4.1

Revision

4.2 if, elsif, else

It’s convenient to test several conditions in one if structure:print "Please enter your grades average:\n";

my $number = <STDIN>;

if ($number < 0 or $number > 100) {

print "ERROR: The average must be between 0 and 100.\n";

} elsif ($number > 90) {

print "wow!\n";

} elsif ($number > 80) {

print "well done.\n";

} else {

print "oh well...\n";

}Note the indentation:

a single tab in each line of new block

‘}’ that ends the block should be in the same indentation as where it

started

4.3

if ($age = 18)...Found = in conditional, should be == at ...if ($name == "Yossi")...Argument "Yossi" isn't numeric in numeric eq (==) at ...

Comparison operators

ComparisonNumericString

Equal==eq

Not equal!=ne

Less than<lt

Greater than>gt

Less than or equal to

>=le

Greater than or equal to

<=ge

if ($age == 18){

...

}

if ($name eq "Yossi")...

if ($name ne "Yossi")...

if ($name lt "n")...

ComparisonNumeric

Equal==

Not equal!=

Less than<

Greater than>

Less than or equal to

>=

Greater than or equal to

<=

4.4Loops

Commands inside a loop are executed repeatedly (iteratively):my $num=0;

print "Guess a number.\n";

while ($num != 31) {

$num = <STDIN>;

}

print "correct!\n";

my @names = <STDIN>;

chomp(@names);

my $name;

foreach $name (@names) {

print "Hello $name!\n";

}

4.5 Loops: foreachThe foreach loop passes through all the elements of an array

my @numArr = (1,1,2,3,5);foreach my $number (@numArr) {

$number++;}

Note: The array is

actually changed

4.6Fasta format

Fasta format sequence begins with a single-line description, that start with '>', followed by lines of sequence data that contains new-lines after a fixed number of characters:

>gi|229608964|ref|NM_014600.2| Homo sapiens EH-domain AAACATGGCGGCGCCCTGCGCGGCTTCCCGTCGCCGCAACCGTGGGGCCGGCCCTGCCTTGGAGCGGAGCCGAAGCATCCCTTGCTGCACGCAGGGCAGAGCAGGCGAGGGCTGGGGGCCGTATAACTTATTTTATATCCATATTCAGACTATATAGAGAATATTCTATGCATCTATGACGTGCTTAC>gi|197099147|ref|NM_001131576.1| Pongo abelii EH-domain AGAGCTGAGCGCCTGCCCACAAACATGGCGGCGCCCTGCGCGGCTTCCCTTCGCCGGGACCGCCTGGGGCTGCAGGATGCTGCTGCGGATGCTGAGCTGTCCGCGGGTTGGGCAGCGTCGCTGCGCGGCTTCCCTT>gi|55742034|ref|NM_001006733.1| Xenopus tropicalis EH-domain CGGGCAAGACCACCTTCATCCGCCACCTCATAGAGCAGGACTTCCCCGGCATGAGGATCGGGCCCGAACCGGGGACTTCCTCTGCGCGCCGGCTTCCTGCCCAGCTGGCATTTAAACCACACATGGCGGCGCCCTGCGCGGCTTCCCGTCGCCGCAACCGTGGGGCCGGCC

4.7Breaking out of loops

next – skip to the next iteration last – skip out of the loop

my @lines = <STDIN>;foreach $line (@lines) {

if (substr($line,0,1) eq ">") { next; }if (substr($line,0,8) eq "**stop**") { last; }print($line);

}

4.8

More loops

4.9Scope of variable declaration

If you declare a variable inside a loop it will only exist in that loop

This is true for every {block}:my $name="";

while ($name ne "Yossi") {

chomp($name = <STDIN>);

print "Hello $name, what is your age?\n";

my $age;

$age = <STDIN>;

}

print $name;

print $age;

Global symbol "$age" requires explicit package name

4.10Never declare the same variable name twice

If you declare a variable name twice, outside and inside – you are creating

two distinct variables… don’t do it!my $name = "Ruti";

print "Hello $name!\n";

my $number;

foreach $number (1,2,3) {

my $name = "Nimrod";

print "Hello $name!\n";

}

print "Hello $name!\n";

Hello Ruti!

Hello Nimrod!

Hello Nimrod!

Hello Nimrod!

Hello Ruti!

4.11Never declare the same variable name twice

If you declare a variable name twice, outside and inside – you are creating

two distinct variables… don’t do it!my $name = "Ruti";

print "Hello $name!\n";

my $number;

foreach $number (1,2,3) {

$name = "Nimrod";

print "Hello $name!\n";

}

print "Hello $name!\n";

Hello Ruti!

Hello Nimrod!

Hello Nimrod!

Hello Nimrod!

Hello Nimrod!

4.12 Reminder: Uninitialized (undefined) variables

If uninitialized variables are used (before assignment) awarnings

is issued: my $a;

print($a+3);

Use of uninitialized value in addition (+)

3

my $line;

print("line is $line");

Use of uninitialized value in concatenation (.) or string

line is

4.13

Is this variables defined?

defined check whether a variable was defined.

my $a;

if (defined $a){

print($a+3);

}

my $line = <STDIN>;

while (defined $line){

print "line is $line";

$line = <STDIN>;

}

print "done!!!\n"ctrl-z to

indicate end of input

4.14

Is this variables defined?

defined check whether a variable was defined.

my $line = <STDIN>;

while (defined $line){

if (substr($line,0,1) eq ">"){

print "$line";

}

$line = <STDIN>;

}

4.15FASTA: Analyzing complex input

Assignment:

Write a script that reads several DNA sequences

in FASTA format, and prints for each sequence print

its header and its G+C content

| Obtain from the assignment: Input Required Output Required processes (functions)

4.16FASTA: Analyzing complex input

Overall design:

Read the FASTA file (several sequences).

For each sequence:

1. Read the FASTA sequence

1.1. Read FASTA header

1.2. Read each line until next FASTA header

2. For each sequence: Do something

2.1. Compute G+C content

2.2. Print header and G+C content

Let’s see how it’s done…

Do something

End of input? No

End

Start

Save header

Read line

Header orend of input

Yes

Concatenate to sequence

No

Read line

Read line

4.17

# 1. Read FASTA sequece

$fastaLine = <STDIN>;

while (defined $fastaLine) {# 1.1. Read FASTA header

$header = substr($fastaLine,1);

$fastaLine = <STDIN>;# 1.2. Read sequence until next FASTA header

while ((defined $fastaLine) and

(substr($fastaLine,0,1) ne ">" ))

{

$seq .= $fastaLine;

$fastaLine = <STDIN>;

}

# 2. Do something

... # 2.1 compute $gcContent

print "$header: $gcContent\n";

}

Do something

End of input? No

End

Start

Save header

Read line

Header orend of input

Yes

Concatenate to sequence

No

Read line

Read line

4.18Class exercise 4a

1. Write a script that reads lines of names and expenses:Yossi 6.10,16.50,5.00Dana 21.00,6.00Refael 6.10,24.00,7.00,8.00ENDFor each line print the name and the sum. Stop when you reach "END"

2. Change your script to read names and expenses on separate lines, Identify lines with numbers by a "+" sign as the first character in the string:Yossi+6.10+16.50+5.00Dana+21.00+6.00Refael +6.10+24.00+7.00+8.00END

Sum the numbers while there is a '+' sign before them.

Sum the numbers while there is a '+' sign before them.

Output:Yossi 27.6Dana 27Refael 45.1

Output:Yossi 27.6Dana 27Refael 45.1

4.19Class exercise 4a

3. (Home Ex. 2 Q. 5) Write a script that reads several protein sequences in FASTA format, and prints the name and length of each sequence. Start with the example code from the last lesson.

4*. Write a script that reads several DNA sequences in FASTA format, and prints FASTA output of the sequences whose header starts with 'Chr07'.

5*. As in Q4, but now concatenate all the sequences whose header starts with 'Chr07'.

4.20

A bit aboutReading and writing files

4.21

Open a file for reading, and link it to a filehandle:open(IN, "<EHD.fasta");

And then read lines from the filehandle, exactly like you would from <STDIN>:my $line = <IN>;

my @inputLines = <IN>;foreach $line (@inputLines) ...

Every filehandle opened should be closed:close(IN);

Reading files

4.22

Open a file for writing, and link it to a filehandle: open(OUT, ">EHD.analysis")

NOTE: If a file by that name already exists it will be overwritten!

Print to a file:print OUT "The mutation is in exon $exonNumber\n";

And don't forget to:close(IN);

Writing to files

no comma here

4.23Class exercise 4b

1. Change the script for class exercise 4a.1 to read the lines from an input file (instead of reading lines from keyboard).

2. Now, in addition, write the output of the previous question to a file named "class.ex.4a1.out" (instead of printing to the screen).

3*. Change the script for class exercise 4.a3 to receive from the user two strings: 1) a name of FASTA file 2) a name of an output file. And then - read from a FASTA file given by the user, and write to an output file also supplied by the user.