50

3.0 MATERIALS AND METHODS

3.1 ISOLATION OF THERMOPHILES AND SCREENING FOR

THERMOZYME PRODUCTION

Chemicals:

All microbiological culture media components were purchased from Hi-Media Ltd,

Mumbai, India. Hammerstein grade casein was procured from S. D. Fine chemicals

Ltd, Mumbai. Phenylmethanesulfonylfluoride (PMSF) was procured from Sigma

Aldrich, CA, USA. Magnesium sulfate, sodium carbonate, sodium chloride,

potassium chloride, sodium hydroxide, potassium hydroxide, disodium hydrogen

phosphate, sodium dihydrogen phosphate, calcium chloride, sodium thiosulphate and

magnesium chloride were purchased from Merck India Limited, Mumbai.

Culture Conditions:

Thermophilic bacterial strains Thermus aquaticus and Thermus thermophiles were

procured from Japan Culture of Microorganisms (JCM), Hirosawa, Wako, Saitama,

Japan) as lyophilized powder, revived on medium 276 at 70oC for 24 h in water bath

shaker at 150 strokes/min. 24 h old bacterial culture was stored in 35 % glycerol at -

80° C. For routine work the bacteria was revived in Medium 276 (Table 3.1) at 70 o

C

in a water bath shaker at 150 strokes/min.

Table 3.1 Medium 276 Castenholtz medium

Component Quantity

Tryptone 1.0 g

Yeast extract 1.0 g

Castenholz basal salt solution

(Table 3.2) 100 ml

Distilled water 900 ml

Adjust pH to 8.2 with 0.2 N NaOH before autoclaving.

Water and soil samples were collected from the hot water springs located in

Vajreshwari, Bhiwandi, District Thane, Maharashtra state in India. The temperature of

the water in the Hot water springs ranged in 40°C to 70°C. Samples were collected in

the April 2009. Temperature of the first sampling point was 60°C and the second

sampling point was 70°C. Samples were collected in Autoclaved polypropylene

bottles. Samples were processed further within 6 hr of sample collection.

51

Table 3.2 Castenholtz basal salt solution

Component Quantity

Nitrilotriacetic acid 1.0 g

CaSO4·2H2O 0.6 g

MgSO4·7H2O 1.0 g

NaCl 0.08 g

KNO3 1.03 g

NaNO3 6.89 g

Na2HPO4 1.11 g

FeCl3 solution (0.03%) 10.0 ml

Nitsch's trace elements (Table 3.3) 10.0 ml

Distilled water 1.0 l

Adjust pH to 8.2 before autoclaving.

Table 3.3 Nitsch's trace elements

Component Quantity

H2SO4 0.5 ml

MnSO4·5H2O 2.2 g

ZnSO4·7H2O 0.5 g

H3BO3 0.5 g

CuSO4 0.016 g

Na2MoO4·2H2O 0.025 g

CoCl2·6H2O 0.046 g

Distilled water 1.0 l

Thermus aquaticus and Thermus thermophiles were screened for thermophilic

protease production.

Water and soil samples collected from hot water springs of Vajreshwari were

screened for protease producers using casein plate assay. Colonies found to produce

protease on solid media were studied for protease production in liquid media.

52

Qualitative protease assay:

Cultures/water samples were streaked on plates containing solid medium composed of

Medium 276, 1% casein and 1.1% gelrite as solidifying agent with 0.1% CaCl2 and

incubated for 24 h at 60oC/70

oC. Colony of cultures positive for protease production

forms a transparent zone of clearance due to digestion of casein around the colony

(Gupta et al., 2002).

Quantitative protease assay:

Cultures were grown in liquid medium 276. Cell free broths of cultures were tested

for proteolytic activity assay carried out according to Kunitz (Kunitz 1946) with

modification. The assay mixture contained 0.6% Hammerstein grade casein dissolved

in 50 mM sodium borate/NaOH buffer (pH 10) containing 1 mM CaCl2. The reaction

was initiated by the addition of 0.1 ml cell free broth to 0.5 ml assay mixture, and

incubated at 60oC/70°C for 30 min; the reaction was stopped by transferring the

reaction mixture to an ice bath. After adding 0.5 ml of 5% trichloroacetic acid and

standing for about 30 min, the mixture was centrifuged and the absorbance of the

supernatant was determined at 280 nm. One unit of the protease activity was defined

as the amount of the enzyme that produced trichloroacetic acid soluble materials

equivalent to 1 µg of tyrosine from casein per minute.

3.2 FERMENTATIVE PRODUCTION OF PROTEASE BY THERMUS

AQUATICUS

Inoculum preparation:

Inoculum was prepared in 100 ml Erlenmeyer flasks containing 50 ml of liquid media

consisting of Medium 276. The inoculum was developed by transferring 300 ul of the

bacterial glycerol stock to above mentioned liquid medium. The inoculated flasks

were incubated at 70 oC in water bath shaker at 150 strokes/min for 24 h and used as

the inoculum which was used for all subsequent inoculations unless otherwise stated.

Protease assay:

The proteolytic activity assay was carried out according to Kunitz (Kunitz 1946) with

modification. The assay mixture contained 0.6% Hammerstein grade casein dissolved

in 50 mM sodium borate/NaOH buffer (pH 10) containing 1 mM CaCl2. The reaction

was initiated by the addition of 0.1 ml enzyme sample to 0.5 ml assay mixture, and

incubated at 70°C for 30 min; the reaction was stopped by transferring the reaction

53

mixture to an ice bath. After adding 0.5 ml of 5% trichloroacetic acid and standing for

about 30 min, the mixture was centrifuged and the absorbance of the supernatant was

determined at 280 nm. One unit of the protease activity was defined as the amount of

the enzyme that produced trichloroacetic acid soluble materials equivalent to 1 µg of

tyrosine from casein per minute at pH 10 and 70°C.

Biomass estimation:

The bacterial biomass in the fermentation broth was quantified by dry-cell weight

analysis and by measurement of optical density of the broth. For dry cell weight

determination, cells were recovered by centrifugation at 10,000 x g and 4ºC for 10

min in 2 ml micro-centrifuge tube, and washed twice with 0.9 % saline and once with

distilled water. The recovered biomass was dried to constant weight in an oven (60

ºC) for 24 h. For optical density measurements, the absorbance of properly diluted

broth was read at 660 nm using UV/Vis Hithachi Spectrophotometer.

3.3 FERMENTATION PROCESS OPTIMIZATION

Optimization of fermentation at shake flask level was done using one factor at a time

approach and optimized parameters were subsequently used for statistical media

optimization using Box Behnken design.

3.3.1 One factor at a time study

The independent parameters were evaluated keeping other parameters constant and

selected parameter was incorporated in the next experiment while optimizing the next

parameter (Phadatare et al., 1993).

Effect of temperature and pH:

In order to investigate the effect of temperature and initial pH of medium on protease

production, T. aquaticus YT-1 was cultivated in medium 276 with temperature

ranging from 65 ºC to 75 ºC and initial pH (7-10). The pH was adjusted using diluted

hydrochloric acid and sodium hydroxide before autoclave.

54

Effect of inoculum size:

For optimization of the inoculum size, inoculum was varied with 0.5%, 1%, 1.5% and

2% (v/v) containing a viable cell count of 2 × 108

per ml of T. aquaticus (OD 0.8 to 1

at 660 nm), and transferred to 100 ml Erlenmeyer flasks containing 50 ml of medium

276. All the experiments were performed in triplicates.

Effects of different carbon sources:

To evaluate the effect of different carbon sources on the production of protease,

variety of carbon sources, viz. glucose, lactose, maltose, sucrose, starch, fructose, and

glycerol in addition to medium 276 was used at 1 g/l, 5 g/l and 10 g/l concentrations

for production of protease using T. aquaticus YT-1.

Effects of different organic nitrogen sources:

To study the effects of different organic nitrogen sources on protease production, a

wide range of different protein-rich organic nitrogen sources such as soy peptone,

yeast extract, beef extract, proteose peptone, tryptone, peptone, casein peptone,

soyabean casein digest medium and corn steep liquor were screened for protease

production at 1 g/l, 5 g/l and 10 g/l concentrations.

Effect of inorganic nitrogen sources:

To investigate the effect of inorganic nitrogen sources on thermophilic protease

production, cells were cultivated in the medium containing various inorganic nitrogen

sources such as Tri-ammonium citrate, ammonium sulphate, ammonium chloride,

sodium nitrate, ammonium nitrate at 1 g/l concentration in addition to previously

optimized medium.

3.3.2 Statistical media optimization

Optimization of media components by conventional method which involves the

change of one variable at a time, is time consuming and costly when a large number

of variables are considered and frequently does not assure the determination of

optimal conditions. A substitute to this approach is the optimization of media using

statistical tools such as response surface methodology which can be applied to study

the effects of multiple factors influencing the responses by varying them concurrently

and conducting limited number of experiments.

55

Therefore, to overcome the above mentioned difficulties and to determine the

interaction between the studied variables, response surface method was used for the

optimization process.

Box-Behnken statistical design (Design Expert 6.0.10) for response surface

methodology was used. pH inoculum and Tryptone were the variables studied at 3

levels, 17 experiments were conducted for optimization study (Table 3.4).

Table 3.4 Variables and their levels in Box-Behnken Design

Independent Variables Levels

-1 0 1

X1 = pH 7.5 8.5 9.5

X2 = Inoculum (%) 0.5 1 1.5

X3 = Tryptone (g/l) 2 4 6

Dependent Variables

Y1 = Protease activity (U/ml)

The results were analyzed using ANOVA i.e. analysis of variance suitable for the

experimental design used. The P values were used as a tool to check the significance

of each of the coefficients, which, in turn are necessary to understand the pattern of

the mutual interactions between the test variables. Finally the validation for the RSM

model was also carried out.

56

3.4 SCALE-UP STUDIES FOR PROTEASE PRODUCTION

After optimization at shake flask level the process was scaled up and fermentation

parameters were optimized at 5 l scale fermenter.

Bio-Reactors:

Fermenter 1, a stainless steel vessel with L/D ratio of 1.0 supplied by Navin Process

Systems, Pune, India (Napro) was used in our study. The fermenter was top driven

and contained four evenly spaced baffles. Two adjustable 6-blade disc turbine

impellers were provided on the drive shaft.

Culture condition and media:

All the fermentation runs were carried out at 70°C. Medium used was composed of 4

g/l tryptone, 1 g/l yeast extract and 10 % castenholtz salt solution.

The sterile fermentation medium was inoculated with 1% inoculum of 24h old T.

aquaticus culture, to 2.5 l fermentation medium.

Effect of agitation and aeration:

The effect of different agitation speed (90, 150, 180 and 210 rpm) and different

aeration rate (0.025, 0.5, 1.0 and 1.5 vvm) was studied on the production of protease

and biomass formation as well as substrate utilization pattern.

3.5 DOWNSTREAM PROCESSING AND CHARACTERIZATION OF

PROTEASE

After successful scale up of the fermentation process the protease produced was

recovered using a variety of purification techniques. Protease purified to homogeneity

was characterised to gauge its suitability for applications.

3.5.1 DOWNSTREAM PROCESSING

Estimation of protein:

Protein content was estimated by the Folin–Lowry method using bovine serum

albumin as the standard protein (Lowry et al., 1951). Reagent C was prepared by

adding reagent A (2% Na2CO3 in 0.1N NaOH) and reagent B (50mg CuSO4 and

100mg potassium sodium tartrate in 10 ml) in a ratio of 50:1 The sample (0.1 ml) was

added to 1ml of reagent C. After 10 min, 0.1 ml of Folin reagent (diluted 1:1 with

57

deionized water) was added and mixed. After 30 min, 3.8 ml of distilled water was

added and the absorbance was measured at 660 nm.

Concentrating protease:

The fermented broth was subjected to centrifugation (10000 rpm, 4ºC for 30 min) to

obtain the cell free supernatant. This crude supernatant was used as a source for

protease enzyme. Crude cell free broth was concentrated using 10 kDa molecular

weight cut of filter using Amicon ultrafiltration assembly. The concentrated retentate

was subjected to column chromatography.

The % yield, fold purification and concentration factor were calculated as follows:

%Yield = Total activity in purified sample X 100

Total initial activity

Fold purification = Specific activity of purified sample (U/mg protein)

Specific activity of initial sample (U/mg protein)

Chromatographic purification:

All chromatographic separations were performed using a Biologics Duo Flow system

(Bio-Rad, USA). Various anion exchange and cation exchange resins like UNO Q,

UNO S, DEAE cellulose, Poros 50 PI and Poros 50 HS were screened for binding of

protease or impurities.

Resins were packed in a column (10 mm diameter and 3.9 ml bed volume) was

equilibrated with 0.05 M Borate NaOH buffer, pH 10.5. A flow rate of 0.5 ml/min

was maintained throughout the run. Ultrafiltered sample (1 ml) was loaded on to the

column. Thereafter, the column was washed with 12 ml of the equilibrating buffer to

remove unbound or weakly bound protein. Fractions (2 ml) were collected prior to

elution. Elution was carried out by linear gradient of increasing ionic strength of the

buffer in a with 0-1M NaCl in 12 ml. Collected fractions were analyzed for protein

content and protease activity (Prakash et al., 2010).

Three phase partitioning:

Ammonium sulfate (30%, w/v) was added to the crude enzyme at 4°C and then mixed

gently to dissolve the salt. After the addition of t-butanol with the ratio of 1:1 (v/v) the

mixture was vortexed gently for 1 min and then allowed to stand for 2 h at 4°C,

58

afterwards, the mixture was centrifuged at 5000 rpm for 15 min at 4°C to facilitate the

separation of phases. The upper t-butanol layer was removed carefully. The lower

aqueous layer (bottom phase) and the interfacial precipitate layer (protein precipitated

phase) were separated. The interfacial precipitate was then dissolved in 2 ml of

Borate- NaOH buffer (0.5 M, pH 10.5) and dialyzed against the same buffer for 8 h to

remove any bound ammonium sulphate. Dialyzed precipitates and the aqueous phases

were then assayed for protease activity and total protein content. Effect of various

parameters on three phase partitioning was studied. The influence of ammonium

sulfate concentration (20-40%, w/v), ratio of crude enzyme extract to t-butanol (1:0.5-

1:2, v/v), pH (7-12) and temperature (4-40°C) on the partitioning behaviour of

protease were studied. The purified protease obtained under optimized conditions was

used for further characterization in order to determine the biochemical properties of

the protease. The activity of the crude protease initially added was considered as

100% (Dennison & Lovrien 1997). All the experiments were run in triplicates and the

difference in the readings was less than ±5%.

Electrophoretic analysis and zymogram:

(i) SDS-PAGE: Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis

(PAGE) was performed with 12% polyacrylamide gels (Laemmli 1970). Molecular

weight markers (Prestained Protein Ladder with molecular weights, 10,000 to 170,000

Da; Fermentas, USA) were included, the gel was stained with coomassiae brilliant

blue R-250 and then destained. Comassiae stained gels were silver stained to improve

visibility of protein bands.

(ii) Zymogram: To prepare a zymogram, protease samples were mixed with

electrophoresis sample buffer without heat denaturation prior to electrophoresis. SDS-

PAGE was carried out at 4°C by using a 14% polyacrylamide gel containing 0.1%

gelatin. After electrophoresis, the gel was incubated with 50 mM Borate-NaOH

buffer, pH 10.5 for 2h at 70°C. The gel was stained with coomassiae brilliant blue R-

250 and then destained. Protease bands were observed for clear zones against blue

background (Azeredo et al., 2003).

59

3.5.2 PROTEASE CHARACTERIZATION

The purified protease was characterised for its biochemical properties to gauge its

suitability for industrial application.

pH optima and pH stability:

Protease activity was also measured at 70°C in the following buffer systems: 50 mM

Tris-HCl (pH 7-8), 50 mM Glycine-NaOH (pH 9-10) and 50 mM Borate-NaOH

buffer (pH 10.5, 11, 12) to determine the optimum pH. To assess pH stability,

protease was incubated for 180 min in 50 mM Tris-HCl (pH 7-8), 50 mM Glycine-

NaOH (pH 9.0-10) and 50 mM Borate-NaOH buffer (pH 10.5, 11, 12) and residual

activity was determined under standard assay conditions (Prakash et al., 2010).

Temperature optima and stability:

In order to determine the optimum temperature, protease activity was measured in 50

mM Borate-NaOH buffer, pH 10.5 at 50-80°C. To test the thermostability, the

protease was incubated at various temperatures in the presence and absence of Ca+2

ranging from 70 to 90°C for 30 to 180 min, then cooled on ice and the residual activity

was measured under standard protease assay conditions (Prakash et al., 2010).

Enzyme kinetics:

The protease activity was assayed with 0.25-6 mg/ml of casein as a substrate in 50

mM Borate-NaOH buffer (pH 10.5) containing 1 mM CaCl2 at 70°C. Kinetic

parameters, such as Km and Vmax for casein were obtained using Eadie-Hofstee plot.

Eadie-Hofstee plot is a graphical representation of enzyme kinetics in which

reaction is plotted as a function of the velocity (V) vs. velocity: substrate

concentration ratio (V/S) (Prakash et al., 2010).

Effect of Metal ions, inhibitors and reducing agents:

To study the effect of various metal salts, inhibitors and reducing agents, protease

activity assay was performed using substrate containing various metal salts, inhibitors

and reducing agents at a concentration of 1mM and 10 mM under standard protease

assay conditions (Prakash et al., 2010).

60

Solvent stability:

Stability of the protease against different solvents was determined by incubating the

protease with each solvent and water at 1:4 (v/v) ratio at 70°C for 180 min. Residual

activity after incubation was determined using standard assay conditions. Controls

were maintained without solvent in reaction mixture (Gupta and Khare, 2006).

Surfactant detergents and oxidizer stability:

Residual activity was determined in presence of various surfactants, detergent and

oxidizer at 0.5 or 1 g/dl. The commercial detergents were boiled for 60 min to

inactivate any protease present in the detergent formulation before use (Prakash et al.,

2010).

3.6 APPLICATIONS

Purified protease studied for its efficacy in various applications like silver recovery

from used X-ray film and application as detergent additive.

3.6.1 Bioprocessing of Used X-ray Films for Silver Recovery by Protease:

In this study X-ray film was cut into pieces and incubated with enzyme for gelatine

hydrolysis and subsequent release of silver. Process parameters like pH and

temperature of hydrolysis were optimized. Also reusability and operational

inactivation kinetics was studied.

Hydrolysis of gelatin layers of X-ray film and release of silver:

Used X-ray films were washed with distilled water and wiped with cotton bud

impregnated with ethanol. The washed film was dried in an oven at 50°C for 60 min. 1

g of X-ray film (cut into 2 x 2 cm pieces) was then incubated with 40 ml of 45 U ml-

1enzyme in 50 mM sodium borate/NaOH buffer (pH 10) containing 1 mM CaCl2

(such that the film is completely immersed in the solution) at 70°C in a water bath

shaker. Samples were removed at 10 min intervals till the film was rendered

transparent. Soluble protein in the samples withdrawn was estimated using folin lowry

method to monitor progress in gelatin hydrolysis. Silver released in the reaction

mixture (hydrolysate) can be observed visually as black particles (Shankar et al.,

2010). Reproducibility was verified by repeating the experiments in triplicate and the

standard deviation in all the experimental results was within 5%.

61

Effect of pH, temperature & enzyme activity on gelatin hydrolysis:

1 g film was hydrolysed in 40 ml of crude enzyme with 45 U ml-1

protease activity as

described earlier. Hydrolysis of gelatin was studied at different pH ranging from 8-12

at 70°C (50mM NaH2PO4/Na2HPO4 buffer of pH 8.0, 50 mM sodium borate/NaOH

buffer of pH 9.0-12.0). Enzyme free controls were maintained for each pH in

respective buffers (Shankar et al., 2010).

For determination of optimum temperature, gelatin hydrolysis was carried out at pH

10 and temperatures ranging from 50°C to 90

°C. Enzyme free controls were

maintained at pH 10 for each temperature studied. Effect of enzyme activity on

hydrolysis of gelatin was analyzed by incubating 1 g film with 40 ml of protease

activity ranging 15 U ml-1

to 75 U ml-1

at 70˚C and pH 10. Samples were removed at

10 min intervals till the film was rendered transparent and time required for complete

removal was noted (Shankar et al., 2010).

Thermal stability of Enzyme:

For determination of thermal stability of the enzyme, crude enzyme was incubated at

50˚C to 100˚C and samples withdrawn at 1 h and 3 h. The withdrawn samples were

assayed for protease activity and residual activity determined as percentage of initial

activity (Fujiwara et al., 1991).

Enzyme reusability and inactivation kinetics:

Reusability of enzyme for gelatin hydrolysis for silver recovery was studied by

incubating 1 g of X-ray film with 40 ml of enzyme with 83.3 U ml-1

activity at 70˚C,

pH 10. After complete removal of gelatin (till the film was rendered transparent), old

X-ray film was removed and fresh 1 g X-ray film was added to the same enzyme

solution and incubation continued till complete removal of gelatin was observed.

Samples were withdrawn after every 15 min to monitor gelatin hydrolysis (Shankar et

al., 2010). These samples were also analyzed for residual protease activity to study

inactivation kinetics of enzyme during hydrolytic process (Pal and Khanum 2010).

Atomic absorption spectroscopy for silver estimation:

1 g X-ray film was incubated with 40 ml of 45 U ml-1

crude enzyme at 70˚C and pH

10, on a water bath shaker for 30 min. The hydrolysed reaction slurry was acid

digested in aqua regia (HCl: HNO3, 3:1 v/v) till a clear solution was obtained and

62

used for analysis of silver by Atomic Absorption Spectrophotometer Perkin Elmer

AA700 (Shankar et al., 2010)

3.6.2 Application of protease as detergent additive:

A clean piece of cloth was taken and its whiteness was noted on Hunter colorimeter. It

was then soaked in blood and other stains including juices of beet root, carrot,

coriander, coffee and tea. Each stain was used to stain four pieces of clothes to be

washed with simply water, enzyme inactivated detergent (control), detergent without

inactivation of enzyme and enzyme inactivated detergent incorporated with TPP

purified enzyme respectively. The cloths were then dried and soaked in 2%

formaldehyde and washed with water to remove the excess formaldehyde. Each piece

of cloth for every stain was washed with simply water, enzyme inactivated detergent

(control), detergent and enzyme inactivated detergent incorporated with TPP purified

enzyme respectively. The clothes were kept in shaker at 180 rpm for 15 minutes at

70oC in 7mg/ml detergent to stimulate the washing conditions. The clothes were

washed, dried and their whiteness was noted on Hunter colorimeter (Phadatare et al.,

1993).

3.6.3 Chicken feather degradation using Thermus aquaticus and production of

keratinolytic protease:

Chicken feathers were procured from local poultry farm. Yeast extract, Tryptone of

bacteriology grade were purchased from Himedia Ltd, Mumbai, India. Hammerstein

grade casein was procured from S. D. Fine chemicals Ltd, Mumbai. All other

chemicals were of analytical grade.

Feather processing:

Chicken feathers were collected from a local poultry farm. Feathers were washed with

water until clean. These clean feathers were dried at 60°C.

Protease production:

Thermus aquaticus was cultured in 50 ml Medium 276 with Chicken feather in a 100

ml Erlenmeyer flask post autoclave and incubated in water bath shaker at 70°C, 150

strokes/ min for 48 h. Cell free broth was prepared by centrifugation (10000 rpm, at

4oC) and was used as source of protease for further study.

63

Determination of protease activity:

The proteolytic activity assay was carried out using casein as substrate [Kunitz 1946]

with modification. The assay mixture contained 0.6g/dl Hammerstein grade casein

dissolved in 50 mM sodium borate/NaOH buffer (pH 10.5) containing 1 mM CaCl2.

The reaction was initiated by the addition of 0.1 ml protease sample to 0.5 ml assay

mixture, and incubated at 70°C for 30 min; the reaction was stopped by transferring

the reaction mixture to ice bath. After adding 0.5 ml of 5g/dl trichloroacetic acid and

standing for about 30 min, the mixture was centrifuged and the absorbance of the

supernatant was determined at 280 nm. One unit of the protease activity was defined

as, the amount of the protease that produced trichloroacetic acid soluble materials

equivalent to 1 µg of tyrosine from casein per minute at pH 10.5 and 70°C.

Effect of pretreatment of chicken feather on keratinolysis and protease

production:

To investigate the effect of pretreatment on keratinolysis and protease production,

feathers were pretreated as follows:

Pretreatment 1: 1 g/l Chicken feathers without any pretreatment were added to

Medium 276 and autoclaved.

Pretreatment 2: 1 g/l Chicken feathers were Ethanol sterilized and were transferred

aseptically to autoclaved Medium 276.

Flasks were observed for keratinolysis and protease activity was assayed at 48 h after

inoculation of T. aquaticus.

Effect of Feather meal concentration on keratinolysis and protease production:

Chicken feathers in the range of 1-10 g/l were added to Medium 276 and autoclaved,

inoculated with T. aquaticus and incubated for 48 h at 70°C in water bath shaker at

150strokes/min. Flasks were observed for keratinolysis and protease activity was

assayed after 48 h after inoculation of T. aquaticus.

Effect of Chicken feather concentration on keratinolysis and protease

production:

Chicken feathers were autoclaved at 120oC for 2 h, dried at 60°C and ground to get

chicken feather meal. Feather meal in the range of 1-4 g/l was added to Medium 276

and autoclaved, then inoculated with Thermus aquaticus and incubated for 48 h at

64

70°C in water bath shaker at 150strokes/min. Flasks were observed for keratinolysis.

Since complete keratinolysis of Feather meal was observed at 24 h, protease activity

was assayed at 24 h after inoculation of T. aquaticus.

Single-factor experiments:

To study the effect on protease production, components of Medium 276 were used

individually (1 g/l yeast extract, 1 g/l tryptone and 10 % castenholtz salt solution) and

in combination to media containing 4 g/l Chicken feathers.

Free amino acid analysis of keratin hydrolysate:

Free amino acid liberated in 4 g/l Chicken feather with Medium 276 after 48 h of

fermentation were analysed. 20 µl cell free broth was analysed by HPLC (Shimadzu

prominence), using fluorescence detector after o-phthalaldehyde derivatization.

3.7 IMMOBILISATION OF PROTEASE ON MAGNETIC FERROUS

MICRO PARTICLES

In this study purified protease was immobilized on ferromagnetic particles to study

effect of immobilization on properties of protease.

Preparation of ferrous micro particles:

An aqueous suspension of Fe(OH)2 was prepared by adjusting the pH of 0.1 M FeCl2

aqueous solution (25 ml) to 7.8 by adding the necessary amount of 1 M KOH to the

aqueous solution. The solution colour changed to dark green. Then, 250 μl of H2O2,

3% aqueous solution was added to the suspension, to yield a black precipitate that was

strongly attracted to a permanent magnet. The particles were separated by magnetic

decantation, and washed with 3 washes of 20 ml distilled water and 2 washes of 20 ml

acetone, then dried in air at room temperature (Rossi et al., 2004).

Functionalization:

Iron oxide microparticles (25 mg) were re-dispersed in 100 ml ethanol by sonication.

Then, 70 μl 3-(aminopropyl) triethoxysilane was added with mechanical stirring and

the solution was kept stirring at room temperature overnight. Black precipitate formed

was separated by magnetic decantation. The precipitate was washed with 3 washes of

20 ml ethanol and dried in air at room temperature (Rossi et al., 2004).

65

Enzyme attachment:

Amino-functionalized magnetic microparticles (2.5 mg) were re-dispersed by

sonication in 2 ml 10% glutaraldehyde phosphate buffer solution at pH 7.4 and stirred

for 1 h. The microparticles were then separated by magnetic decantation, washed, and

re-suspended in 2 ml buffer solution. Enzyme solution was prepared in 2 ml

phosphate buffer pH 7.4. The enzyme solution was combined with the microparticles

solution. The reaction mixture was gently stirred overnight. The protease–magnetite

microparticles were separated by magnetic decantation and then washed with a

phosphate buffer solution at pH 7.4 (4 washes of 4 ml), and with phosphate buffer

solution at pH 6.5 (2 washes of 4 ml). The particles were re-suspended in 5 ml

phosphate buffer solution at pH 6.5. The stock solution of protease-coated magnetite

microparticles was stored at 4oC until used (Rossi et al., 2004).

The sample was mixed with dry KBr and spectrum was recorded using Perkin Elmer

Spectrum 100 instrument for FTIR analysis.

pH optima and pH stability:

Protease activity of enzyme immobilized particles was measured at 70°C in the

following buffer systems: 50 mM Tris-HCl (pH 7-8), 50 mM Glycine-NaOH (pH 9-

10) and 50 mM Borate-NaOH buffer (pH 10.5, 11, 12) to determine the optimum pH.

To assess pH stability, protease was incubated for 180 min in 50 mM Tris-HCl (pH 7-

8), 50 mM Glycine-NaOH (pH 9.0-10) and 50 mM Borate-NaOH buffer (pH 10.5, 11,

12) and residual activity was determined under standard assay conditions (Prakash et

al., 2010).

Temperature optima and stability:

In order to determine the optimum temperature, protease activity of enzyme

immobilized particles was measured in 50 mM Borate-NaOH buffer, pH 10.5 at 50-

80°C. To test the thermostability, the protease was incubated at various temperatures

ranging from 70 to 90°C for 30 to 180 min, then cooled on ice and the residual activity

was measured under standard assay conditions (Prakash et al., 2010).

66

Enzyme kinetics:

The protease activity was assayed with 0.25-6 mg/ml of casein as a substrate in

50mM Borate-NaOH buffer (pH 10.5) containing 1 mM CaCl2 at 70°C. Kinetic

parameters, such as Km and Vmax for casein were obtained using Lineweaver burk

plot (Prakash et al., 2010).

Solvent stability:

Stability of the protease immobilized particles was determined by incubating the

protease with butanol 25% at 70°C for 180 min. Residual activity after incubation was

determined using standard assay conditions. Control was maintained without butanol

in reaction mixture (Gupta and Khare, 2006).

Reusability study:

Enzyme immobilized micro particles were incubated with 0.5 ml mixture containing

0.6% Hammerstein grade casein dissolved in 50 mM sodium borate/NaOH buffer (pH

10) containing 1 mM CaCl2 at 70°C for 30 min; the reaction was stopped by

transferring the reaction mixture to an ice bath. Enzyme immobilized microparticles

were separated using magnetic decantation. After adding 0.5 ml of 5% trichloroacetic

acid and standing for about 30 min, the mixture was centrifuged and the absorbance

of the supernatant was determined at 280 nm. One unit of the protease activity was

defined as the amount of the enzyme that produced trichloroacetic acid soluble

materials equivalent to 1 µg of tyrosine from casein per minute at pH 10 and 70°C.

Separated enzyme immobilized microparticles were reused for the next cycle of

casein hydrolysis. Residual activity was calculated after every reuse.

67

3.8 CLONING AND EXPRESSION OF PROTEASE IN E.COLI

Table 3.5 Composition of solutions and buffers:

Buffer/Solution Components Processing

/storage

STET buffer:

8% sucrose

5% Triton X-100

50mM Tris-HCl (pH8.0)

50mM EDTA pH 8.0

Filter sterilized and

Stored at 4oC

Lysozyme-RNase

mixture

10mg/ml lysozyme

1mg/ml RNase in 50mM Tris-HCl

pH8.0

Store at -20oC in

small aliquots.

50X TAE

40mM Tris base

40mM Glacial acetic acid

2mM EDTA.

Stored at 4oC

6X gel loading buffer

for DNA

0.25% bromophenol blue

0.25% xylene cyanol FF

30% Glycerol

Stored at 4oC

Ethidium bomide

stock 10mg/ml in distilled water

Working solution

5µg/ml. Stored at

4oC

Luria Bertani (LB)

medium

1% Tryptone

0.5% yeast extract

0.5% NaCl

Adjust pH-7.0 with

10 N NaOH, and

autoclave.

LB agar

1% Tryptone

0.5% yeast extract

0.5% NaCl

2% Agar

Adjust pH-7.0 with

10 N NaOH, and

autoclave.

Ampicillin 50mg/ml in sterile distilled water Filter sterilized and

stored at –20 oC

Isopropyl β-D-1-

thiogalactopyranoside

(IPTG)

IPTG- 20mg/100l

Filter sterilized,

store at -20ºC.

Surface spread 4l

of IPTG / LB

68

ampicillin plate

Tris EDTA buffer,

pH 8.0

10mM Tris base

1mM EDTA

1M Tris-HCl, pH-8.0

Stored at 4oC

Tris saturated phenol Distilled phenol saturated with 0.5M

Tris-HCl, pH 8.0 Stored at 4

oC

CHISAM Chloroform: isoamyl alcohol (24:1

ratio)

Acrylamide solution 30.0 gm acrylamide

0.8gm Bis-acrylamide

Made up the

volume to 100ml

with distilled water,

filtered and stored

in amber coloured

bottle.

Resolving gel buffer 1 M Tris-HCl, pH 8.8

Spacer gel buffer 1M Tris-HCl, pH-6.8

Sodium Dodecyl

Sulphate (SDS) 10% (SDS)

Ammonium

persulphate (APS) 10% (APS)

Electrode buffer

25 mM Tris base

190 mM Glycine

0.1% (w/v) SDS

4X SDS-sample

buffer

4.0 ml Distilled water

1.0 ml 0.5 M Tris-HCl, pH 6.8

0.8 ml Glycerol

1.6 ml 10% SDS

0.4 ml -mercaptoethanol

0.2 ml 0.05% bromophenol blue

Stored at 4oC

69

Table 3.6 Resolving gel composition:

Percentage 7.5% 10% 12% 15%

Water 7.0 4.0 3.3 2.3

30%Acrylamide 4.0 3.3 4.0 5.0

1 M Tris-Cl

pH 8.8 3.8 2.5 2.5 2.5

10% SDS 0.15 0.1 0.1 0.05

TEMED 0.009 0.004 0.004 0.002

10%APS 0.15 0.1 0.1 0.05

Total volume 15 ml 10 ml 10 ml 10 ml

Table 3.7 Stacking gel composition:

Water 0.68 1.4

30%Acrylamide 0.17 0.33

1 M Tris-Cl pH 6.8 0.13 0.25

10% SDS 0.01 0.02

TEMED 0.01 0.02

10%APS 0.001 0.002

Total volume 1 ml 2 ml

Table 3.8 Coomassie blue staining:

Solution Components Procedure

Coomassie blue stain

Coomassie blue R250 0.25%

Glacial acetic acid 10 %

Methanol 50 %

Water 40 %

Keep the gel in

Coomassie blue stain

solution for overnight

on rocker

Destaining solution

Glacial acetic acid 10 %

Methanol 50 %

Water 40 %

Keep the gel in

destain solution on

rocker till visible blue

bands appear

70

Table 3.9 Silver staining:

Solution Components

Fixing solution

Glacial acetic acid 10 %

Methanol 50 %

Water 40 %

Sensitization solution

100ml

Methanol 30 ml

NaS2O7 200 mg

CH3COONa 6.8 gm

Water 66 ml

Silver nitrate solution

100 ml

AgNO3 250 mg

Water 100 ml

Formaldehyde 40 ul

Developing solution

100 ml

Na2CO3 2.5 gm

Water 100 ml

CH2O 40 ul

Stopping solution

100 ml

EDTA 1.4 gm

Water 100 ml

Isolation of genomic DNA:

1. Centrifuge 15 ml 24 h old culture at 10000 rpm for 15mins.

2. Decant the cell free media.

3. Re-suspend cell pellet in 900 μl of STET buffer and transfer to 1.5ml tube.

4. Add 200ul RNAse-Lysomzyme mix and boil for 1min 45 sec and cool in ice.

5. Add 200ul protinase k and incubate at 65o C for 40 mins, centrifuge at 13000

rpm 4o C for 15 min.

6. Separate the Aqueous layer and add 0.5 volume Chloroform: isoamyl alcohol

(24:1) and 0.5 volume of phenol. Repeat for 4 times.

7. Separate the aqueous layer and add equal volume of phenol. Repeat 2 times.

8. Separate the Aqueous layer and add 1/10 volume of 4 M LiCl, keep on ice for

15 min.

9. Centrifuge at 13000 rpm for 10 min at 4o C.

10. Separate the aqueous layer and add equal volumes of isopropanol to it, mix

well and incubate at room temperature for 5 min.

11. Centrifuge at 13000 rpm for 10 min at 4o C.

71

12. Wash the pellet with 2 washes of 80 % ethanol; let ethanol evaporate at room

temperature. Re-suspend in 50 μl distilled water or Tris EDTA buffer.

Primer:

Primer designing was carried out on the basis of the protease gene sequence available

with GenBank (GenBank Accession No. 90108.1) also termed as aquI of the T.

aquaticus. Primers were designed to include complete coding sequence including the

signal peptide. Sequences of the primers used for amplification of aquI gene are as

given in Table 3.10.

Table 3.10 Primer sequence used for aquI amplification

Primer Primer Sequence 5ˈ-3ˈ Number

of bases

Tm (ºC) CG %)

Forward CACCatgaggaagacttattggc 23 65.5 50

Reverse gcgctggagccagaactcgta 21 70.8 50

*Pl note in F.P, CACC is added for directional cloning as per vector manufacturer’s

recommendation. In R.P, the penultimate ‘Pro’ and the last ‘stop’ codons have been

removed to facilitate 6xHis tag addition. However, the natural autocatalysis may

remove the tag in the final protein.

Agarose gel electrophoresis:

1. Tris-acetate–EDTA (TAE) buffer was prepared and used to pour the gel and

fill the electrophoresis tank.

2. 1 g agarose was added to 100 ml of electrophoresis buffer in a volumetric

flask, heated the slurry in a microwave by swirling the vessel occasionally,

until the agarose was dissolved.

3. The comb was inserted in to the gel tray for well formation. A drop of

ethidium bromide solution (5μg/ml) was added to agarose and swirled.

4. The agarose was poured onto the gel tray to a thickness of 3–5 mm and left to

set (30-40 min).

5. Comb was carefully removed from the gel and tank containing the gel was

filled with electrophoresis buffer.

6. 1 volume of gel loading buffer was added to 6 volumes DNA sample, mixed

well and applied to the wells of the gel.

72

7. The electrodes were connected and power supply was turned on.

Electrophoresis was allowed to continue until the dye have migrated an

appropriate distance.

8. Gel was examined under UV light for band of interest.

PCR amplification:

PCR was performed using the following program:

1. Initial denaturation at 95o

C, 4 min.

2. Denaturation at 95o

C

3. 1 min, annealing at 58o

C.

4. 30 sec and extension at 72o

C.

5. 2 min and an additional 7 min elongation step at the end of the 30th cycle.

PCR product was resolved on 1% agarose gel. A single PCR product of size

1535bp obtained was gel purified. PCR was cleaned up using Qiagen QIAquick

PCR purification columns according to manufacturer’s instruction. The purified

product was quantitated spectrophotometrically at 280nm.

Ligation & Cloning:

Invitrogen Champion pET Directional TOPO 101 expression kit was used for ligation

and cloning of protease gene in E.coli according to manufacturer’s instructions.

Ligation:

According to formula: kb insert *ng vector* vector:insert ratio /kb vector = ng insert

For 5:1 ratio: 1.535 *20*5/5.753 = 26.6 ng PCR product

26 ng PCR product i.e 50ul (1535bp) +20 ng pET-TOPO (5753bp) 1ul

Incubate at 16o C overnight

Transformation:

1. Competent cells of E.coli DH5 were incubated on ice for 30-40 min with

vector-insert ligate.

2. The cells were subjected Heat shock for 90 sec, quench cool on ice for uptake

of vector-insert ligate.

3. 500 ul of LB borth was added and cells were allowed to grow for 1 h at 37o C

73

4. Cells were centrifuged at 3000 rpm for 10 min at room temperature

5. Cell pellet obtained was suspended in 50 ul LB medium and plated on LB

Amp+

plate for screening of putative recombinants

6. Growth on LB Amp+

plate indicates insertion of vector-insert ligate.

Isolation of recombinant plasmid:

Qiagen plasmid isolation kit was used to isolate plasmids from positive clones as per

manufacturer’s instructions.

Restriction enzyme digestion for recombinant plasmid:

Plasmids from positive colonies were subjected to restriction digestion by Apa I. The

restriction enzyme Apa I was purchased from New England Biolabs Pvt. Ltd., India.

The recombinant pET TOPO 101 vector containing insert aquI gene was digested

with Apa I. The reaction mixture was incubated at 37 ºC for 1 hour. After incubation,

reaction was stopped by heating at 65 ºC for 20 min.

After digestion 5 μl of digested plasmid DNA was run on 1.5 % agarose gel along

with undigested recombinant plasmid DNA, and control plasmid.

Transformation of recombinant plasmid into expression host:

Plasmid isolated from the putative recombinants was transformed in E.coli BL-21

cells for expression of the protease under IPTG induction (0.2- 0.8 mM). Complete

gene for thermophilic protease was attempted to be expressed. The expressed protein

was activated into mature active protease (28 kDa) by its autocatalytic cleavage at

70oC by heat treatment (Sakamoto et al. 1995) for 30-120 min.

Analysis of expressed products using SDS-PAGE:

Two glass plates of 8cm x 10 cm dimensions and 1.5 mm spacers were assembled to

set up the gel cast. Resolving gel mix was poured till ¾ th of the size of the gel and

butanol was over layered to remove air bubbles. Once the gel polymerized, butanol

was decanted and comb was inserted in the head space. Following this, stacking gel

mix was overlaid and allowed to polymerise. After polymerisation, the comb was

removed and the wells were washed with electrode buffer. The protein sample was

mixed with sample buffer and heated at 100ºC for 4 min in a boiling water bath. The

samples were loaded in to respective wells and using 1X electrode buffer the gel was

74

electrophoresed at 100 V for 1-2 hours (Laemmli, 1970). Following this, the gel was

carefully removed from the glass plates, rinsed with distilled water and silver stained.

The silver staining procedure was performed as follows:

1. The gel was placed in a plastic container containing fixing solution and

agitated slowly for 30 minutes on a rocker.

2. Subsequently, the gel was soaked for 15 min in sensitization solution on

rocker and later washed thrice in distilled water 5min/wash.

3. The gel was then incubated in silver nitrate solution and agitated slowly on

rocker for 15 min followed by rinsing the gel in distilled water for 2 min and

then developing the gel using developing solution until the bands appear.

4. The reaction was stopped by adding stop solution to the same developing

solution. Gel was stored in 5% w/v glacial acetic acid till observations were

made.