36

36

3. MATERIALS AND METHODS

The present study was undertaken in the Department of Microbiology, College of

Basic Sciences, Himachal Pradesh Agricultural University, Palampur which is located in

the mid-hills and sub-humid agro-climatic zone of Himachal Pradesh, India. This town is

located at 32º6’N, 76º18’E and 1220 m msl.

The chemicals and media components used were of analytical grade (AR)

obtained from Merck limited - India, Sigma-Aldrich Inc. USA, and Hi Media

Laboratories, Mumbai, India. The materials used and the methods employed are

presented below under the following sub-headings:

3.1 Yeast isolates and culture maintenance

3.2 Morphological and biochemical studies on S. cerevisiae strains

3.3 ITS region sequencing

3.4 PCR-RFLP of ITS region

3.4.1 DNA extraction, amplification and visualization

3.4.2 Digestion of PCR products

3.5 Baking traits

3.5.1 Specific growth rate

3.5.2 Acid tolerance

3.5.3 Maltose adaptation

i. Anthrone colorimetric method

ii. Glucose oxidase method

3.5.4 Invertase activity

i. DNS method

3.5.5 Latent time

3.6 Brewing traits

3.6.1 Alcohol production

i. Estimation of ethanol content

3.6.2 Alcohol tolerance

3.6.3 Molasses concentration

37

37

3.6.4 Attenuation and fermentation efficiency

3.6.5 Flocculation

3.7 Killer activity

3.7.1 Assay for mycocinogenic activity

3.7.2 Determination of killer activity by the well test method

3.8 Allele Mining of ADH1 and ATF1 genes

3.9 Organoleptic studies

3.9.1 Selection of fruits

3.9.2 Physico-chemical analysis of apple pulp

3.9.3 Preparation of inoculum

3.9.4 Alcoholic fermentation of apple juice

3.9.5 Analytical techniques

i. Estimation of pH

ii. Estimation of total soluble solids

iii. Estimation of titrable acidity

iv. Estimation of brix-acid ratio

v. Estimation of ethanol content

vi. Estimation of ascorbic acid content

vii. Estimation of reducing sugars

viii. Estimation of total sugars

3.9.6 Sensory evaluation

3.10 Screening of bio-emulsifier producing strains

3.10.1 Growth medium

3.10.2 Extraction of emulsifier

3.10.3 Measurement of emulsification activity

3.11 Statistical analysis of data

3.1 Yeast isolates and culture maintenance

Out of twenty-three S. cerevisiae strains, eighteen strains (Table 3.1) were used in

the present study, because five strains were lost as these could not be revived. S.

cerevisiae strains available with the Department of Microbiology of Himachal Pradesh

38

38

Agricultural University, Palampur were maintained on potato dextrose agar at 4 °C, and

were also preserved in 50 % glycerol at -80 °C.

The composition of potato dextrose agar was:

Potato infusion 300.0 g

Dextrose 20.0 g

Agar 15.0 g

Distilled water 1000 mL

pH 5.6±0.2

Table 3.1 S. cerevisiae strains used in the study along with their source, place of

collection and GenBank accession numbers

S.

No.

Strain

code

Source Place of

collection

GenBank

accession number

aNBAIM

Accession No.

1. Sc01 Chhang Lahaul&Spiti KC515355 Awaited

2. Sc02 Lugari Lahaul&Spiti KC515356 NAIMCC-F-02236

3. Sc03 Dhaeli Lahaul&Spiti KC515357 NAIMCC-F-02237

4. Sc04 Aara Lahaul&Spiti KC515358 NAIMCC-F-02238

5. Sc05 Chiang Lahaul&Spiti KC515359 NAIMCC-F-02239

6. Sc06 Chilra Lahaul&Spiti KC515360 NAIMCC-F-02240

7. Sc07 Bhaturu Lahaul&Spiti KC515361 Awaited

8. Sc08 Babru Lahaul&Spiti KC515362 NAIMCC-F-02241

9. Sc09 Khameer Lahaul&Spiti KC515363 NAIMCC-F-02242

10. Sc10 Faasur Sangla KC515364 Awaited

11. Sc11 Chuli Sangla KC515365 Awaited

12. Sc12 Apple

wine

Sangla KC515366 Awaited

13. Sc15 Beverage Bharmour KC515369 Awaited

14. Sc16 Beverage Pangi KC515370 Awaited

15. Sc19 Wine Sangla KC515373 Awaited

16. Sc20 Wine Sangla KC515374 Awaited

17. Sc21 Wine Sangla KC515375 Awaited

18. Sc24 Fermented

product

Palampur KC515376 Awaited

aNational Bureau of Agriculturally Important Microorganisms, Maunath Bhanjan, Uttar Pradesh, India

39

39

3.2 Morphological and biochemical studies on S. cerevisiae strains

The indigenous yeast strains were streaked on potato dextrose agar. Their

morphological studies with respect to colony characteristics, characteristics in broth

culture, and cell shape were carried out.

The strains were identified on the basis of biochemical characteristics as

described by Lodder (1970) and Barnett et al. (1983). These biochemical characteristics

were growth at different temperatures, growth in presence of 10% ethanol and

fermentation pattern of different sugars.

3.3 ITS region sequencing

Thermo Scientific Phire Plant Direct PCR Kit (F-130) was used to perform

polymerase chain reaction (PCR) directly from the yeast cells with some modifications.

Based on optimization trials, the standardized PCR protocol for 20 µl reaction mixture

included 10 µl of 2X phire plant PCR buffer, 0.4 µl of 10 µM of primer set containing

forward and reverse primers, 0.4 µl of phire hot start II DNA polymerase, 0.5 µl of yeast

cells grown in potato dextrose broth (PDB) and sterilized milli-Q water to make up the

final reaction volume.

Universal primers viz., ITS-1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS-4

(5′TCCTCCGCTTATTGATATGC3′) targeting ribosomal gene region [Internal

Transcribed Spacer region (ITS1 and ITS2), 5.8S and partial regions for 18S -28S] were

used to amplify the genomic DNA of the yeast strains (White et al. 1990).

Amplification was carried out in a thermal cycler (B-96G, TC-PRO, BOECO,

Germany) with an initial denaturation at 94 °C for 5 min, followed by 30 cycles of 30 s at

94 °C, 30 s at 55 °C, 1 min at 72 °C and a final elongation step at 72 °C for 2 min. The

PCR products were resolved in 1.2 % agarose gel in 1x tris acetate EDTA buffer

containing ethidium bromide (0.5 μg/ mL) at 75 V for 90 minutes (Plate 3.1).

The PCR products were freeze dried (CHRIST ALPHA I-2LD) and custom

sequenced (ABI 3730xl automated sequencer) by using same upstream and downstream

primers, by a commercial sequencing facility (Xcelris Labs Ltd., Ahmedabad, India). The

sequences of different isolates of yeasts were edited manually and analyzed using NCBI

BLASTN program (http://www.ncbi.nih.gov/blast; Altschul et al. 1997). The

phylogenetic analyses were carried out in MEGA 5.1 software program.

40

40

The sequences were submitted to GenBank, National Center for Biotechnology

Information (NCBI), USA (Table 3.1). The yeast cultures were deposited with the

National Bureau of Agriculturally Important Microorganisms (NBAIM), Maunath

Bhanjan, Uttar Pradesh, India.

Plate 3.1 PCR amplification of ITS region of S. cerevisiae, Rhodotorula mucilaginosa

and Torulaspora delbrueckii using ITS-1 and ITS-4 primers

3.4 PCR-RFLPof ITS region

3.4.1 DNA extraction, amplification and visualization

Thermo Scientific Phire Plant Direct PCR Kit, F-130 was used to perform

polymerase chain reaction (PCR) directly from the yeast cells. Based on optimization

trials, the standardized PCR protocol for 50 µl reaction mixture; included, 25 µl of 2X

phire plant PCR buffer, 0.6 µl of 10 µM of primer set containing forward and reverse

primers, 1 µl of phire hot start II DNA polymerase, 0.5 µl of yeast cells grown in potato

dextrose broth (PDB) and sterilized milli-Q water to make up the reaction volume. PCR

amplification and visualization of PCR products were done as described in section 3.3.

3.4.2 Digestion of PCR products

The PCR products were digested without further purification with four restriction

endonucleases i.e. AluI, HaeIII, HinfI and TaqI by the following protocol:

PCR product: 10 µl

Buffer: 2 µl

Restriction enzyme: 0.5 µl

Distilled water: 7.5 µl

ITS region of Rhodotorula mucilaginosa

(~800 bp)

ITS region of Torulaspora delbrueckii

(~850 bp)

Ladder

ITS region of

S. cerevisiae (~880 bp)

41

41

The mixture was incubated at 37 ºC for two hours except for TaqI, where

incubation temperature was 60 ºC, the restriction fragments were separated on 1.2 %

agarose gel in 1X TAE buffer. The gels were stained with ethidium bromide, visualized

under UV light and photographed by UVITEC, Cambridge, GeNeiTM

. Sizes of different

bands were estimated by comparison with a DNA length standard. The PCR-RFLP

analyses were carried out using Treeconw software program.

3.5 Baking Traits

Eighteen S. cerevisiae strains were screened for following five baking traits as per

the method of Clement and Hennette (1982):

3.5.1 Specific growth rate

This test included determination of the mean or average multiplication coefficient

(µ) of a given strain by following the variation in optical density of a standard medium

(potato dextrose broth, Hi-Media) seeded with the suspension of yeast cells, at 600nm,

which could be calculated by using formula,

µ= 1/x X dx/dt

where, x represents the cellular population at time t.

3.5.2 Acid tolerance

The log CFU/mL of the yeast strains were measured after incubation of 48 hours

at 30 °C in the presence of an inhibitor i.e. glacial acetic acid at a concentration of 0.466

% (v/v) added in potato dextrose broth where, pH corresponded to 3.45.

3.5.3 Maltose adaptation

Maltose adaptation of the strains was measured in presence of glucose by

determination of the amount of maltose subsisting in a standard medium after a known

amount of glucose added to the medium had been completely consumed. The test was

carried out in 0.01M phosphate buffer medium, pH 6.5, the reaction mixture comprising

of: yeast-20 to 25 mg of dry matter/mL, glucose-4 mg/mL and maltose-2 mg/mL. The

reaction was carried out at 30 °C for one hour and was arrested by sudden cooling and

cold centrifugation. Disappearance of the total sugars in the supernatant was determined

by anthrone colorimetric method (Hodge and Hofreiter 1962) and that of glucose by

glucose oxidase method (Meites 1965). The amount of maltose was determined by the

difference in readings and percentage of maltose consumed was worked out.

42

42

i. Anthrone colorimetric method

a) Standard stock solution of anthrone

Standard stock solution was prepared by dissolving 100 mg of glucose in 100 mL

of distilled water and working standard was prepared by diluting 10 mL of stock solution

to 100 mL with distilled water.

b) Preparation of anthrone reagent

Anthrone reagent was prepared by dissolving 200 mg of anthrone in 100 mL of

ice cold 95 per cent H2SO4.

c) Preparation of standard curve

Standard curve was prepared by taking 0, 0.2, 0.4, 0.6, 0.8 and 1 mL of the

working standard and the volume was made up to 1 mL by adding distilled water. 4 mL

of anthrone reagent was added and the mixture was heated for eight minutes in a boiling

water bath. After rapid cooling, the absorbance was recorded at a wavelength of 630 nm

using SPECTRONIC® GENESYS

TM5 Spectrophotometer. The standard curve so formed

is shown as below (Fig 3.1):

Fig 3.1 Standard curve of anthrone colorimetric method

d) Determination of total sugar from samples

One mL of sample was added directly in the tube. 4 mL of anthrone reagent was

added and the mixture was heated for eight minutes in a boiling water bath. After rapid

cooling, the absorbance was recorded at 630 nm. The amount of total sugars in each

sample was determined by using the standard curve of anthrone.

y = 0.1371x + 0.0065 R² = 0.9988

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.02 0.04 0.06 0.08 0.1

Glucose conc. (mg/mL)

Abso

rban

ce a

t 630 n

m

43

43

ii. Glucose oxidase method

a) Standard stock solution of glucose

Standard stock solution was prepared by dissolving 100 mg of glucose in 100 mL

of distilled water and working standard was prepared by diluting 10 mL of stock solution

to 100 mL with distilled water.

b) Preparation of glucose oxidase peroxidase reagent

Twenty five mg of O-dianisidine was dissolved completely in 1 mL of methanol

and 49 mL of 0.1M phosphate buffer (pH 6.5) was added to it. Then 5 mg of peroxidase

and 5 mg of glucose oxidase were added to the above prepared O-dianisidine solution.

c) Preparation of standard curve

Standard curve was prepared by taking 0, 0.2, 0.4, 0.6, 0.8 and 1 mL of the

working standard glucose solution and the final volume was made up to 1 mL by adding

distilled water. 1 mL of glucose oxidase peroxidase reagent was added and the mixture

was incubated at 35 ºC for 40 minutes. The reaction was terminated by the addition of 2

mL of 6N-HCl. The absorbance was recorded at a wavelength of 540 nm using

SPECTRONIC® GENESYS

TM5 Spectrophotometer. The standard curve so formed is

shown as below (Fig 3.2):

Fig 3.2 Standard curve of glucose oxidase method

y = 0.3782x + 0.0504 R² = 0.9919

0

0.5

1

1.5

2

2.5

0.02 0.04 0.06 0.08 1

Abso

rban

ce a

t 540 n

m

Glucose conc. (mg/mL)

44

44

d) Determination of glucose concentration from samples

One mL of sample was added directly in the tube. 1mL of glucose oxidase

peroxidase reagent was added and the mixture was incubated at 35 ºC for 40 minutes.

The reaction was terminated by the addition of 2 mL of 6N-HCl and the absorbance was

recorded at 540 nm. The amount of glucose in each sample was determined by using the

standard curve of glucose oxidase.

3.5.4 Invertase activity

Each invertase unit is defined as production of a micromole of reducing sugars in

five minutes per mg of yeast dry matter at 30 °C and at pH 4.7, without plasmolysis of

the yeast. 0.2 mg of dry yeast matter was placed in the presence of saccharose at a final

concentration of 0.1 M in an acetate buffer medium, pH 4.7, in a test tube and was placed

in a water bath at 30°C. At the end of five minutes, inversion reaction of saccharose was

blocked by the addition of a reactant sodium dinitrosalycilate which also helped in

determining the reducing sugars formed, by colorimetric method (Miller 1950).

i. DNS method

a) Standard stock solution of glucose

Standard stock solution was prepared by dissolving 100 mg of glucose in 100 mL

of distilled water and working standard was prepared by diluting 10 mL of stock solution

to 100 mL with distilled water.

b) Preparation of dinitrosalicylic acid (DNS) reagent

One gram of dinitrosalicylic acid, 200 mg of crystalline phenol, and 50 mg of

sodium sulphite were simultaneously dissolved in 100 mL of 1 per cent NaOH solution

by stirring.

Forty per cent of Rochelle salt solution (sodium-potassium tartrate solution) was

prepared.

c) Preparation of standard curve

Standard curve was prepared by taking 0, 0.2, 0.4, 0.6, 0.8 and 1 mL of the

working standard glucose solution and the volume was made up to 3 mL by adding

distilled water. 3 mL of DNS reagent was added and the mixture was heated for five

45

45

minutes in a boiling water bath. After the development of the color, 1 mL of 40 per cent

Rochelle salt solution was added (in warm contents) and mixed thoroughly. After cooling

the tubes, the absorbance was recorded at a wavelength of 540 nm using SPECTRONIC®

GENESYS TM

5 Spectrophotometer. The standard curve so formed is shown as below

(Fig 3.3):

Fig 3.3 Standard curve of DNS colorimetric method

d) Determination of invertase activity in samples

One mL of sample was added directly in the tube and the volume was made up to

3 mL by adding distilled water. 3 mL of DNS reagent was added and the mixture was

heated for five minutes in a boiling water bath. The reaction was terminated by the

addition of 1 mL of Rochelle salt solution. After cooling, the absorbance was recorded at

540 nm. The invertase units in each sample were determined by using the following

formula:

Units of invertase activity in each assay tube = ABS/5.0 min * Final volume

a * 1.0 cm

Where, ΔABS = absorbance change

a = milli-molar absorptivity constant

Total units = Number of units / Final volume*Final volume/mL of dilute enzyme added*total

mL of dilute enzyme / mL of stock added*mL of stock fraction / 1

y = 0.2318x - 0.04 R² = 0.9983

0

0.2

0.4

0.6

0.8

1

1.2

0 1 2 3 4 5 6

Abso

rban

ce a

t 540 n

m

Glucose conc. (mg/mL)

46

46

3.5.5 Latent time

The latent time was measured by following the variation in the optical density

(600 nm) of yeast suspension applied in the specific growth rate test after having

conferred on this suspension a sugar concentration of 30 %.

3.6 Brewing Traits

S. cerevisiae isolates were screened for different brewing traits using molasses as

a substrate because it is being used as a carbon source in most of the industries for large

scale production (Keo 1967).

3.6.1 Alcohol production

For the estimation of maximum alcohol content produced by yeasts, molasses was

diluted to 15 °Brix. The solution was then poured into seven different flasks. To each

individual flask different doses of sucrose were added to achieve the final sugar

concentration varying from 22 to 28 °Brix with a difference of 1 °Brix in two consecutive

flasks (Table 3.2).

The molasses was then inoculated with 1 % inoculum and was incubated at 30 °C

for three days.

Table 3.2: Different doses of sucrose added to achieve the final sugar concentration

in the range of 22-28 °Brix

Flask Initial °Brix Sucrose added (%) Final °Brix

1 15 7 22

2 15 8 23

3 15 9 24

4 15 10 25

5 15 11 26

6 15 12 27

7 15 13 28

47

47

i. Estimation of ethanol content

Per cent of ethanol in alcoholic samples was estimated by the method of Caputi et

al. (1968).

a) Standard stock solution of ethanol

Ethanol standards were made by using ethanol-water solution in the range of 0 –

20 % ethanol (v/v).

b) Preparation of potassium dichromate solution

Potassium dichromate solution was prepared by adding 325 mL conc. H2SO4 to

400 mL distilled water in 1 liter volumetric flask. After mixing and cooling (80-90 0C),

33.768 g K2Cr2O7 was added and then final volume of 1 liter was made with distilled

water at 20 0C.

c) Preparation of standard curve

Standard curve was prepared by taking 1 mL of each concentration of the

standard solution [0-20% (v/v)] in a 100 mL volumetric flask containing 25 mL of

potassium dichromate solution. The samples were heated at 60 0C for 20 minutes in a

water bath and then cooled and diluted to 50 mL with distilled water. Absorbance was

recorded at a wavelength of 600 nm using SPECTRONIC® GENESYS

TM5

Spectrophotometer. The standard curve so formed is shown in Fig 3.4.

d) Estimation of alcohol in the samples

One mL of alcoholic sample was added directly to the distillation flask, diluted to

30 mL with distilled water and then distilled. Distillation was carried out at 70+ 2 0C and

20 mL of distillate was collected in a 50 mL volumetric flask containing 25 mL of

potassium dichromate solution. The contents in the volumetric flask were heated at 60 0C

in a water bath for 20 minutes and final volume was made to 50 mL with distilled water.

After mixing and cooling the contents of the flask, the absorbance was recorded at 600

nm. The amount of ethanol in each sample was determined by using the standard curve of

ethanol.

48

48

Fig 3.4 Standard curve for estimation of ethanol content

3.6.2 Alcohol tolerance

To determine the maximum alcohol content tolerated by yeasts, molasses was

diluted to 22 °Brix concentration and poured into five flasks. To each flask, various doses

of alcohol were added to achieve an initial concentration of 2 % in flask 1, 3 % in flask 2

and so on. The flasks were then inoculated and incubated at 30 °C for three days and then

per cent alcohol was estimated by Caputi et al. (1968) method.

3.6.3 Molasses concentration

For the determination of maximum molasses concentration at which the yeasts

remain functional, the molasses was diluted to 22 to 40 °Brix. Then the substrate was

inoculated with 1 % inoculum and incubated at 30 °C for three days. After incubation,

per cent alcohol was estimated in the samples by Caputi et al. (1968) method.

3.6.4 Attenuation and fermentation efficiency

Attenuation and fermentation efficiency were calculated by using the following

formulae:

Attenuation refers to the percentage of sugars converted to alcohol and carbon dioxide, as

measured by specific gravity,

Attenuation= [(OG-FG) / (OG-1)] X 100

y = 0.1136x + 0.0063 R² = 0.9998

0

0.2

0.4

0.6

0.8

1

1.2

0 2 4 6 8 10 12

Ethanol conc. (v/v)

Abso

rban

ce a

t 600 n

m

49

49

Where, OG is original gravity (specific gravity before pitching), FG is final

gravity (specific gravity at the end of the fermentation).

Fermentation efficiency is an expression of how much alcohol was actually

produced in relation to the theoretical production,

Fermentation efficiency (%) = (Actual ethanol recovery (v/v) / Theoretical

ethanol recovery (v/v)) X 100

3.6.5 Flocculation

For measuring the flocculation ability of the yeast strains, modified helm

sedimentation test (Soares and Mota 1997) was performed. All pre-cultures were

prepared by inoculating a loopful of yeast cells in 100 mL of potato dextrose broth. The

cells were incubated at 30 °C on an orbital shaker at 150 rpm, for 48 hours. Flocculent

cells were harvested by centrifugation (4500 X g, 5 min, 4 °C), washed twice in 250 mM

EDTA solution, followed by washing the cells with NaCl solution (250 mM) at pH 2.0

and with NaCl solution (250 mM) at pH 4.5. Cells were finally suspended in NaCl

solution (250 mM) at pH 4.5 at a final concentration of 1 x 108cells/mL. Cell suspension

(24 mL) in NaCl solution (250 mM), at pH 4.5, was placed in a 25 mL cylinder. The

suspension was adjusted to 4 mM Ca2+

with the addition of CaCl2 solution (1.0 mL from

a stock solution of 100 mM, at pH 4.5), and then agitated to promote flocculation.

Eighteen inversions of the cylinder were used to promote flocculation. At defined periods

of time, samples were taken (200-1000 µl) from a fixed position of the cylinder (the level

corresponding to 20 mL), and dispersed in NaCl solution (250 mM) at pH 2.0. Cell

concentration was determined by measuring the absorbance of the suspension at 620 nm.

3.7 Killer activity

The killer yeasts were detected on Yeast Extract Peptone Dextrose (YEPD) agar.

The composition of YEPD agar buffered at pH 4.2 (0.1M citrate-phosphate buffer) was

as follows:

Yeast extract 1 g/L

Peptone 2 g/L

Glucose 2 g/L

Methylene blue 0.05 g/L

50

50

3.7.1 Assay for mycocinogenic activity

Determinations were performed according to the method of Salek et al. (1990).

Sensitive lawns were made by mixing 200 μl of fresh culture of the sensitive strain

MTCC-473, with 20 mL of YEPD and poured in Petriplates. The yeast isolates were

seeded on the sensitive lawns and the plates were incubated at 22, 30 or 37 ºC for 3 to 7

days. Positive killer activity was observed by a clear zone, surrounded by a blue

precipitated halo, indicative of cellular death.

3.7.2 Determination of killer activity by the well test method

The cultures were grown in 200 mL potato dextrose broth in a 500 mL

Erlenmeyer flask for 24 hrs at room temperature on a rotary shaker (120 rpm). After

centrifugation (10,000 X g, for 10 min. at 5 ºC), the supernatant was filtered through 0.45

µm pore size membrane filter (Millipore). The resulting filtrate was incubated for 4 hrs at

4 ºC and the precipitate was collected by centrifugation (10,000 X g, for 20 min.) and

resuspended in equal volume of 0.1 M citrate-phosphate buffer (pH 4.2). This toxin

supernatant was stored at 4 ºC until use (Sawant et al. 1988).

A volume of 100 μl of toxin supernatant was inoculated into wells (10-mm

diameter) cut into sensitive cell lawns and the diameters of the death zones were

measured after incubation for 3 to 7 days at 22 or 30 ºC.

3.8 Allele Mining of ADH1 and ATF1 genes

Ten yeast strains viz., Sc01, Sc03, Sc04, Sc05, Sc11, Sc12, Sc15, Sc19, Sc21 and

Sc24; based on their variation in baking and brewing traits were selected for allele

mining. For DNA isolation, Yeast DNA isolation Kit was used (Xcelgen). The DNA

stock samples were quantified using Nanodrop spectrophotometer at 260 and 280 nm.

Quality and purity of DNA were checked by agarose gel electrophoresis.

The length of ADH1 gene is 1047 bp, hence, two separate primer pairs amplifying

two parts of the gene with overlapping flanking sequences were used (Table 3.3). The

second gene consisted of 2088 bases with 1578 bp long protein coding region of ATF1

gene. ATF1 gene sequence (1578 bp), preceding promoter and TATA box sequences (293

bases) and proceeding 217 bases were amplified and sequenced. For amplification and

sequencing, this 2088 bp region was divided into three overlapping sequences

51

51

(Appendix-1). Three separate primer pairs were used to amplify these three overlapping

sequences (Table 3.3). PCR was carried out in a final reaction volume of 25 µl: DNase-

RNase free water 7.50 μl, 2x PCR master mix (MBI Fermentas) 12.50 μl, forward primer

(10 pmole/μl) 1.00 μl, reverse primer (10 pmole/μl) 1.00 μl and diluted DNA (30 ng/μl)

3.0 μl. Amplification was carried out in the thermal cycler (B-96G, TC-PRO, BOECO,

Germany) with an initial denaturation at 95 °C for 2 min, followed by 30 cycles of 30 s at

94 °C, 30 s at 51 °C, 90 s at 72 °C and a final elongation step at 72 °C for 10 min. To

confirm the targeted PCR amplification, electrophoresis was done (Pate 3.2 and Plate 3.3)

and the amplified PCR products were purified using Qiagen Mini elute Gel extraction kit

according to manufacturer’s protocol.

The purified PCR products were freeze dried (CHRIST ALPHA I-2LD) and

custom sequenced (ABI 3730xl automated sequencer) by using same upstream and

downstream primers, by a commercial sequencing facility (Xcelris Labs Ltd.,

Ahmedabad, India). The complete gene sequences were then recovered by aligning the

overlapping regions of the obtained contigs. The homology search for these sequences

was carried out using an on-line NCBI BLASTN program http://www.ncbi.nih.gov/blast

(Altschul et al. 1997). All the phylogenetic analyses were conducted in MEGA 5.1

software program. The ADH1 and ATF1 gene sequences were submitted at GenBank,

National Center for Biotechnology Information (NCBI), USA (Table 3.4).

Table 3.3: ADH1 and ATF1 gene primer sequences

Primer Sequence

ADH1FL CAGGAAAGAGTTACTCAAGAATAAGAA

ADH1FR TGGGTAACGAATCCAACTGTC

ADH1SL ACGGTGATACCAGCACACAA

ADH1SR CTCGTTCCCTTTCTTCCTTG

ATF1FL TGCACTCGATGGTCTTCTCA

ATF1FR GACAAATTAGCCGCCAACTC

ATF1SL TGCAATGTTCTGCACGTTATT

ATF1SR TAGTTGTGAGCGGCAATCTG

ATF1TL GAACTTCGAATGGCTTACGG

ATF1TR TGCAATGTTCTGCACGTTATT

52

52

Table 3.4: Genbank accession numbers of ADH1 and ATF1 genes along with their

strain codes

S.No. Strain Code ADH1 GenBank

Accession Number

ATF1 GenBank

Accession Number

1 Sc04 KF429720 KF429730

2 Sc24 KF429721 KF429731

3 Sc01 KF429722 KF429732

4 Sc03 KF429723 KF429733

5 Sc05 KF429724 KF429734

6 Sc19 KF429725 KF429735

7 Sc15 KF429726 KF429736

8 Sc11 KF429727 KF429737

9 Sc21 KF429728 KF429738

10 Sc12 KF429729 KF429739

3.9 Organoleptic studies

3.9.1 Selection of fruits

Healthy fruits were selected, washed in hot water, mixed with 0.1 % of potassium

metabisulphite and then used for the extraction of juice. Juice was extracted aseptically

under hygienic conditions.

3.9.2 Physico-chemical analysis of apple juice

The physico-chemical analysis of apple juice was done which included estimation

of TSS, pH, titrable acidity, brix acid ratio, total sugars, reducing sugars and ascorbic

acid.

3.9.3 Preparation of inoculum

The inoculum of six randomly selected S. cerevisiae strains viz. Sc01, Sc02,

Sc05, Sc12, Sc21 and Sc24 was prepared in 250 mL Erlenmeyer flasks containing 100

mL potato dextrose broth inoculated with a loopful of culture and incubated at 28 ± 2 ºC

for 24 hrs with 100 rpm shaking. From this seed inoculum, starter culture was prepared

by inoculating 2 % of seed inoculum to pasteurized apple juice and incubated at 28 ºC for

24 hrs under shaking conditions.

53

53

Plate 3.2 PCR amplification products of ADH1 gene contigs

Plate 3.3 PCR amplification products of ATF1 gene contigs

First part of ADH1 (850 bp)

Second part of ADH1 (500 bp)

First part of ATF1 (850 bp)

Second part of ATF1 (850 bp)

Third part of ATF1 (850 bp)

54

54

3.9.4 Alcoholic fermentation of apple juice

The pasteurized apple juice (1500 mL) was taken in 3000 mL Erlenmeyer flasks

which was adjusted to sugar level of 18 ºBrix using granulated sucrose procured from

local market. Juice was inoculated using 1 per cent inoculum supplemented with

diammonium hydrogen orthophosphate (DAHP) (300 mg w/v) and incubated at room

temperature. The periodic samples were taken, spun at 6000 rpm for 5 minutes and

analyzed for TSS, pH and ethanol content till no further decrease in ºBrix was noticed.

3.9.5 Analytical techniques

i. Estimation of pH

The pH of the periodic samples was determined by using Digital pH meter

(Eutech Instruments, Germany).

ii. Estimation of total soluble solids

Total soluble solids (TSS) in juice were determined by using Erma hand

refractometer of 0-32 ºBrix. A drop of distilled water (at 20 ºC) was placed on clean and

dry prism and calibration was done at zero line on the scale. Then the samples of juice

and cider were analyzed for their TSS value by reading the line of demarcation on the

scale.

iii. Estimation of titrable acidity

It was expressed as per cent acidity and analyzed using the method of Amerine et

al. (1967). Titrable acidity was determined by titrating known quantity of apple juice or

cider sample (10 mL) against standardized 0.2 N NaOH using a few drops of 1 per cent

phenolphthalein solution as indicator to achieve pink colourend point which should

persist for 15 seconds.

Acidity (%) = volume of 0.2 N NaOH used X 0.2 X 6 X 100

10 (volume of sample taken)

iv. Estimation of brix-acid ratio

It was calculated by dividing TSS value with titrable acidity of the juice and cider.

v. Estimation of ethanol content

The estimation was done by chemical oxidation method of Caputi et al. (1968) as

described in section 3.6.1 (i).

55

55

vi. Estimation of ascorbic acid content

Ascorbic acid content was estimated by the method of Ranganna (1976). A dye

solution was prepared in which 42 mg of sodium bicarbonate and 52 mg of

dichlorophenol indophenol were mixed in 200 mL of distilled water. In stock standard

solution, 100 mg ascorbic acid was dissolved in 100 mL of 4 % oxalic acid solution in a

flask (1 mg/mL). For the preparation of working solution, 10 mL of the stock solution

was diluted to 100 mL with 4 % oxalic acid and the concentration of this working

solution was taken 100 µg/mL.

In next step, 5 mL of the working solution was pipetted out into 100 mL conical

flask. 10 mL of 4 % oxalic acid was then added to it and titrated against the dye (V1 mL).

End point was determined by the appearance of pink color which persisted for a few

minutes. 10 mL of sample was taken and 100 mL of volume was made with 4 % oxalic

acid solution. 5 mL of this supernatant was added to 10 mL of 4 % oxalic acid and

titrated against the dye (V2 mL). The results thus, obtained were expressed in terms of mg

ascorbic acid/100 mL of juice or cider. The ascorbic acid content was calculated by using

the following formula:

Ascorbic acid (mg/100 g sample) =

Where, V1 (mL) is the volume of dye used for the end point of standard

V2 (mL) is the volume of dye used for the end point of sample

vii) Estimation of reducing sugars

Reducing sugars were estimated by the method of Miller (1950). Test tubes

containing 3 mL sample and 3 mL DNS reagent were heated for 15 min. in a boiling

water bath. One mL Rochelle salt solution was added to each tube and the tubes were

allowed to cool to room temperature and O.D. was measured at 575 nm using

SPECTRONIC® GENESYS

TM5 Spectrophotometer. The concentration of reducing

sugars (as glucose) was calculated from the standard curve (Fig 3.5).

viii) Estimation of total sugars

Total sugars were estimated by phenol-sulphuric acid method of Dubois et al.

(1956) using glucose as standard. For estimation purposes, different aliquots of 0.2 mL

0.5 mg×V2×100 mL×100

V1×15 mL×Wt. of the sample

56

56

cider were taken in test tubes and distilled water was added to make the volume 1 mL. It

was followed by addition of 1 mL of 5 per cent phenol and 5 mL conc. sulphuric acid.

The acid was poured directly in the center of the test tube to ensure that temperature rises

Fig 3.5 Standard curve of DNS colorimetric method

to 70 ºC for optimal color development. The test tubes were kept for 10 min at room

temperature and then cooled under tap water. A stable yellow orange color developed

after about 20 min. Absorbance was recorded at 490 nm using SPECTRONIC®

GENESYS TM

5 Spectrophotometer against a reagent blank. The concentration of total

sugars was calculated from the standard curve by using glucose as standard (Fig 3.6).

Fig 3.6 Standard curve of phenol-sulphuric acid method

y = 0.0071x - 0.0046 R² = 0.9992

0

0.01

0.02

0.03

0.04

0.05

0.06

0.07

0.08

0 2 4 6 8 10 12

y = 0.0066x + 0.022 R² = 0.9963

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0 20 40 60 80 100 120

Abso

rban

ce a

t 5

75

nm

Glucose conc. (µg/mL)

Glucose conc. (µg/mL)

Ab

sorb

ance

at

49

0 n

m

57

57

3.9.6 Sensory evaluation

The organoleptic evaluation of cider was done on the basis of appearance, color,

flavor, mouthfeel and overall acceptability by a panel of judges. Consumer acceptance for

the products was evaluated on a nine point “Hedonic scale” (Amerine et al. 1965) with

following scale

Table 3.5 Nine point Hedonic scale for sensory evaluation of apple cider

Scale Sensory Score

Liked extremely 9

Liked very much 8

Liked moderately 7

Liked slightly 6

Neither liked nor disliked 5

Disliked slightly 4

Disliked moderately 3

Disliked very much 2

Disliked extremely 1

3.10 Screening of bio-emulsifier producing strains

3.10.1 Growth medium

For screening of emulsifier production by intact cells, yeast strains were grown in

Yeast Casamino Glucose (YCG) medium; 0.5% (w/v) yeast extract, 1% casamino acids

and 1% glucose, for 48 hours on a rotary shaker (150 rpm) at 28 ºC. Cells were harvested

by centrifugation at 3000 rpm for 10 min.

3.10.2 Extraction of emulsifier

Emulsifier was extracted from the cells of S. cerevisiae strains by the method of

Cameron et al. (1988). Yeast cells were suspended in 100 mL of 0.1 M potassium citrate

and 0.02 M potassium metabisulphite buffer (pH 7.0) and autoclaved (121ºC) for 3 hours.

The resulting suspensions were centrifuged at 5000 X g for 10 min at 4 ºC. The

supernatant was retained for the assay of emulsification activity

58

58

3.10.3 Measurement of emulsification activity

Emulsification activity was measured using the method described by Cooper and

Goldenberg (1986). Kerosene (6 mL) was added to 4 mL of the bio-emulsifier and

vortexed at high speed for 2 min. A vernier caliper was used to take measurements after

24 hours. The emulsification index (E24) was obtained by dividing the height of emulsion

layer by the total height and multiplied by 100.

3.11 Statistical analysis of data

All the experiments were performed in triplicates and results were statistically

analyzed by one-way and two-way ANOVA and are presented as mean values with the

standard error calculated at 95 % confidence level.