Azoreducase gene; Lane 2: 100 bp ladder.
5 kb
3 kb
600 bp
1 2 3 4 5
1 2
![Page 26: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/26.jpg)
Chapter 5: Community genomics.........
162
Among several reported azoreductases, the enzymes of X. azovorans KF46F (Blumel
et al., 2002), P. kullae K24 (Blumel and Stolz, 2003), E. coli (Nakanishi et al., 2001),
Ent. faecalis (Chen et al., 2004) and R. sphaeroides AS1.1737 (Bin et al., 2004) use
NADH as electron donors. However, the enzymes of E. coli (Nakanishi et al., 2001)
and Ent. faecalis (Chen et al., 2004) are also FMN-dependent. On the other hand,
enzymes of B. sp. OY1-2 (Suzuki et al., 2001) and S. aureus (Chen et al., 2005) use
NADPH as electron donor. Consequently, to find out the co-factor required by the
cloned gene product, enzyme assays were carried out with different co-factors as
shown in Fig. 5.16. Co-factors FAD (Fig. 5.16a), FMN (Fig. 5.16b), NAD (Fig.
5.16c) and NADP.Na2 (Fig. 5.16d) did not activate the enzyme as only 6%, 4.7%, 8%
and 8.5% dye degradation was observed, respectively. Co-factor NADH.DPNH (Fig.
5.16e) did facilitate dye degradation but only 56%. On the other hand, co-factor
NADPH.Na4 (Fig. 5.16f) facilitated 85-90% dye degradation. A similar kind of fact
has also been reported earlier (Zimmerman et al., 1982; Blumel et al., 2002). They
had found azoreductases, which preferably used NADPH as co-factor and NADH
only when present in significantly higher Km values. Consequently, co-factor
NADPH.Na4 was best amongst all and was selected for further studies. To determine
the minimum amount of NADPH.Na4 required by the gene product, enzyme assays
with different concentrations of co-factor were carried out (Fig. 5.17). As we can see,
6.8%, 46.7%, 83% and 85.3% dye degradation was observed with 0 mM (Fig. 5.17a),
0.5 mM (Fig. 5.17b), 1 mM (Fig. 5.17c) and 1.5 mM (Fig. 5.17d) NADPH.Na4
concentrations, respectively. Thus it was clear that the cloned gene product requires at
least 1 mM of NADPH.Na4 for the desired activity.
![Page 27: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/27.jpg)
Chapter 5: Community genomics.........
163
f e
d
b a
c
Fig. 5.16: Dye degradation by pET1 E. coli BL21(DE3) clone with different co-
factors: (a) FAD, (b) FMN, (c) NAD, (d) NADP.Na2, (e) NADH.DPNH and (f)
NADPH.Na4. ( 0 min, 10 min, 20 min and 30 min)
![Page 28: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/28.jpg)
Chapter 5: Community genomics.........
164
d c
b a
Fig. 5.17: Dye degradation by pET1 E. coli BL21(DE3) clone at different
concentrations of NADPH.Na4 (a) 0 mM, (b) 0.5 mM, (c) 1 mM and (d) 1.5 mM.
( 0 min, 10 min and 20 min)
![Page 29: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/29.jpg)
Chapter 5: Community genomics.........
165
Azoreductase assays were carried out for cell extracts of clones carrying azoreductase
gene - E. coli DH10B clone pUC1, E. coli DH10B clone pET1 and E. coli
BL21(DE3) clone pET1. As controls, assays were also carried out for cell extracts of
E. coli DH5α, E. coli DH10B, E. coli BL21(DE3) and E. coli strains with vectors
pUC19 and pET28a+. The comparison of dye degradation capabilities of the
recombinant strains with the control strains is shown in Fig. 5.18. Strains such as E.
coli BL21(DE3) (Fig. 5.18a), E. coli DH5α (Fig. 5.18b) and E. coli DH10B (Fig.
5.18c) could degrade only 26.1%, 32.6% and 22.2% dye, respectively after 3 hours.
Strains with vectors pUC19 (Fig. 5.18d) and pET28a+ (Fig. 5.18e) could also
degrade only 23.5% and 24.4% dye, respectively after 3 hours. Whereas, recombinant
pUC19 with azoreductase gene transformed in E. coli DH10B named as E. coli
DH10B clone pUC1 (Fig. 5.18f) and recombinant pET28a+ with azoreductase gene
transformed in E. coli DH10B named as E. coli DH10B clone pET1 (Fig. 5.18g)
could degrade 24.4% and 59% dye, respectively after 3 hours. On the other hand,
recombinant plasmid, isolated from E. coli DH10B clone pET1, transformed in E. coli
BL21(DE3) named as E. coli BL21(DE3) clone pET1 (Fig. 5.18h) was able to
degrade 90% of dye within 7 minutes.
Thus it can be observed that only 20-30% of total dye was degraded with cell extracts
of strains such as E. coli DH5α, E. coli DH10B, E. coli BL21(DE3) and E. coli strains
containing vectors pUC19 and pET28a+ after 3 hours. Even cell extracts of E. coli
DH10B clone pUC1 and E. coli DH10B clone pET1 could degrade 24.4% and 59%
dye, respectively after 3 hours. In comparison to these controls and recombinant
clones in E. coli DH10B, E. coli BL21(DE3) clone pET1 was able to degrade 90% of
dye and that too within 7 minutes only. Moreover, this also shows that the selection of
right host strain is very important. Because when recombinant pET28a+ was
transformed in E. coli DH10B it could degrade only 59% of total dye in 3 hours.
Whereas, when the same was transformed in E. coli BL21(DE3) it was able to 90% of
dye and that too within 7 minutes only.
![Page 30: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/30.jpg)
Chapter 5: Community genomics.........
166
e f
d c
b a
![Page 31: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/31.jpg)
Chapter 5: Community genomics.........
167
h g
Fig. 5.18: Comparison of dye degradation by cloned gene product with experimental
controls: (a) E. coli B21(DE3), (b) E. coli DH5α, (c) E. coli DH10B, (d) Strain with
vector pUC19, (e) Strain with vector pET28a+, (f) pUC1 E. coli DH10B clone, (g)
pET1 E. coli DH10B clone and (h) pET1 E. coli BL21(DE3) clone. [ 0 min and
3 h for (a-g) / 7 min for (h)]
5.4 Conclusion
The present study helps us to understand the importance of consortium (mixed
cultures) in bioremediation processes. The cloned azoreductase gene, having a length
of 537 bp and containing an ORF of 178 amino acids, on phylogenetic analysis
clustered with azoreductase of Bacillus cereus Q1 (phylum Firmicutes). The
recombinant strains possessed in vitro azoreductase activities. However, they did not
show in vivo activities and reason can be attributed to the fact that recombinant E. coli
strains were unable to uptake azo dyes. The cloned azoreductase requires at least 1
mM of co-factor NADPH.Na4. In comparison to control strains (20-30% of total dye
in 3 hours) and E. coli DH10B recombinant clones (25-60% of total dye in 3 hours),
E. coli BL21(DE3) clone pET1 was able to degrade 90% of dye within 7 minutes
only. The expression analysis of azoreductase gene will be of immense help in
developing novel recombinant strains for application in dye contaminated waste-water
treatment technologies.
![Page 32: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/32.jpg)
Chapter 5: Community genomics.........
168
5.5 References
Anjaneya, O., Souche, S.Y., Santoshkumar, M., Karegoudar, T.B. (2011)
Decolorization of sulfonated azo dye Metanil Yellow by newly isolated bacterial
strains: Bacillus sp. strain AK1 and Lysinibacillus sp. strain AK2. J Hazard
Mater. 190: 351-358.
Anliker, R. (1979) Ecotoxicology of dyestuffs-a joint effort by industry. Ecotox.
Environ Safety. 3: 59-74.
Bin, Y., Jiti, Z., Jing, W., Cuihong, D., Hongman, H., Zhiyong, S., Yongming, B.
(2004) Expression and characteristics of the gene encoding azoreductase from
Rhodobacter sphaeroides AS1.1737. FEMS Microbiol Lett. 236: 129-136.
Blumel, S., Knackmuss, H.J., Stolz, A. (2002) Molecular cloning and characterization
of the gene coding for the aerobic azoreductase from Xenophilus azovorans
KF46F. Appl Environ Microbiol. 68: 3948-3955.
Blumel, S., Stolz, A. (2003) Cloning and characterization of the gene coding for the
aerobic azoreductase from Pigmentiphaga kullae K24. Appl Microbiol
Biotechnol. 62: 186-190.
Chen, H., Hopper, S.L., Cerniglia, C.E. (2005) Biochemical and molecular
characterization of an azoreductase from Staphylococcus aureus, a tetrameric
NADPH-dependent flavoprotein. Microbiology. 151: 1433-1441.
Chen, H., Wang, R.F., Cerniglia, C.E. (2004) Molecular cloning, overexpression,
purification, and characterization of an aerobic FMN-dependent azoreductase
from Enterococcus faecalis. Protein Expr Purif. 34: 302-310.
Chen, H., Xu, H., Kweon, O., Chen, S., Cerniglia, C.E. (2008) Functional role of Trp-
105 of Enterococcus faecalis azoreductase (AzoA) as resolved by structural and
mutational analysis. Microbiology. 154: 2659-2667.
Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the
bootstrap. Evolution. 39: 783-791.
Kadam, A.A., Telke, A.A., Jagtap, S.S., Govindwar, S.P. (2011) Decolorization of
adsorbed textile dyes by developed consortium of Pseudomonas sp. SUK1 and
Aspergillus ochraceus NCIM-1146 under solid state fermentation. J Hazard
Mater. 189: 486-494.
Lowry, H.O., Rosenbrough, N.J., Farr, A.L., Randall, R.J. (1951) Protein
measurement with the Folin phenol reagent. J Biol Chem. 193: 265-75.
Macwana, S.R., Punj, S., Cooper, J., Schwenk, E., John, G.H. (2010) Identification
and isolation of an azoreductase from Enterococcus faecium. Curr Issues Mol
Biol. 12: 43-48.
Mendes, S., Pereira, L., Batista, C., Martins L.O. (2011) Molecular determinants of
azo reduction activity in the strain Pseudomonas putida MET94. Appl Microbiol
Biotechnol. [Epub ahead of print].
![Page 33: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/33.jpg)
Chapter 5: Community genomics.........
169
Nakanishi. M., Yatome, C., Ishida, N., Kitade, Y. (2001) Putative ACP
Phosphodiesterase gene (acpD) encodes an azoreductase. J Biol Chem. 276:
46394-46399.
Nakayama, T., Kimura, T., Kodama, M., Nagata, C. (1983) Generation of hydrogen
peroxide and superoxide anion from active metabolites of naphthylamines and
aminoazo dyes: its possible role in carcinogenesis. Carcinogenesis. 4: 765-769.
Overney, G. (1979) Ueber den aerobe Abbau von Dicarboxyazobenzol durch ein
Flavobacterium sp. Ph.D. thesis ETH 6421. ETH Zurich, Zurich, Switzerland.
Pagga, U., Brown, D. (1986) The degradation of dyestuffs: part II Behaviour of
dyestuffs in aerobic biodegradation tests. Chemosphere. 15: 479-491.
Perez-Pantoja, D., Donoso, R., Junca, H., Gonzalez, B., Pieper, D.H. (2009)
Phylogenomics of aerobic bacterial degradation of aromatics. In Timmis, K.N.
(Eds) Handbook of Hydrocarbon and Lipid Microbiology. Springer-Verlag,
Berlin, pp. 1356-1397.
Petty, N.K., Bulgin, R., Crepin, V.F., Cerdeño-Tárraga, A.M., Schroeder, G.N., Quail,
M.A., Lennard, N., Corton, C., Barron, A., Clark, L., Toribio, A.L., Parkhill, J.,
Dougan, G., Frankel, G., Thomson, N.R. (2010) The Citrobacter rodentium
genome sequence reveals convergent evolution with human pathogenic
Escherichia coli. J Bacteriol. 192: 525-538.
Reisch, M.S. (1996) Asian textile dye markers are a growing power in changing
market. Chem Eng News. 15: 10-12.
Said, G., Ferid, L., Mnejib, M. (2010) Decolourization of an industrial effluent by free
and immobilized cells of Stenotrophomonas maltophila AAP56. Implementation
of efficient down flow column reactor. World J Microbiol Biotechnol. 26: 1341-
1347.
Saitou, N., Nei, M. (1987) The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Mol Biol Evol. 4: 406-425.
Shaul, G.M., Holdsworth, T.J., Dempsey, C.R., Dostal, K.A. (1991) Fate of water
soluble azo dyes in the activated sludge process. Chemosphere. 22: 107-119.
Stolz, A. (1999) Degradation of substituted naphthalenesulfonic acids by
Sphingomonas xenophaga BN6. J Ind Microbiol Biotechnol. 23: 391-399.
Sugiura, W., Yoda, T., Matsuba, T., Tanaka, Y., Suzuki, Y. (2006) Expression and
characterization of the genes encoding azoreductases from Bacillus subtilis and
Geobacillus stearothermophilus. Biosci Biotechnol Biochem. 70: 1655-1665.
Suzuki, Y., Yoda, T., Ruhul, A., Sugiura, W. (2001) Molecular cloning and
characterization of the gene coding for azoreductase from Bacillus sp. 0Y1-2
isolated from soil. J Biol Chem. 276: 9059-9065.
Tamura, K., Dudley, J., Nei, M., Kumar, S. (2007) MEGA4: Molecular evolutionary
genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 24: 1596-1599.
![Page 34: 5.1 Introduction - INFLIBNETshodhganga.inflibnet.ac.in/bitstream/10603/7234/13/13_chapter 5.pdf · metabolism of azo dyes requires specific enzymes (aerobic azoreductases), which](https://reader030.fdocuments.in/reader030/viewer/2022040421/5e0a408950ea4d2b3e57f40e/html5/thumbnails/34.jpg)
Chapter 5: Community genomics.........
170
Tamura, K., Nei, M., Kumar, S. (2004) Prospects for inferring very large phylogenies
by using the neighbor-joining method. Proc Nat Acad Sci. USA. 101: 11030-
11035.
Vakkerov-Kouzova, N.D. (2007) Ochrobactrum intermedium ANKI, a nitrogen-
fixing bacterium able to decolourize azobenzene. Prikl Biokhim Mikrobiol. 43:
450-454.
Zhou, J., Bruns, M.A., Tiedje, J.M. (1996) DNA recovery from soils of diverse
composition. Appl Environ Microbiol. 62: 316-322.
Zimmermann, T., Kulla, H.G., Leisinger, T. (1982) Properties of purified orange II
azoreductase, the enzyme initiating azo dye degradation by Pseudomonas KF46.
Eur J Biochem. 129: 197-203.
Zuckerkandl, E., Pauling, L. (1965) Evolutionary divergence and convergence in
proteins. In Bryson, V., Vogel, H.J. (Eds) Evolving Genes and Proteins.
Academic Press, New York, pp. 97-166.