3. ISOLATION AND IDENTIFICATION OF CHITINASE...

3. ISOLATION AND

IDENTIFICATION OF

CHITINASE PRODUCING

ORGANISMS

Chapter 3: Isolation and Identification of chitinase producing organisms

School of Science, SVKM’S NMIMS (Deemed-to-be) University Page 49

3.1. INTRODUCTION

Major contributions of microbes have been in the development of biotechnology and

genetics. Microbes present many advantageous features of short life cycle, simple

organization and ease of growing and manipulating them in laboratory conditions.

These features are exploited by the industries in attempts to develop commercially

valuable products, which will help human society at large. Soil presents a habitat for a

major repository of micro-organisms which are responsible for producing a variety of

value added products. Thus, screening of soil samples and isolation of organisms form

the first stage in attempts to obtain microbes which produce products of commercial

value.

Microbial ecology necessitates studying, measure, and evaluating the variety of

microbes present in the community, effect of the microbes in that environment and

parameters of the habitat. These studies include - enumeration of organisms present,

study of the morphological characters of organisms and their interaction with the

environment, culturing and identifying the nature of the organisms present and their

diversity, evaluating the metabolic pathways employed by the community of the

organisms, and identifying the metabolic product and their effects on the environment

(Atlas & Bartha 1997; Barton & Northup 2011).

Amongst the diverse varieties of microflora found in the soil, bacteria are the most

abundant. Each of these bacteria requires unique nutritional requirements in order to

flourish. Traditional methods to isolate and monitor micro-organisms include total

viable count (TVC) which allows only a small fraction of microbial community to be

detected. The isolation and identification procedures are often tedious, mainly because

it is extremely difficult to stimulate the natural conditions in the laboratory. The

enrichment culture technique can prove to be beneficial as it is useful for isolation of

a specific type of micro-organism from an environment that is replete with different

types of microbes. This technique allows the proliferation of the desired organisms

which may be present in the environmental source in very small numbers.

Subsequently, the desired organisms can be isolated and characterized later

(Cappuccino 1999).

Chapter 3: Isolation and identification of chitinase producing organisms


The enrichment medium can be designed to contain specific substrate which will

preferentially promote the growth of desired population of micro-organisms. An ideal

enrichment process commences with inoculation of the environmental source (usually

soil) into the enrichment medium. After the growth of the organisms is observed in

the initial inoculated medium, the primary culture is serially transferred into a fresh

enrichment broth of the same composition until the population of the desired

organism is predominant in the culture (Cappuccino 1999). Along with the

enrichment process, a selective procedure can be employed in order to isolate the

dominant organisms of interest by spreading a small amount of enriched medium onto

solidified medium. The use of solidified media demonstrates the importance of a

selective force in the process of isolation as a preliminary tool in order to obtain the

isolate of interest (P. F. Stanbury et al. 1995)

The enrichment technique ensures the selection of desired population of organisms

because once the desired population flourishes, these organisms adapt to the medium

components and achieve exponential growth at a much faster rate. This population

adapts the ability to utilize the incorporated substrate, whereas the competitors lack

the ability to enzymatically use the substrate in the medium. This technique has a

range of applications in the field of clinical, industrial and environmental

microbiology. It is commonly employed to isolate and identify specific soil micro-

organisms for production of value added products (Bisen et al. 2012b).

Correct identification of the organism is the most important task before a

microbiologist and the most practical way to identify the organisms includes

classifying the bacteria based on morphological and biochemical characteristics.

Bergey’s Manual of Systematic Bacteriology, first presented the identification scheme

which included the classification of bacteria primarily on five characteristics: energy

and carbon source, mode of locomotion, morphology and Gram stain reaction,

gaseous requirements and the ability to produce endospores. Before opting for

identification, it is essential to ensure that the starting material is a pure culture. A

“pure culture” is the one that contains all of the daughter colonies to be like the

parent.



The first step to the identification scheme includes studies on the phenotypic

characteristics of the organism, of which Gram staining, colony morphology and cell

motility are important. Gram stain forms a basis for “phenotypic identification” of the

organism. Biochemical tests are important for identification of the organisms up to

genus and species level. These include the determination of the ability of the organism

to utilize certain nutrients, products of metabolism, response to chemicals and the

ability to produce a particular enzyme. The traditional bacterial identification

methods, however, suffer from drawback like they can be used only for identification

of organisms which are cultivated in vitro.

Recently, the use of molecular techniques has proven to be beneficial for

identification of organisms. These techniques help to overcome the limitations of the

biochemical tests and are widely used to confirm the identity of the organism.

16SrRNA sequence forms a basis of many molecular techniques, the sequence can be

analysed followed by comparison to databases providing up to 100,000 sequences.

These techniques are particularly useful for strain identification (Bisen et al. 2012a).

Identification of bacteria by studying its homology with 16SrRNA gene sequence to

that of the known and recorded bacterial strains in the databases, has become a routine

part of phenotypic characterization and replaced many culture-based techniques

(Clarridge 2004). Ribosomal RNA (rRNA) genes possess highly conserved regions

that are suitable as sites for Polymerase Chain Reaction (PCR) primers that recognise

large, diverse groups of organisms and possess variable regions that provide distinct

signatures for identification at the phylogenetic levels (Persing et al. 2004).

Previously, a number of strains have been determined by determination of its

16SrRNA gene sequences. The largest databank of nucleotide sequences GenBank

comprises over 20 million deposited sequences, of which over 90,000

are of

16SrRNA gene. This allows the job of comparative analysis of sequence of an

unknown strain to that with previously deposited sequences (Clarridge 2004).


School of Science, SVKM’S NMIMS (Deemed-to-be) University 2

In order to derive the sequence for a non-cultured bacterium, the basic method

involves using universal primers against the 16SrRNA gene region in PCR so as to

increase the amount of DNA and then to sequence the amplicon (Clarridge 2004).

In the present study, the soil samples were collected from varied environments

followed by an enrichment strategy which enabled isolation of chitinolytic organisms.

The screening procedure was followed in order to select true chitin degraders which

were first identified biochemically. The biochemical tests allowed the identification of

the organism up to the genus level. The identity of each of the selected isolates was

confirmed by carrying out 16SrRNA sequencing. This involved extraction of genomic

DNA (gDNA) followed by amplification by PCR using universal bacterial primers

(Vickerman et al. 2007). The PCR product was analysed using Agarose Gel

Electrophoresis (AGE). Gene sequencing was carried out after analysing the PCR

product.

This chapter discusses:

Collection and enrichment of soil samples from different sites

Isolation of chitinolytic organism from the enriched soil samples

Identification of chitinolytic organisms using biochemical and 16SrRNA

techniques



3.2. THEORETICAL

The first step to 16SrRNA gene sequencing was to isolate and extract genomic DNA

from each isolate. Genomic DNA is the entire hereditary material present in the

nucleus. The extraction of DNA involves isolation of DNA from other cellular

components, such as proteins, lipids and RNA. Genomic DNA can be isolated from a

variety of starting materials like tissue sample, blood, cultured cells, fixed tissues,

yeasts, bacteria, etc. For the present study genomic DNA was extracted from the

bacterial cells.

Extraction of DNA:

The process of isolation of genomic DNA usually involves disruption and lysis of the

cells, which is followed by removal of proteins and other contaminants and finally

recovering the DNA. Proteinase K is usually employed in order to remove proteins

from the sample, followed by salting-out and organic extraction.

Organic extraction of DNA was used to isolate genomic DNA from each selected

isolate in the present study. It is the conventional technique which has been in use

since many years and it is used for situations when either Restriction fragment length

polymorphism (RFLP) or PCR typing is performed. Organic extraction of DNA

involves sequential addition of some chemicals. Initially, addition of sodium

dodecylsulfate (SDS) and Proteinase K facilitate to lyse open the cell walls and

degrade the proteins that protect the DNA molecules bound to the chromosomes. Next

step involves the addition of phenol/chloroform mixture in order to separate the DNA

from proteins. Following the addition of phenol/chloroform mixture, the DNA

solubilizes in the aqueous phase of the organic-aqueous mixture. The mixture is

centrifuged to separate away the unwanted proteins and cellular debris, leaving the

double stranded DNA in the aqueous phase. The aqueous phase is then transferred

into a fresh Eppendorf for analysis. This technique is particularly useful for recovery

of high molecular weight DNA (Butler 2005).



Polymerase Chain Reaction (PCR):

History

The field of molecular biology has greatly benefited with the technique of polymerase

chain reaction or PCR. The ability of PCR to make millions of copies of DNA with a

specific sequence has revolutionized the field of molecular biology (Butler 2005).

In 1971, Khorana and his colleagues described a method for duplicating a region of

duplex DNA using two DNA synthesis primers, in vitro (Kleppe et al. 1971).

However, this concept failed to receive attention for another 12 years. “Sometimes a

good idea comes to you when you are not looking for it.” With these words Kary

Mullis, started an account in Scientific American about how he had a revelation that

led him to develop PCR in 1983 (McPherson & Moller 2006a). He was awarded

Nobel Prize in Chemistry in 1993, less than 10 years after the technique was

described.

PCR technique

PCR involves copying the DNA in the test tube and it uses basic fundamentals of the

natural DNA replication processes. In simple terms, the duplex DNA strands are

unwound following which each strand of parent molecule is used as a template to

produce a complementary ‘daughter’ strand. In a simple buffer system, target region

of the DNA molecule is amplified by DNA polymerase that uses deoxynucleotides

that act as building blocks of new strands, sequence specific primers that bind to the

target region of DNA (McPherson & Moller 2006b).

The process involves the separation of the template strands by heat, which causes the

hydrogen bonds between the base pairs of DNA strands to break; this step is known as

denaturation. The oligonucleotide primers, then find their complementary sequences

on the templates and DNA polymerase then begins to add deoxynucleotides to the 3’-

OH group of the primers, producing new duplex molecules (McPherson & Moller

2006b).



At the next heating step, these new double stranded molecules are once again

denatured and each single strand provides for a site for the primer binding and act as a

template for further DNA synthesis. Thus, there is an exponential increase in the

number of the copies of the ‘target’ DNA sequence where the number of strands of

the target sequence will be doubled at each PCR cycle. There is 100 % efficiency and

the reaction is very specific and precise (McPherson & Moller 2006b).

Figure 3.1: DNA amplification process with the Polymerase Chain

Reaction(Butler 2005)



Agarose Gel Electrophoresis:

Electrophoresis is a technique used to separate and sometimes purify macromolecules

– especially nucleic acids and proteins – that differ in size, charge and conformation.

It is a method of separating macromolecules based on the rate of movement while

under the influence of an electric field (Sambrook, Maniatis, et al. 1989).

Principle

In gel electrophoresis, charged molecules when placed in an electric field, they

migrate towards either positive or negative pole according to their charge. In contrast

to proteins, which have either net positive or either net negative charge, nucleic acids,

i.e. DNA and RNA, have a consistent negative charge imparted by their phosphate

backbone, and thus migrate towards the anode. Moreover, molecules which have

similar charge will have a different charge to mass ratio due to inherent differences in

molecular weight. These differences in combined, form a sufficient basis for a

differential migration when ions in the solution are subjected to an electric field. Thus

electrophoresis allow separation of charged molecules in the sample (Sambrook,

Maniatis, et al. 1989).

The macromolecules like proteins and nucleic acids are electrophoresed in a matrix or

gel support. The gel is itself a porous matrix, or meshwork, often made up of

carbohydrate chains. Commonly, the gel is cast in a shape of a thin slab, with wells

for loading the sample. The gel is immersed within an electrophoresis buffer that

provides ions to carry a current along with some type of buffer to maintain the pH at

relatively constant value.

Agarose Gel

The gel matrix is composed of agarose or polyacrylamide, each of which has

attributes suitable for a particular task. Agarose is a fraction extracted from agar

producing seaweeds. It comprises of alternating units of galactose and 3, 6-anhydro-

L-galactose. The chemical structure gives agarose the capacity to form gels that are

resistant even at very low concentrations.



It is typically used in the concentration of 0.5 % to 2 % for separation of both nucleic

acids and proteins. Agarose is a neutral and toxic-free material so it can be handled

freely. Agarose gels are extremely easy to prepare: simply mixing the agarose powder

with a buffer solution, dissolve it by heating; gel formation occurs between 40-41 oC.

The gelling properties are attributed to inter and intramolecular hydrogen bonding

between long agarose chain. This cross linked structure gives the gel uniform pore

size. Lower concentration of agarose, larger the pore size and vice versa (Sambrook,


Agarose gels have a large range of separation, but relatively low resolving power. It is

favoured since it remains quite stable at applied current, has a low melting point and

also since it is non-toxic. Fragments of DNA from about 200 to 50,000 bps can be

separated by varying the concentration of agarose, using standard electrophoretic

techniques (Sambrook, Maniatis, et al. 1989).

Basic setup

The electrophoresis equipment and power supplies necessary for conducting agarose

gel electrophoresis are relatively simple and consists of:

An electrophoresis chamber and power supply.

UV- transparent gel casting plastic tray, which are available in a variety of sizes.

Sample comb, to prepare wells in the gel for loading samples.

Electrophoresis buffer, usually Tris – acetate – EDTA (TAE) or Tris – borate –

EDTA (TBE) at a concentration of approximately 0.05 M, over a pH range of 7.5

to 8.0. Buffers not only establish a pH, but provide ions to support conductivity.

EDTA is invariably incorporated in these buffers to suppress the activity of

DNases.

Loading buffer, that contains glycerol, which is dense, allowing the sample to

‘fall’ into the wells, and a tracking dye such as Bromophenol blue, which adds

color to the sample, thereby simplifying the loading process and the dye migrates

through the gel almost at the same rate as the nucleic acids thereby allowing

visual monitoring of the electrophoresis process.



Ethidium bromide, a fluorescent dye used for staining nucleic acids. It

intercalates between bases of DNA and RNA.

Transilluminator (an ultraviolet light box), is used to visualize ethidium bromide

stained DNA gels (Sambrook, Maniatis, et al. 1989).

Migration of DNA fragments in agarose gel

Fragments of linear DNA migrate through agarose gels with a mobility that is

inversely proportional to the log10 of their molecular weight, i.e., if you plot the

distance from the wall that DNA fragments have migrated against the log 10 of either

their molecular weights or number of base pairs, a roughly straight line will be

formed. Circular forms of DNA migrate in agarose distinctly differently from linear

DNAs of the same mass (Sambrook, Maniatis, et al. 1989).

Agarose concentration

By using gels with different concentrations of agarose, one can resolve different sizes

of DNA fragments. Higher concentrations of agarose facilitate separation of small

DNA’s, while low agarose concentrations allow resolution of larger DNA’s

(Sambrook, Maniatis, et al. 1989).

Voltage

As the voltage applied to a gel is increased, larger fragments migrate proportionally

faster than small fragments. If the separation of the electrodes is ‘d’ metres and the

potential difference between them is ‘V’ volts, the potential gradient is V/d

volts/meter. The force of an ion bearing a charge ‘q’ coulombs ‘Vq/d’ newtons. The

rate of migration under unit potential gradient is called mobility of the ion. Thus, an

increase in the potential gradient will increase the rate of migration proportionally.

For that reason, the best resolution of fragments larger than about 2 kb is attained by

applying no more than 5 volts per cm to the gel (Sambrook, Maniatis, et al. 1989).

Electrophoresis buffer

Several buffers have been recommended for electrophoresis of DNA. The most

commonly used for duplex DNA are TAE and TBE. DNA fragments migrate at

different rates in these two buffers due to differences in ionic strength. As the ionic



strength of the buffer increases, the proportion of current carried by the buffer will

increase and the share of the current carried by the sample will decrease, thus slowing

its rate of migration. In low ionic strength, the proportion of current carried by the

buffer will decrease and share of current carried by the sample will increase, thus

increasing its rate of migration. The ionic strength is generally selected within a range

of 0.05M to 0.1M (Sambrook, Maniatis, et al. 1989).

Effects of ethidium bromide

Ethidium bromide is a fluorescent dye that intercalates between bases of nucleic acids

and allows very convenient detection of DNA fragments in gels. Binding of ethidium

bromide to DNA alters its mass and rigidity and therefore its mobility (Sambrook,




3.3. MATERIALS AND METHODS

3.3.1. Soil collection and site information

Four soil samples were collected for the purpose of isolating suitable chitinase

producing organisms using enrichment technique. The soil samples were collected in

a sterile plastic container and labelled accordingly. The four sites from which the soil

samples were collected are as follows:

Beach sand (Malad)

Beach sand was collected during the low tide, in the area where the chitinous rich

waste material was observed. Soil from the depth of 4-5 cms was collected. The

uppermost layer of the soil was collected where maximum microbial activity is

observed.

Tide condition: Low tide

Date of sample collection: 17/11/09

Garden soil (Kandivli)

Garden soil was collected from the disposal compost site where the local wastes from

fruits, vegetables and seafood wastes like prawn heads had been buried in the trench.

Soil from the depth of 10-12 cms was collected.


Dumping ground soil (Malad)

The sample from a waste disposal site was collected from the depth of 5-6 cms.

Date of sample collection: 10 /12/09

Fish market soil (Kandivli)

Local fish market soil was collected from 5-6 cm depth where the seafood wastes

were disposed. This soil was very rich with chitinous material and hence it was

assumed that this source will pose as a rich source for chitinolytic organisms.




Culture media and chemicals

Throughout the study, the chemicals used were of analytical grade purchased from

Qualigens Fine Chemicals, Mumbai, India. Ready-made dehydrated media were

procured from Hi Media Laboratories Pvt Ltd, Mumbai.

In the present investigation, culture media were prepared according to manufacturer’s

instructions. Compositions of the media are listed wherever required. Weighed

quantity of dehydrated medium was suspended in a measured quantity of distilled

water (D/W) and mixed well. In case of solid media, the medium was heated in the

microwave to dissolve the dehydrated powder completely. The media was sterilized

by autoclaving at 121 oC under the pressure of 15 psi for 20 min. Sterilized medium

was allowed to cool and stored at 4 oC until use. All media, thus prepared were used

within seven days.

3.3.2. Isolation and enrichment of chitinolytic organism from the soil samples

Soil samples collected from the earlier mentioned sites were processed in order to

assess the initial microbial load as well as to study the type of microflora in each of

the soil samples.

Media and solution used:

Nutrient Agar (NA)

Saline

Compositions:

Nutrient Agar

Table 3.1: Composition of Nutrient Agar

Composition (28 gms /1000ml) Quantity (gms/litre)

Peptone 5

Beef extract 3

Sodium chloride 8

Agar 15



Saline

Table 3.2: Composition of Saline

Method:

In order to enumerate and study the initial microflora of each of the soil samples, 1 g

of soil sample was diluted using 10 ml of sterile saline. This mixture was vortexed so

as to facilitate proper mixing of the solution as well as separation of soil particles. The

mixture was left undisturbed for 20 minutes, allowing the soil particles to settle down

completely. 500 µL of the supernatant was serially diluted in 4.5 ml sterile saline.

Dilutions up to 10-10

were prepared and viable count was performed by a spread plate

technique on NA plates.

Enrichment strategy of soil samples

Three successive enrichments for each soil sample were carried out in order to narrow

down on those isolates which possess the chitin degrading ability.

Media used:

Minimal Salts Media (MSM) containing 1 % chitin powder

Table 3.3: Composition of MSM containing 1 % chitin powder

Composition Quantity (gms/litre)

Potassium dihydrogen phosphate 7

Di potassium hydrogen phosphate 3

Magnesium sulphate 5

Ammonium sulphate 0.2

Chitin powder 1

Ferrous sulphate 0.001

Zinc sulphate 0.001

Final pH (at 25 oC) 7.0 ± 0.2

Composition Quantity (gms/litre)

Sodium chloride 8.5

D/W 1000ml



Method:

Each soil sample was subjected to the process of enrichment, which allowed the

proliferation of desired organisms by creating unfavourable conditions for growth of

undesired organisms.

For enrichment of each of the soil samples, sterile Minimal Salts Media (MSM)

containing 1 % chitin powder was used as an enrichment medium. The enrichment

process was initiated by adding 5 g of soil sample to enrichment medium. The

incubation of flask was carried out at 27 ± 2 oC (room temperature), on a shaker at

150 rpm. The process of enrichment was carried out at room temperature since the

soil microbes had been acclimatized to this range of temperature in the natural

environment.

The process of enrichment was carried out in three stages for each of the soil samples

collected. Each enrichment stage lasted for a period of 25 to 30 days.

First enrichment as mentioned earlier, comprises of MSM containing 1 % chitin

powder inoculated with 5 g of respective soil sample. This system was incubated for a

period of 25 to 30 days at room temperature under shaker conditions (150 rpm).

Second enrichment process was carried out for respective soil samples; 11 ml of

inoculum from the first enrichment flask was aliquoted and transferred aseptically

into 100 ml of fresh sterile MSM containing 1 % chitin powder. Similarly, this system

was incubated for a period of 25 to 30 days at room temperature under shaker

conditions (150 rpm).

Further, similar third enrichment process was carried out which was the last step of

the enrichment stage for each soil sample, wherein, 11 ml of inoculum from the

second enrichment flask was aliquoted and transferred aseptically into 100 ml of fresh

sterile MSM containing 1 % chitin powder and was incubated for a period of 25 to 30

days at room temperature under shaker conditions (150 rpm).



During each of the enrichment stage, viable count was performed at regular intervals

in order to access the enriched microflora and each colony was studied

macroscopically in terms of colony characteristics and subjected to preliminary

screening. Viable counts were performed using the spread plate technique on 2 %

Nutrient agar. The plates were incubated at room temperature for a period of 24 - 48

hours, after which bacterial counts were obtained.

Figure 3.2: General scheme for enrichment process

3.3.3. Preliminary screening of chitinolytic organisms

Preliminary screening abetted the selection of isolates for further study. Screening

technique of the enriched colonies involved selection of isolates which possessed the

ability to produce chitinase which resulted in degradation of the substrate chitin.

Colloidal Chitin Agar (CCA) was employed to select the isolates which were able to

utilize chitin as a sole source of carbon and energy. The isolates which possessed the

ability to degrade chitin produced a distinct zone of clearance around it. These

colonies were sub-cultured onto sterile NA slants and maintained for further studies.



Media used:

Colloidal Chitin Agar

Table 3.4: Composition of Colloidal Chitin Agar

Preparation of Colloidal chitin

Colloidal chitin is the most preferred substrate for investigation of chitinase activity.

Chitin is used in a colloidal form as a water insoluble substrate for chitinase. Colloidal

chitin was prepared by the modified method of Robert and Selitrennikoff (Roberts &

Selitrennikoff 1988): To 5 g of powdered chitin, 50 ml of concentrated HCl was

added slowly. The mixture was left standing for 6 h. The mixture then was added to

250 ml of ice-cold ethanol with continuous stirring. The pH of the solution was

adjusted to 7 and the precipitate was collected by centrifugation at 8000 rpm for 30

min at 4 oC. The colloidal chitin collected was dried at room temperature and later

stored at 4 oC for further use.

Preparation of Colloidal Chitin Agar

All the components of the media were weighed and added to MSM. This media was

mixed thoroughly and heated in the microwave to dissolve the components. The

media was sterilized by autoclaving at 121 oC under the pressure of 15 psi for 20 min.

Sterilized medium was allowed to cool and then poured into sterile Petri plates. The

plates were left to solidify.

Composition Quantity (per 100ml)

Colloidal Chitin 1 g

Yeast Extract 0.001 g

Agar 1.5 g

Minimal Salts Media 100 ml

Final pH (at 25 oC) 7.0 ± 0.2



Method:

The colonies obtained from regular viable counts were subjected to preliminary

screening on sterile CCA plates. Colonies with distinguishable colony characteristics

were spot inoculated onto sterile CCA plates and incubated for 4-5 days at room

temperature. Isolates were selected on the basis of clearance zone: colony size

(CZ/CS) ratio on CCA plates (Cody 1989). Isolates showing high CZ/CS ratio were

regarded as chitinase producing and they were maintained on slants of NA.

3.3.4. Secondary screening of chitinolytic isolates

The selected colonies were confirmed for their ability to degrade chitin. This was

done by sub-culturing the colonies on a Nutrient agar medium followed by spot

inoculating the culture on CCA. The colonies which retained the ability to degrade

chitin were able to produce a zone of clearance on CCA plates. These colonies were

taken as true chitin degraders and selected for further studies.

3.3.5. Identification of the isolates capable of producing chitinase

The isolates obtained from various soil samples, which showed the ability to produce

chitinase were identified by conventional identification tests. These tests include

standard morphological and biochemical tests which helped in identification of the

isolates up to the genus level of identification.

3.3.5.1. Morphological characterization

Gram’s character: Gram staining of each isolates was performed as described in

Textbook of Medical Laboratory Technology (Godkar & Godkar 2007) and the Gram

nature of each of the isolates were recorded.

Colony morphology: Colony characteristics of overnight grown cultures of each

isolate on Nutrient agar was observed and recorded.

Cell morphology: The Gram stained smears of the isolates were observed

microscopically under the magnification of 1000 X using an oil immersion lens to

determine the morphological characteristics of the cells.



Test for motility: The test for motility was performed as described in Textbook of

Medical Microbiology (Collee et al. 1996) and method used to detect motility was

“hanging drop technique”.

Presence of endospores: The bacterial isolates were checked for the presence of

endospores by performing the staining procedure for endospore staining as described

in Experiments in Microbiology, Plant Pathology and Biotechnology (Aneja 2003)

Lactose fermentation Test:

This test uses MacConkey Agar. This is a differential and low selectivity medium

used to distinguish lactose fermenting from non-lactose fermenting bacteria.

Media used:

MacConkey Agar

Table 3.5: Composition of MacConkey Agar

Composition (51.53 gms/1000ml) Quantity (gms/litre)

Peptic digest of animal tissue 17.00

Proteose peptone 3.00

Lactose 10.00

Bile salts 1.5

Sodium Chloride 5.00

Neutral red 0.03

Agar 15.00

Final pH (at 25 °C) 7.1 ± 0.2

Method: Plates were inoculated with test organism, incubated at 37 °C for 48 h.

Interpretation: Pale colonies indicate non-lactose fermenting bacteria, whereas

bright pink opaque colonies indicate lactose fermenting bacteria.



3.3.5.2. Biochemical characterization

Bacteria differ widely in their ability to metabolize carbohydrates and other

compounds. For the purpose of identification, these differences can be demonstrated

by four different tests which are described below (Collee et al. 1996).

Tests to check the carbohydrate utilization oxidatively and fermentatively.

Tests for specific breakdown products.

Tests for the ability of bacteria to utilize certain proteins and amino acids.

Tests to study the various enzymes produced by isolated bacteria.

All the tests were performed as per standard techniques given in Mackie and

McCartney’s Practical Medical Microbiology (Collee et al. 1996).

Inoculum preparation

The isolates were streaked onto Nutrient agar plates and 18- hours-old culture of each

isolate was obtained. These cultures were prepared according to the 0.5 Mac

Farland’s turbidity standard (107- 10

8 organisms/ml). These suspensions of the

isolates were kept constant and were used for inoculation throughout all biochemical

tests (Brown & Poxton 1996).

Incubation temperature and time

All the inoculated tubes, plates and slants were incubated at 37 °C for 24-48 h unless

and otherwise mentioned.

Requirements, preparations and methods for biochemical identification of the

isolates

I. Fermentation of carbohydrates and related compounds

The purpose of this test is to detect the production of acid and gas or acid alone when

a pure culture is grown in the presence of a test compound.

Sugars used in this test:

Hexose: Glucose

Monosaccharide: Xylose

Dissacharides: Sucrose, Lactose, Maltose



Polyhydric Alcohol: Mannitol

Indicator used: Andrade’s indicator

Medium used: 1.5 % Peptone water

Preparation of media

1.5 % peptone water was prepared and Andrade’s indicator was added to it so as to

achieve a resultant concentration of indicator in the medium as 1 %. The medium was

dispensed into tubes. An inverted Durham tube was introduced into each tube to

detect gas production. During preparation and sterilization, it is to be ensured that the

inverted Durham tube is devoid of any air bubbles.

10 % solutions of the above mentioned sugars were prepared in distilled water and

autoclaved at 10 psi for 10 min. The sterile sugar solution was added to the individual

tubes of peptone water under sterile conditions so as to obtain the resultant

concentration of 1 % sugar in each tube.

Method: The sugar fermentation media were inoculated with the test organisms. 6

tubes corresponding to each sugar were inoculated for each isolate and incubated at

37 °C for 24 h.

Interpretation: Turbidity in the tubes indicated growth. Andrade’s indicator will

change color as a result of the formation of acids during the fermentation, resulting in

the development of a pink color in the medium while the appearance of air bubble

within the inverted Durham tube indicated the production of gas during fermentation

of sugars.

II. Test for checking the oxidative/ fermentative utilization of carbohydrate

This method depends upon the use of a semi-solid medium containing carbohydrates

together with pH indicator placed in a tube. If acid is produced only at the surface of

the medium, where the conditions are aerobic, the attack on the sugar is considered to

be oxidative. If acid is found throughout the tube, including the lower layers where

conditions are anaerobic, the breakdown of sugar is considered to be fermentative.



Media used:

Oxidative fermentative medium (Hugh and Leifson medium)

Table 3.6: Composition of Oxidative fermentative medium

Components Quantity (gms/liter)

Peptone 2

NaCl 2

K2HPO4 0.3

1% Bromothymol blue

(1% aqueous solution)

3ml

Agar 3

Sugar used: Glucose

Preparation of media:

The pH adjusted to 7.1 before adding bromothymol blue and medium is autoclaved at

121 °C for 15 min. The sugar to be added was sterilized separately. 10 % stock of

sugar was prepared and sterilized separately at 10 psi for 10 minutes, and added to the

medium to give a final concentration of 1 %.

Method: Test organisms were stab inoculated in butt with straight nichrome wire

loop, incubated at 37 °C for 24-48 h.

Interpretation:

1) Yellow coloration only at the surface of butt indicates the oxidative utilization of

carbohydrates.

2) Yellow coloration of whole butt indicates the fermentative utilization of

carbohydrates.



III. Tests for specific breakdown products

a) Methyl Red Test (MR test):

This test was employed to detect the production of sufficient acid during the

fermentation of glucose.

Media used:

MR-VP medium (Buffered glucose broth)

Table 3.7: Composition of MR-VP medium

Composition: (17.0 gms /1000 ml) Quantity (gms/liter)

Buffered peptone 7

Dipotassium phosphate 5

Dextrose 5

Final pH (at 25 oC) 6.9 ± 0.2

Indicator used:

Methyl red indicator solution

Table 3.8: Composition of Methyl Red indicator

Composition Quantity

Methyl red 0.1g

Ethanol 300 ml

Distilled water 200 ml

Method: Glucose phosphate broth was inoculated with the test organisms and

incubated at 37 oC for 24 h. About 5 drops of Methyl red indicator solution was added

to the broth culture, mixed well and was observed for the development of bright red

color.

Interpretation: Bright red color indicates positive MR test.



b) Vogus Prouskauer Test (VP or Acetoin production test)

Many bacteria ferment carbohydrates with the production of acetyl methyl carbinol

(CH3.CO.CHOH.CH3) or its reduction product 2,3-butylene glycol (CH3.

CHOH.CHOH.CH3). It can be detected by chemical methods. This test is usually

done in conjunction with the methyl red test since the production of acetyl methyl

carbinol or butylene glycol usually results in insufficient acid accumulation during

fermentation to give a methyl red positive reaction (Collee et al. 1996).

Media used:

Methyl Red – Voges Proskauer (MR-VP) medium

Composition of MR-VP medium

Refer to Table 3.7

Method: As for the Methyl red test, Glucose phosphate broth were inoculated with

the test organisms and incubated at 37 oC for 24 h. To this broth culture 1 ml of

O’Meara’s reagent (40 % KOH and 3 ml of a 5 % solution of α – naphthol in absolute

ethanol) was added and incubated at 37 oC for 30 min and then observed for

coloration.

Interpretation: A positive reaction is denoted by the development of an eosin pink

color after incubation.

IV. Test for the ability of the bacteria to utilize particular substrate

a) Starch utilization test

This test was performed to test the ability of the isolate to produce amylase. Amylase

enzyme acts on starch and converts it into simple sugars. This could be detected by

iodine solution. In the presence of starch, iodine gives dark blue coloration.

Media used:

Starch agar



Preparation of media: Composition of NA is provided in this chapter in Table 3.1.

To this autoclaved, cooled and molten medium, 10 ml of 10 % starch solution

(autoclaved separately at 10 psi for 10 min) was added and poured to prepare Starch

agar plates.

Method: Plates were inoculated with test organisms and incubated at 37 ° C for 48 h.

After incubation, the plate was flooded with iodine solution.

Interpretation: Presence of amylolytic activity was indicated by clearance around the

colonies against the blue background.

b) Citrate utilization test:

This test was performed to detect the ability of an isolated test organism to utilize

citrate as a sole carbon and energy source for growth and an ammonium salt as the

sole source of nitrogen.

Medium used:

Simmons Citrate Agar

Table 3.9: Composition of Simmons Citrate Agar

Composition (24.28 gms/1000 ml) Quantity (gms/liter)

Magnesium sulphate 0.2

Ammonium dihydrogen phosphate 1

Dipotassium phosphate 1

Sodium citrate 2

Sodium chloride 5

Bromothymol blue 0.08

Agar 15

Final pH (at 25 oC) 6.8 ± 0.2

Method: Simmon’s citrate agar slant was streaked with the test organism and

incubated at 37 °C for 24 h.



Interpretation: Positive = Change in color from green to blue and the streak of

growth.

Negative = Original green color and no growth.

V. Test for metabolism of proteins and amino acids

a) Indole test

This test was employed to demonstrate the ability of certain bacteria to decompose the

amino acid, tryptophan, to indole, which accumulates in the medium. Indole is then

tested for by a colorimetric reaction with p – dimethyl amino benzyldehyde (Kovac’s

reagent).

Media used:

Tryptone Water

Table 3.10: Composition of tryptone water

Composition: (25 gms/1000 ml) Quantity (gms/liter)

Casein enzymic hydrolysate 20

Sodium chloride 5

Final pH (at 25 oC) 7.5 ± 0.2

Indicator used:

Kovac’s reagent

Table 3.11: Composition of Kovac’s reagent

Components Quantity

Amyl or isoamyl alcohol 150 ml

p-Dimethyl amino benzyldehyde 10g

Concentrated hydrochloric acid 50 ml



Method: Sterile Tryptone water was seeded with test organism and incubated at 37

oC for 24 h. At the end of the incubation period 0.5 ml of Kovac’s reagent was added

to the culture and mixed well.

Interpretation: A positive reaction was indicated by formation of a reddish pink ring

on the surface of the inoculated media.

b) Arginine dihydrolase

The purpose is to see if the isolate can utilize the amino acid arginine. The use of

arginine is accomplished by the enzyme arginine dihydrolase. The medium contained

a small amount of glucose, which the organism initially utilizes. This causes the pH to

drop which is indicated by a change in the colour of the medium from purple to

yellow. Once the medium has been acidified, the enzyme arginine dihydrolase is

activated, causing the arginine in the medium to be utilised. Change in the colour of

the medium from yellow back to purple indicates a positive test for arginine

dihydrolase

Medium used:

L-arginine dihydrolase medium

Table 3.12: Composition of L-arginine dihydrolase medium

Components Quantity (gms/liter)

L-arginine monohydrochloride 5

Yeast extract 3

Glucose 1

Bromocresol purple 0.015

Final pH (at 25 oC) 6.8 ± 0.2

Method: Test cultures were inoculated and incubated at 37 °C for 24-72 h. The

medium was observed for color change after 24 h, 48 h and 72 h.



Interpretation: The medium first becomes yellow due to acid production during

glucose fermentation; later if decarboxylation occurs, the medium become violet. The

control should remain yellow.

c) Gelatin liquefaction test

Some of the bacteria have the ability to liquefy gelatin. Gelatin breakdown was

demonstrated by incorporating it in buffered NA, growing the culture on it and

flooding the medium with a reagent that differentially precipitated either gelatin or its

break down products.

Media used:

Gelatin agar

Table 3.13: Composition of Gelatin agar

Components Quantity

Nutrient agar 1 liter

Potassium dihydrogen phosphate 0.5 g

Di potassium hydrogen phosphate 1.5 g

Gelatin 4 g

Glucose 0.05 g

Test reagent: Mercuric chloride solution

Preparation of test reagent: 15 grams of mercuric chloride was added to 20 ml of

concentrated hydrochloric acid. The volume of this mixture was made up 100 ml with

D/W.

Method: The plates were inoculated with test cultures and incubated at 37 °C for 24

h. They were then flooded with mercuric chloride solution.

Interpretation: Clear zone around gelatin liquefying colonies showed positive

confirmation of the test.



VI. Combined Tests

a) Triple Sugar Iron (TSI) Test

This medium was used as a multi-test medium, which detects fermentation reaction,

gas production and ability of an organism to produce H2S.

Media used:

Triple Sugar Iron (TSI) agar

Table 3.14: Composition of Triple Sugar Iron agar

Composition (65 gms/1000 ml) Quantity (gms/liter)

Peptic digest of animal tissue 10

Casein enzymic hydrolysate 10

Beef extract 3

Yeast extract 3

Lactose 10

Sucrose 10

Dextrose 1

Sodium chloride 5

Ferrous sulphate 0.2

Sodium thiosulphate 0.3

Phenol red 0.024

Agar 12

Final pH (at 25 oC) 7.4 ± 0.2

Method: A heavy inoculum was streaked over the surface of the slope and stabbed in

the butt. The medium was incubated at 37 oC for 48 h.

Interpretation: The results were interpreted as the fermentation reactions on the

slope and in the butt by a change in color to yellow due to acid production. The

cracking of the medium and cavities formed indicated gas production. The blackening

of the medium indicated H2S production.



VII. Tests for various enzymes produced by the isolates

The isolates was checked for the production of enzymes like

1. Oxidase

2. Catalase

3. Nitratase

4. Urease

1. Oxidase

This test is used to detect the presence of cytochrome oxidase enzyme present in the

organism, which will catalyze the loss of electrons from a redox dye, tetra methyl p-

phenylene diamine hydrochloride. So, the dye gets oxidized to give deep purple

colour.

Method: Test organisms were inoculated on NA plates and incubated at 37 °C for 24

h. A small filter paper strip soaked in a 1.0-1.5 % solution of tetra methyl p-

phenylene diamine hydrochloride was laid in a Petri plate. The colonies to be tested

were smeared on the paper by using flame sterilized glass slide or rod.

Interpretation: Positive reaction was indicated by deep purple hue, appearing within

5-10 seconds, a delayed positive reaction by coloration in 10-60 seconds and a

negative reaction by absence of coloration or by coloration later than 60 seconds.

2. Catalase

This test demonstrates the presence of catalase, an enzyme that catalyze the release of

oxygen from hydrogen peroxide.

Method: Test organisms were inoculated on NA slant and incubated at 37 °C for 24

h.10 % hydrogen peroxide was added drop wise to cultured slant with substantial

growth and checked for effervescence.

Interpretation: Effervescence within 30 seconds indicates a positive test.



3. Nitratase

This test was carried out to detect the presence of the enzyme, nitrate reductase

(nitratase), which causes the reduction of nitrates to nitrites.

Media used:

Nitrate broth

Table 3.15: Composition of Nitrate broth

Composition (39 gms/1000 ml) Quantity (gms/liter)


Meat extract 0.3

Sodium chloride 30

Potassium nitrate 0.1

Final pH (at 25 oC) 7.0 ± 0.2

Test reagents used: Sulphanilic acid and α – naphthylamine

Composition of test reagents:

1) Sulphanilic acid: 0.8 g of sulphanilic acid dissolved in 100 ml of 5 M of acetic

acid.

2) α – naphthylamine: 0.5 g of α – naphthylamine dissolved in 100 ml of 5 M of

acetic acid.

Method: Nitrate broth was inoculated with the test organisms and incubated at 37oC

for 24-48 h. 2-3 drops of sulphanilic acid and α- naphthylamine was added to nitrate

broth and the color change was observed.

Interpretation: Development of the red colour indicates the presence of nitrite and

thus the ability of an organism to reduce nitrate to nitrite was confirmed.



4. Urease

Bacteria, particularly those growing naturally in an environment with exposure to

urine, may decompose urea by means of the enzyme urease

NH2.CO.NH2 + H2O 2NH3 +CO2

The presence or absence of this enzyme was detected by growing the organism in the

presence of urea. The production of alkali was detected by means of pH indicator

added to the media.

Media used:

Urea agar base

Table 3.16: Composition of Urea agar base

Composition (24 gms/950 ml) Quantity (gms/950 ml)


Dextrose 0.1

Sodium chloride 0.5

Monopotassium phosphate 0.2

Phenol red 0.012

Agar 15

Final pH (at 25 oC) 6.8 ± 0.2

Preparation of media: After sterilization and cooling of Urea agar base

approximately to 50 oC, 50 ml of sterile 40 % urea was added. Mixed well and

dispensed aseptically in 5 ml aliquots in sterilized tubes for the preparation of slants.

Method: The entire slope surface of urea agar slant was heavily inoculated with test

organism and incubated at 37 °C for about 24-48 h.

Interpretation: Urease positive reaction is indicated by the change in color of the

media to purple pink.



3.3.6. Characterization of optimum growth conditions for the isolates

The potential chitinase producing strains selected were further studied so as to

characterize their growth conditions. The parameters which were studied are as

follows:

A. Study of comparative growth of the isolate in different media

B. Study of optimum pH

C. Study of optimum temperature

D. Study of growth response at different salt concentrations.

Preparation of inoculum

Saline suspensions of each of the isolate was prepared from 18 hours old culture as

per the 0.5 McFarland turbidity standard to obtain approximate cell density of 107-8

cells/ml. 10µL of this suspension was used as inoculum. Negative control was

included in each experimental batch. All the flasks, tubes or plates were incubated at

37 oC for 24 hours to 5 days, unless otherwise mentioned.

A. Test for comparative growth study of the isolates in different media

Each isolate was inoculated in three different growth media – Nutrient broth (NB),

Luria Bertani broth (LB) and Soyabean Casein digest broth (SCB). The media, which

resulted in the maximum and dispersed growth of the isolate, was selected for further

characterization experiments.

Media used:

Nutrient broth

Luria Bertani broth

Soyabean Casein digest broth



Compositions:

Nutrient broth

Table 3.17: Composition of Nutrient broth

Composition (13 gms/1000 ml) Quantity (gms/litre)


Sodium chloride 5.00

Beef extract 1.50

Yeast extract 1.50

Final pH (at 25 °C) 7.2 ± 0.2

Luria Bertani broth

Table 3.18: Composition of Luria Bertani broth


Casein enzymic hydrolysate 10.00

Yeast extract 5.00


Final pH (at 25 °C) 7.5 ± 0.2

Soyabean Casein digest broth

Table 3.19: Composition of Soyabean Casein digest broth


Pancreatic digest of casein 17.00

Peptic digest of soyabean meal 3.00


Dextrose 2.50

Dibasic potassium phosphate 2.50

Final pH (at 25 °C) 7.3 ± 0.2



B. Test for study of optimum pH

To determine the optimum pH, 20 ml of SC broth was dispensed into assay tubes and

sterilized by autoclaving at 121 oC 15 lb psi for 20 min. The pH range was selected

from 4.0 to 10.0 (4.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0). Test isolates were inoculated

and incubated at 37 oC. The tubes were assessed visually for microbial growth in

terms of turbidity for 48 h.

C. Test for study of optimum temperature

To determine the optimum temperature, 20 ml of SC broth was dispensed into assay

tubes and sterilized by autoclaving at 121 oC 15 psi for 20 min. The temperatures

selected were as follows: 4 oC, 25

oC, 37

oC, 40

oC and 50

oC. Test isolates were

inoculated and incubated at respective temperatures. The tubes were assessed visually

for microbial growth in terms of turbidity for 48 h.

D. Study of growth response to different conditions:

a) Study of growth response to anaerobic conditions

This test uses anaerobic agar. This media is specifically used for cultivation and

selectively growing anaerobic bacteria like Clostridium and other anaerobic

organisms (Collee et al. 1996).

Media used:

Anaerobic agar

Table 3.20: Composition of Anaerobic agar


Casein enzymic hydrolysate 20.00

Dextrose 10.00


Sodium thioglycollate 2.00

Sodium formaldehyde Sulphoxylate 1.00

Methylene blue 0.002

Agar 20.00

Final pH (at 25 °C) 7.2 ± 0.2



Method: Plates were inoculated with test organism, incubated at 37 °C for 96 h, in

anaerobic conditions. These conditions were obtained with the help of an anaerobic

gas pack jar.

Interpretation: Growth on the plates shows the presence of facultative anaerobic

bacteria. Absence of any growth on the plates after incubation shows the presence of

strict aerobic bacteria. After the incubation is completed, the media plates are seen to

turn pale yellow.

b) Study of growth at different NaCl concentrations

To study the effect of different concentrations of NaCl, SC broth with a range of NaCl

concentration (0.5 %, 2 %, 5 %, 7 %, 9 %, 10 % and 12 %) was prepared. Test

organisms were inoculated and incubated at 37 oC. The tubes were examined for

growth for 48 h.

3.3.7. Antibiotic Sensitivity Test (AST)

The test was performed to check the sensitivity of the isolates against various

antibiotics. The test was carried out on sterile Mueller Hinton (MH) agar medium

using antibiotic discs from Hi Media. MH agar is employed in determination of

antimicrobial susceptibility testing. It is selected by Clinical and Laboratory Standards

Institute (CLSI) for various reasons:

It reveals good batch-to-batch reproducibility for susceptibility testing.

It is low in sulphonamide, trimethoprim and tetracycline inhibitors.

It supports the growth of most non-fastidious bacterial pathogens.

Many data and much experience regarding its performance have been recorded

(Murray et al. 2003).



Media used:

Mueller Hinton (MH) agar

Table 3.21: Composition of MH agar


Beef, infusion form 300.00

Casein acid hydrolysate 17.500

Starch 1.500

Agar 17.000

Final pH (at 25 °C) 7.3 ± 0.1

Method:

0.5 ml of test organisms were surface spread on sterile MH agar plates. The antibiotic

disc was placed aseptically with the help of forceps which was flame sterilized every

time before placing each antibiotic disc. Plates were incubated at 37 oC for 24 h and

observed for the zone of inhibition.

Interpretation:

The results were compared with the chart provided by the Clinical and Laboratories

Standards Institute (CLSI 2012).

3.3.8. Preparation of glycerol stocks

Glycerol stocks of the selected chitinase producers were prepared to ensure their

viability during longer period of storage.

A single colony of interest was picked and grown overnight in Nutrient broth. After

incubation, the purity of the culture was ensured by Gram staining. Glycerol stocks

with 15 % glycerol content were prepared as prescribed by Sambrook, Fritsch, et al.

(1989) with slight modification where in 87 % glycerol was used instead of 100 %

glycerol. 0.17 ml of 87 % glycerol was added to a sterile 1.5 ml Eppendorf tube

followed by 0.83 ml of overnight culture. The tube was vortex mixed and labelled

with all pertinent information. The glycerol stocks were stored at -80 ºC until further

use.



3.3.9. Extraction of DNA from bacterial cells

Genomic DNA was extracted from each selected chitinolytic isolates using the

procedure as described in Short Protocols in Molecular Biology (Wilson 1995).

Requirements:

Sample: Overnight culture of bacterial cells

Media: St NB (refer Table 3.16)

Reagents: Tris EDTA (TE) Buffer

10 % Sodium Dodecyl Sulphate (SDS)

Proteinase K – 10 mg/ml

5 M NaCl

CTAB/NaCl solution

24: 1 Chloroform/isoamyl alcohol

25: 24:1 Phenol/chloroform/isoamyl alcohol

Isopropanol

70 % ethanol

Compositions:

TE Buffer

1 ml of 1 M Tris-HCl (pH 8) + 0.2 ml EDTA (0.5M). The volume was made up to

100 ml with D/W.

1 M Tris (Molecular weight – 121.14 g)

First 3.027 g of Tris was dissolved in 15 ml D/W and the pH of the solution was

adjusted to 8 with concentrated HCl. The final volume of the buffer was made up to

25 ml with D/W.

0.5 M EDTA (Molecular weight – 373.2 g)

0.5 M EDTA = 4.65 g in 25 ml D/W

A part of weighed disodium EDTA salt was dissolved in 10 ml D/W and the pH of the

solution was adjusted to 8 with 10 N NaOH. Then another small part of the same

disodium EDTA salt was added to the above solution. The volume was made up to 25

ml with D/W.



10 % SDS

1 g of SDS dissolved in 10 ml D/W.

5 M NaCl (Molecular weight – 58.44 g)

14.61 g of NaCl was dissolved in 30 ml D/W and the final volume was made up to 50

ml with D/W.

CTAB/NaCl

4.1 g of NaCl was dissolved in 80 ml D/W. The solution was heated and while stirring

the solution, 10 g of N-cetyl-N, N, N,-trimethyl ammonium bromide (CTAB) was

added. The solution was heated to dissolve the CTAB completely. Finally the total

volume was made up to 100 ml with D/W.

70 % ethanol

70 ml of absolute ethanol was made up to 100 ml with D/W.

Method:

Day1. An overnight culture of each selected isolate was made by inoculating 10 ml of

sterile NB media with a single bacterial colony, and incubating it overnight at room

temperature under shaker conditions.

Day2. The overnight grown cultures were examined for the presence of any

contamination by carrying out Gram’s staining of each isolate. The media was then

subjected to centrifugation to obtain cell pellet of each isolate. The cell pellet of each

isolate was re-suspended in 600 µL of TE buffer. To the mixture, 60 µL of 10 % SDS

and 6 µL of 10 mg/ml proteinase K were added. The mixture was incubated for one

hour at 37 oC. Following incubation, 200 µL of 5 M NaCl was added and mixed

thoroughly. This was followed by the addition of 600 µL of CTAB/NaCl solution.

The mixture was incubated for 10 min at 65 oC. Equal amount of chloroform/isoamyl

alcohol was added to the mixture and micro-centrifuged for five min. The supernatant

was transferred into a fresh sterile tube. Equal amount of phenol/chloroform/isoamyl

alcohol was added and mixed well. The mixture was subjected to micro-centrifugation

for five min. Again the supernatant was transferred into a fresh sterile tube. 0.6



volumes of isopropanol were added and mixed gently. The mixture was micro-

centrifuged for five min. This was followed by washing of DNA precipitate with one

ml of 70 % ethanol. The tubes were left overnight at 37 oC in order to let the ethanol

evaporate from the DNA samples.

Day3. The DNA pellets from each isolate were re-suspended in 40 µL of TE buffer.

These DNA samples were subjected to qualitative analysis by carrying out Agarose

Gel Electrophoresis. In case smearing effect was observed, the genomic DNA

samples were subjected to treatment with RNAses. This involved addition of 2 µL of

RNAses in gDNA samples followed by incubation for one hour at 37 oC. Following

incubation, the gDNA samples were subjected to phenol/chloroform extraction and

phenol/chloroform/isoamyl alcohol extraction and finally precipitation of gDNA with

iso-propanol. This was followed by washing of the pellet with 70 % ethanol. The

ethanol was evaporated and the sample was re-constituted in a minimum volume of

TE Buffer, followed by qualitatively analysing the samples by Agarose Gel

Electrophoresis.

3.3.10. Polymerase chain reaction for amplification 16SrRNA gene

Following extraction of genomic DNA from selected chitinolytic isolates, the gDNA

was used as a source of template DNA for amplification of 16SrRNA gene from each

of the isolates using PCR technique (Sambrook, P.Maniatis, et al. 1989).

Requirements:

Sample: Extracted genomic DNA of each selected isolate

Reagents: Sterile D/W

10X PCR buffer

25 mM MgCl2

10 mM Dinucleotide Triphosphatase (dNTP) mix

Primers: 20 pmol/µL (Vickerman et al. 2007)

FP – 8F: 5’AGAGTTTGATCCTGGCTCAG 3’

RP – 1391R: 5’ GACGGGCGGTGTGTRCA 3’

Taq Polymerase enzyme



Miscellaneous: Ice pack

Sterile gloves

Applied Biosystems Thermocycler (ABI2400)

All the reagents were from Applied Biosystems and the dNTP mix was from

Fermentas Lifesciences.

Method:

The PCR reaction mixture of the reagents was prepared by adding the accurate

volume of reagents and primers as given below:

Components Quantity (in µL)

10X PCR Buffer 2.5

25 mM MgCl2 1.5

10 mM dNTP Mix 2.5

Taq Polymerase 0.25

Sterile Distilled Water 15.25

Forward Primer (8F) 1

Reverse Primer (1391R) 1

Template DNA 1

Total Volume 25

The volume of reagents mentioned above was for a single reaction. For multiple

reactions, corresponding volume of reagents was multiplied by the number of

reactions and then split into equal parts.

The template DNA was added to the reaction mixture and the final volume of the

mixture was made up with sterile D/W. This was followed by performing thermal

cycling under the following conditions:



Cycling Step Temperature Time Number of

cycles

Initial DNA

denaturation

94 oC 5 min 1 cycle

Denaturation 94 oC 1 min 35 cycles

Annealing 55 oC 45 sec

Extension 72 oC 2 min

Final extension 72 oC 10 min 1 cycle

Final Hold 4 oC -

After the completion of thermal cycling, the PCR products were qualitatively

analysed by carrying out Agarose Gel Electrophoresis.

3.3.11. Qualitative analysis of Genomic DNA/PCR product by Agarose Gel

Electrophoresis

The genomic DNA and PCR products obtained from each of the isolates were

qualitatively analysed as per the procedure described by J Sambrook et al. (1989).

Requirements:

Sample: Genomic DNA/ amplified PCR product

Reagents: Agarose (1 %)

1X Tris Borate EDTA electrophoresis buffer (TBE)

Ethidium bromide (10 mg/ml)

6X Gel loading buffer

Molecular marker – Lambda DNA/ EcoR1 + HindIII Marker

Miscellaneous: Electrophoresis apparatus with gel casting trays

Power pack

UV Transilluminator



Compositions:

10X TBE stock solution

108 g Tris Base

55 g boric acid

40 ml 0.5 M EDTA, pH 8.0 [186.1 g Na2EDTA.2H2O was dissolved in 700 ml H2O.

The pH was adjusted to 8.0 with 10 M NaOH. Then the final volume was made up to

1 liter with D/W]

1X TBE working solution

10X TBE stock solution was diluted 1:10 times before use [100 ml of TBE stock

solution was mixed with D/W to make up the volume to 1 liter].

Ethidium bromide solution – 10 mg/ml

10 mg ethidium bromide was dissolved in 1 ml D/W. This solution was stored in a

sterile Eppendorf tube wrapped in an aluminium foil at 4 oC.

6X Gel loading buffer

10 % Glycerol

0.25 % Bromophenol blue prepared in H2O from 0.5 % stock Bromophenol blue

solution [50 mg of Bromophenol blue dissolved in 10 ml D/W].

The buffer was prepared as follows:

344 µL of available glycerol stock (87 %) + 500 µL of 0.5 % Bromophenol blue

solution. The volume was made up to 1 ml with D/W and mixed well. This solution

was stored at 4 oC.

1 % Agarose

0.5 g of agarose powder was added to 50 ml of TBE buffer and heated so as to

completely dissolve the constituents.



Method:

A horizontal gel electrophoresis casting tray was rinsed with soap solution and water,

and then wiped with methanol.

1 % agarose was prepared and 2 µL ethidium bromide was added to the warm agarose

solution at 50 oC. The solution was mixed well and poured into the casting tray. The

comb was inserted carefully and the gel was allowed to solidify.

After the solidification, the comb was removed and the casting tray was transferred

into the agarose gel electrophoresis apparatus.

1X TBE buffer was added to the tank and the samples were loaded into the wells. The

samples were prepared by mixing it with loading dye.

The gel was run at 100 V for 45-50 min. The bands were visualized in the Gel

Documentation system, Alpha Inotech under UV.

FOR PCR Products:

The PCR products bands were visualized in the Gel Documentation system and

observed for bands of expected product size (~1.3 Kb) following which, the PCR

products were sent for bidirectional 16SrRNA gene sequencing at GeneOm Biotech –

contract service research labs, Pune.

The sequence generated from each isolate was further analysed and compared with

that in GenBank using NCBI BLAST Tool (Basic Local Alignment Search Tool). The

maximum resembling sequences were compared and aligned with closely related

sequences using CLUSTALW software. Distance based phylogenetic tree was

constructed using the NJ algorithm.



3.4. RESULTS AND DISCUSSION

Enrichment and isolation of chitinolytic organism from the soil samples

Swiontek Brzezinska et al. (2010) suggested that chitinolytic organisms, isolated from

soil are more active than the ones isolated from water and bottom sediment samples,

hence they can be considered more appropriate for agricultural use. Therefore, soil

samples were collected from different environments to isolate chitinolytic organisms.

These soil samples were processed in order to obtain the initial count of microbes.

The initial count of each of the soil samples has been presented in the Table 3.22.

Table 3.22: Initial colony count obtained from all soil samples

Sr.No Soil Sample Initial Count (cells/ml)

1 Beach sand 105

2 Garden soil 105

3 Dumping ground soil 104

4 Fish market soil 103

Each of the soil samples were subjected to enrichment process which ensured the

proliferation of chitinase producing organisms. During the process of enrichment and

viable count, mixed and pure culture colonies were obtained which were capable of

producing chitinase. In a natural environment, organisms often co-exist as a part of

multi-species community, which interact amongst themselves (Keller & Surette 2006;

Haruta et al. 2009). These communities later on form an integral part of biological

system (Straight & Kolter 2009).

As mentioned earlier, the enrichment process was carried out in three successive

stages and viability count of the cells was performed at regular intervals for each step

of the enrichment process in order to study the type of microflora being enriched. The

first enrichment allowed the proliferation of micro-organisms which were capable of

utilizing chitin as a sole source of carbon and energy. Chitinolytic micro-organisms

were then further allowed to out-grow the other type of flora present in the initial

inoculum by carrying out subsequent enrichments. These stages allowed the true-

chitin utilizing micro-organisms to proliferate that may be present in each of the



original soil sample but in very small numbers. The enrichment process revealed that

the diversity of the microbes obtained from each of the soil samples was limited. This

may be attributed to the limitations of the method based on laboratory cultivation, and

the presence of viable and dormant but non-culturable cells.

Another noteworthy observation made was that a majority of the isolated micro-

organisms from the enriched broth were affiliated to the phylogenetic class Bacillus.

This observation was in accordance with a previous report by Hoster et al. (2005).

Previous studies also confirm the frequent recovery of members of this class during

the enrichment of chitin-degrading micro-organisms from soil and marine samples

(Kuroshima et al. 1996; Ivanova et al. 1999).

The micro-organisms isolated from the enrichment process were assumed to be

chitinase producers and further subjected to preliminary and secondary screening

procedures.



Table 3.23: Colony characteristics of the isolates obtained from soil sample 1

SOIL SAMPLE 1 – BEACH SAND SOIL

Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6 Colony 7 Colony 8

Size Large Pinpoint Small Large Small Small Large Pinpoint

Shape Circular Circular Circular Irregular Circular Circular Irregular Circular

Color White Cream White Cream Orange Yellow Off White Yellow

Margin Entire Entire Entire Irregular Entire Entire Irregular Entire

Consistency Butyrous Butyrous Butyrous Rough Butyrous Butyrous Butyrous Butyrous

Elevation Flat Flat Low convex Flat Low convex Convex Low convex Convex

Opacity Opaque Translucent Translucent Translucent Translucent Opaque Opaque Opaque

Gram’s

Nature

Gram +ve

cocci

Gram –ve

coccobacilli

Gram –ve

rods

Gram –ve

coccobacilli

Gram –ve

rods

Gram +ve

cocci

Gram –ve

coccobacilli

Gram +ve

cocci




SOIL SAMPLE 2 - GARDEN SOIL

Colony

1

Colony

2

Colony

3

Colony

4

Colony

5

Colony

6

Colony

7

Colony

8

Colony

9

Colony

10

Size Small Pinpoint Large Small Large Large Small Small Small Medium

Shape Circular Circular Circular Irregular Irregular Irregular Circular Circular Circular Irregular

Color White White White Yellow White Cream Yellowish White Greenish Greenish

Margin Entire Entire Entire Irregular Irregular Irregular Irregular Entire Entire Irregular

Consistency Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous Butyrous

Elevation Low

convex

Low

convex Flat Flat Flat Flat Flat

Low

convex

Low

convex Flat

Opacity Opaque Translucent Opaque Opaque Translucent Translucent Translucent Opaque Translucent Translucent

Gram’s

Nature

Gram

+ve

bacilli

Gram +ve

bacilli

Gram

+ve

bacilli

Gram

+ve

cocci

Gram –ve

coccobacilli

Gram –ve

coccobacilli

Gram –ve

coccobacilli

Gram

+ve

bacilli

Gram –ve

rods

Gram –ve

rods




SOIL SAMPLE 3 – DUMPING GROUND SOIL

Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6

Size Small Pinpoint Small Large Medium Medium

Shape Circular Circular Circular Circular Circular Circular

Color Reddish Cream Cream White Cream Off white

Margin Entire Entire Entire Serrate Entire Entire

Consistency Butyrous Butyrous Butyrous Powdery Butyrous Butyrous

Elevation Flat Flat Low convex Flat Low convex Flat

Opacity Translucent Opaque Opaque Opaque Opaque Opaque

Gram’s Nature Gram +ve cocci Gram –ve rods Gram +ve bacilli Gram +ve bacilli

Gram –ve

coccobacilli Gram –ve rods




SOIL SAMPLE 4 – FISH MARKET SOIL

Colony 1 Colony 2 Colony 3 Colony 4

Size Medium Small Small Small

Shape Circular Circular Circular Irregular

Color White Off white White Off white

Margin Entire Entire Entire Irregular

Consistency Butyrous Butyrous Butyrous Butyrous

Elevation Flat Low convex Convex Low convex

Opacity Opaque Opaque Translucent Opaque

Gram’s Nature Gram -ve coccobacilli Gram +ve bacilli Gram –ve rods Gram +ve bacilli



Preliminary and secondary screening of the isolates:

The colonies, which were consistently obtained from regular viable count during the

enrichment process, were subjected to preliminary screening. The colony

characteristics of the isolates from each of the soil samples have been summarized in

Tables 3.23 - 3.26.

A total of 28 isolates were obtained from enrichment of soil samples. These isolates

were assumed to be potent chitinase producers and were subjected to preliminary

screening in order to narrow down on the number of isolates on the basis of clearance

zone: colony size (CZ/CS) ratio. The colonies which exhibited high (CZ/CS) ratios

were selected for further studies. The (CZ/CS) ratios of the isolates obtained from

each of the soil samples have been tabulated in the Tables 3.28 – 3.31.

Preliminary screening revealed that although some colonies from each soil sample

were consistently observed throughout the enrichment process, not all the isolates

were capable of chitinase production. These isolates were unable to produce the zone

of clearance on CCA plates. This phenomenon is explained by the authors Beier &

Bertilsson (2013) which states that during enrichment process it is plausible that

chitinolytic bacteria sometimes process more chitin substrate than they are able to

utilize. The hydrolysis products produced as a result of degradation of chitin are

actively utilized by other micro-organisms with no apparent chitinase activity. This

may have led to the growth of microbes which lack the ability to utilize chitin. This

phenomenon of inter-specific cross feeding is the reasonable explanation for

proliferation of non-chitinolytic microbes during the enrichment process. The results

obtained from preliminary screening confirmed the occurrence of inter-specific cross

feeding phenomenon during the enrichment process.

The chitinase producing colonies were further subjected to secondary screening,

which involved repeated sub-culturing on NA plates followed by spot inoculation on

CCA plates to check for their ability to degrade chitin.



Consistent chitin degraders i.e. isolates which showed distinct zone of clearance on

repeated subculture, were selected for further studies. The isolates selected for further

studies, along with their (CZ/CS) ratio have been summarized below in Table 3.27.

Table 3.27: Isolates selected for further studies

Colony Obtained from CZ/CS Ratio

Colony 6 – S1 Beach sand soil 1.92 ± 0.07

Colony 3 – S2 Garden soil 2.22 ± 0.48

Colony 10 – S2 Garden soil 1.88 ± 0.13

Colony 3 – S3 Dumping ground soil 1.99 ± 0.56

Colony 4 – S4 Fish market soil 2.27 ± 0.25

These isolates were subjected to biochemical identification tests as described in

Bergey’s Manual of Systematic Bacteriology.



Table 3.28: Clearance zone to Colony size (CZ/CS) ration of isolates (in cms) from soil sample 1 (S1)

Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6 Colony 7 Colony 8

CZ/CS ratio NA 1.43 ± 0.29 1.38 ± 0.10 NA NA 1.92 ± 0.07 1.57 ± 0.08 1.45 ± 0.13

Values are Mean ± SD of 3 replications

Key: NA – Not Applicable. No zone of inhibition observed


Colony

1

Colony

2

Colony

3

Colony

4

Colony

5

Colony

6

Colony

7

Colony

8

Colony

9

Colony

10

CZ/CS

ratio

0.63

±

0.12

0.48

±

0.04

2.22

±

0.48

NA NA NA NA 0.87

±

0.2

1.16

±

0.08

1.88

±

0.13






Colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6

CZ/CS ratio NA 1.32 ± 0.2 1.99 ± 0.56 0.87 ± 0.78 NA NA




Colony 1 Colony 2 Colony 3 Colony 4

CZ/CS ratio 1.31 ± 0.27 1.43 ± 0.29 1.56 ± 0.10 2.27 ± 0.25





Biochemical identification of the isolates capable of producing chitinase

Of the 28 isolates evaluated, five potential chitinase producers were selected for

further assessment. Each of the isolates were identified on the basis of their

morphological characteristics, namely, cell morphology (Gram’s nature, shape,

motility and the presence of endospores); colony morphology (colour, size, shape,

opacity, margin, elevation, and consistency) and biochemical characteristics using

standard biochemical test suggested in Bergey’s Manual of Systematic Bacteriology

(Claus & Berkeley 1986). The results of the morphological and biochemical tests

performed for each of the selected isolates are represented in Table 3.32 and Table

3.33 respectively.

Identification of the organism usually goes hand in hand with performing Antibiotic

Sensitivity Test (AST). This test was performed in order to confirm the identity of

each isolate along with compiling the information on what type of antibiotics to

consider for each isolate, as these isolates require to be user and environment-friendly.

The results of this test are presented in the Table 3.34.

Along with morphological and biochemical identification, additional accessory tests

were performed in order to further confirm the identity of each selected isolates. Each

isolate was studied in order to investigate the optimum pH, temperature and salt

concentration for maximum growth. The results of the test in order to investigate the

optimum conditions for maximum growth of each isolate have been summarized in

the Table 3.35.



Table 3.32: Morphological characteristics of each of the isolates selected from the

screening process

Colony 6

S1

Colony 3

S2

Colony 10

S2

Colony 3

S3

Colony 4

S4

Gram Nature Gram

positive

cocci

Gram positive

bacilli

Gram negative

short rods

Gram

positive

bacilli

Gram

positive

bacilli

Motility Non motile Sluggishly

motile

Motile Non motile Non motile

Presence of

Endospore

Absent Sub terminal Absent Central Sub

terminal

Lactose

fermentation

NA NA Lactose non-

fermenter

NA NA

Key: NA- Not applicable



Table 3.33: Biochemical characteristics of the selected isolates from the screening

process

TEST Colony 6

S1

Colony 3

S2

Colony 10

S2

Colony 3

S3

Colony 4

S4

Tests to distinguish between aerobic and anaerobic breakdown of carbohydrates

O/F Aerobic* + + + + +

O/F Anaerobic - - - - -

Tests to show fermentation of range of carbohydrates: Acid production from

Glucose + + + + +

Sucrose + + - + +

Lactose + - - - +

Maltose + + - + +

Mannitol + - - - +

Xylose + - - - -

Tests for Specific Breakdown Products

Methyl Red + + - + +

VP Test - - - - -

Tests to show Ability to utilize particular Substrate

Starch + + + + -

Citrate - - + - -

Tests for Metabolism of Proteins and Amino acids

Indole

Production

- - - - -

Arginine

dihydrolyase

- - + - -

Gelatin

hydrolysis

+ + + + +

Tests for Enzymes

Catalase + - +

+

+ +

Oxidase - - + - -

Urease - + - + +

Nitrate

Reduction

+ - - - +

Combined Tests

Triple Sugar

Iron(TSI)

A/A A/A K/K A/A A/A

Key: + indicates positive reaction for the test

- indicates negative reaction the test

* indicates utilization of carbohydrate resulted in yellow coloration in the

medium

Acidic Slant, Acidic butt (A/A)

Alkaline Slant, Alkaline butt (K/K)



Table 3.34: Antibiotic Sensitivity of each of the chitinolytic organisms

Antibiotic Zone of Inhibition (in mm)

Colony 6

S1

Colony 3

S2

Colony 10

S2

Colony 3

S3

Colony 4

S4 Aztreonam 8 16 31 16 --

Cefoperazone 19 20 29 18 15

Tetracycline 20 23 24 19 19

Levofloxacin 28 26 34 30 20

Cefixime -- -- -- -- 28

Ofloxacin 14 21 23 23 --

Penicillin G 19 -- 6 -- 14

Imipenem -- -- -- -- 19

Cefuroxime 8 -- -- -- --

Azithromycin 28 19 20 21 8

Carbenicillin 14 -- 21 -- 28

Ciprofloxacin 12 20 21 23 14

Piprac/Tazobact 20 20 29 20 12

Augmenin 19 -- 22 -- 20

Methicillin 9 -- 10 -- 19

Ceftriaxone 18 11 29 -- 9

Amikacin 16 33 21 23 18

Tobramycin -- 35 -- 22 16

Sulfamethizole 24 32 33 24 --

Norfloxacin -- 32 11 22 24

Chloramphenicol 32 44 18 27 --

Cefadroxil 24 37 -- 26 32

Bacitracin 8 19 -- -- 24

Cephalexin 18 31 -- 25 8

Lincomycin -- 29 -- 17 18

Novobiocin 27 39 -- 22 --

Meropenem -- -- -- -- 27

Cefazolin -- -- 31 -- --

Oxacillin 9 -- 12 -- --

Ceftazidime -- -- -- -- 9

Sparfloxacin 24 38 40 26 --

Nalidixic acid -- 30 -- 22 24

Metronidiazole -- -- -- --

Vancomycin 28 30 -- 19 --

Co-trimoxazole 10 31 33 13 --

Trimethoprim -- -- -- -- 28

Cloxacillin

-- -- -- -- 10

Erythomycin -- 33 -- 26 --

Key: -- indicates no inhibition observed



Table 3.35: Summary of optimum growth parameters for each chitinolytic

organisms

Colony

6

S1

Colony

3

S2

Colony

10

S2

Colony

3

S3

Colony

4

S4

Optimum pH 7 7 7 7 7

Optimum temperature 37 oC 37

oC 37

oC 37

oC 37

oC

Optimum NaCl

concentration (%)

0.5 0.5 0.5 0.5 0.5

After the assessment of biochemical characteristics, the identity of each of the

selected isolates from the screening procedure was investigated up to the genus level

of identification. The summary of biochemical identification of the chitinolytic

isolates have been represented below in the Table 3.36.

Table 3.36: Summary of biochemical identification of the chitinolytic organisms

ISOLATE NAME

OBTAINED FROM

BIOCHEMICALLY

IDENTIFIED AS

Colony 6 S1 Beach soil Cellulosimicrobium spp.

Colony 3 S2 Garden Soil Bacillus spp.

Colony 10 S2 Garden soil Pseudomonas spp.

Colony 3 S3 Dumping ground soil Bacillus spp.

Colony 4 S4 Fish Market soil Bacillus spp.



As per Bergey’s manual of Systematic Bacteriology, Colony 6 from beach sand soil

(Soil sample 1), resembled Cellulosimicrobium spp. (Claus & Berkeley 1986). The

morphological, biochemical and growth condition characterization matched with the

description provided in the Bergey’s manual of Systematic Bacteriology (Claus &

Berkeley 1986). Previously, strains of Cellulosimicrobium cellulans have been

reported to be isolated from alcohol fermentation industrial waste (Ferracini-Santos &

Sato 2009) and soil sample from Taiwan (Lo et al. 2009). The occurrence of

Cellulosmicrobium has also been reported in soil, compost samples and fetal tissues

or placenta samples from cases of equine abortion, premature birth and term

pregnancies of horses (Bolin et al. 2004; Yoon et al. 2007; Kamble & Jadhav 2013).

As per Bergey’s manual of Systematic Bacteriology (Claus & Berkeley 1986), Colony

3 and Colony 10 from garden soil (Soil sample 2) resembled Bacillus and

Pseudomonas spp. respectively. Earlier, Pseudomonadaceae have been reported to

constitute approximately 80 % of the chitinolytic population in the soil (Frändberg &

Schnürer 1998). Previous literature suggests that Pseudomonas is known to be

resistant to antibiotics and it is also implicated as an opportunistic pathogen of clinical

relevance (Mesaros et al. 2007). Although reports are available for usage of

Pseudomonas as biocontrol agents, the limited viability of Pseudomonas spp., has

hindered practical application (Weller 1988; Gardener 2007) and hence this isolate

was not selected for further studies Also, compared to other bacteria, Bacillus spp.

offer many advantages as biocontrol agents therefore Colony 3 which was identified

as belonging to Bacillus spp. was considered for further studies.

Colony 3 from soil sample 3 and Colony 4 from soil sample 4 which were garden soil

and fish market soil respectively were resembling Bacillus spp. as per Bergey’s

manual of Systematic Bacteriology (Claus & Berkeley 1986). The presence of

Bacillus spp. in garden and fish market soil confirmed the role of Bacillus spp. in

degradation of chitin containing substrates and recycling carbon and nitrogen in

nature.



On the basis of previous literature reports, out of five chitinolytic organisms, four

isolates, belonging to Bacillus spp. (Colony 3 S2, Colony 3 S3 and Colony 4 S4) and

Cellulosimicrobium spp. (Colony 6 S1) were selected for further studies. In further

experiments, Colony 3 S2, Colony 6 S1, Colony 3 S3 and Colony 4 S4 will be

referred as Isolate 1, Isolate 2, Isolate 3 and Isolate 4 respectively for the description

of outcomes.

Extraction of Genomic DNA from bacterial cells and PCR for amplification of

16SrRNA gene:

Genomic DNA pellets were visualized as white pellets from each isolate following

isopropanol precipitation; these pellets were left overnight to dry and re-constituted

the following day in TE buffer. The extracted gDNA was qualitatively analysed by

carrying out Agarose Gel Electrophoresis.

The agarose gel electrophoresis indicated that the gDNA from the Isolates 1 and 2

were successfully extracted whereas gDNA from Isolates 3 and 4 showed trailing

effect (Figure 3.3). This phenomenon was attributed to the presence of RNA

contamination in the gDNA samples; the smearing and trailing effect of the gDNA

bands has been most frequently observed with high-molecular weight DNA fragments

(Voytas 2000). The absence of sharp bands of gDNA has been attributed to diffusion

of DNA through the gel, when gels are run for long periods of time at low voltages

(Voytas 2000). The gDNA samples from each isolates were subjected to RNase A

treatment which cleared out RNA contamination from the gDNA samples (Figure

3.4).

The genomic DNA samples were stored at -20 oC and used for PCR reactions. The

extracted genomic DNA of each of the four isolates served as template DNA for

amplification of 16SrRNA gene using PCR technique. Universal bacterial 16SrRNA

primers- 8F and 1391R were used for amplification of the 16SrRNA gene (Vickerman

et al. 2007). Under the optimized reaction mixture and reaction conditions, all the

isolates gave the amplified product of approximately 1.3 Kb using universal bacterial

primers (Figure 3.5).



Figure 3.3: Agarose gel electrophoresis of genomic DNA (gDNA) extracted from

all the isolates. Legend: Lane 1- gDNA from isolate 1; Lane 2- gDNA from isolate

2; Lane 3- gDNA from isolate 3; Lane 4- gDNA from isolate 4

Figure 3.4: Agarose gel electrophoresis of genomic DNA (gDNA) from

chitinolytic isolates following RNase A treatment. Legend: Lane 1- gDNA from

isolate 1; Lane 2- gDNA from isolate 2; Lane 3- gDNA from isolate 3;Lane 4-

gDNA from isolate 4



Figure 3.5: Agarose gel electrophoresis of PCR products from chitinolytic

isolates using universal bacterial 16SrRNA primers- 8F and 1391R. Legend:

Lane 1- DNA ladder (EcoRI/HindIII Marker); Lane 2- blank; Lane 3- PCR product

of isolate 2; Lane 4 – blank; Lane 5 – PCR product from isolate 3;Lane 6 –PCR

product from isolate 4; Lane 7 – blank; Lane 8 –PCR product from isolate 1



16SrRNA sequencing of the amplified PCR products of chitinolytic isolates:

To validate the isolates identity up to the species level, the PCR amplification

products were sent for sequencing at Gene Ombiotech Labs, Pune and the sequence

obtained were compared with the database of GenBank using the NCBI Blast tool.

The sequence data obtained following bidirectional sequencing of each isolate has

been presented in the Figures 3.6, 3.8, 3.10 and 3.12. This was followed by a

similarity search for the sequences obtained from each isolate using the BLAST

program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) which served to demonstrate the

identity of each isolate. The results obtained using Blast program has been included in

the Appendix I.

The partial sequence obtained for Isolate 1 using universal bacterial forward primer

8F resulted in the sequencing of 517 base pairs. The plausible causes of short DNA

sequencing read lengths can be attributed to excess template DNA or primers, too

little DNA or contamination of DNA template (Nucleics 2013). This problem could

be rectified by checking the concentration of the template DNA by taking

spectrophotometer readings.

The sequence of 827 bp obtained from Isolate 1 showed 98 % homology identity of

the culture to Bacillus cereus. The sequence of 912 bp obtained from Isolate 2

demonstrated 97 % homology identity of the culture to be alike to Cellulosimicrobium

cellulans whereas the sequences of 994 bp and 923 bp obtained from isolates 3 and 4

showed the cultures having 93 % and 96 % homology, confirming the isolates to be

Bacillus cereus strain NOC2011 and Bacillus licheniformis respectively.

A neighbour-joining distance gene tree was constructed using the NJ algorithm. The

phylogenetic trees for each of the isolates were constructed by comparing and

aligning the maximum resembling sequences to the sequence obtained from each

isolates using the CLUSTALW tool (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The

phylograms of each of the isolates have been presented in the Figures 3.7, 3.9, 3.11

and 3.13.

http://blast.ncbi.nlm.nih.gov/Blast.cgi

http://www.ebi.ac.uk/Tools/msa/clustalw2/



In the present study, the identification of the selected chitinolytic isolates was

confirmed up to the species level. It is reported that one of the most potential uses of

16SrRNA gene sequence informatics is to provide genus and species identification of

the isolates that do not fit any recognized biochemical profiles. It is also known that

results from a limited number of studies to date, suggest that 16SrRNA gene

sequencing provides genus identification, in most cases (> 90 %) 1 to 14 % of the

isolates remaining unidentified (Drancourt et al. 2000; Mignard & Flandrois. 2006).

The difficulties in obtaining the genus and species identification have been attributed

to few sequences deposited in nucleotide databases, species sharing similar and/or

identical 16SrRNA sequences (Janda & Abbott 2007). In regards to bacterial

classification, 16SrRNA gene sequencing has low phylogenetic power at species level

and poor discriminatory power for some genera, and DNA relatedness studies are

necessary to provide absolute resolution to taxonomic problems. The genus Bacillus

has been reported to exhibit this phenomenon (Janda & Abbott 2007). Hence, the use

of technologies based on microarray may prove to be more sensitive for molecular

species identification. The results of biochemical and 16SrRNA identification of each

of the chitinolytic isolates have been summarized in the Table below (3.37). The next

goal of the project included assessment and optimization of chitinase activity from

selected isolates followed by selection of potential BCA’s for further investigation.

This has been discussed in detail in following chapter.

Table 3.37: Summary of identification of chitinolytic isolates

ISOLATE

ORIGIN

BIOCHEMICALLY

IDENTIFIED AS

LINEAGE REPORT

RESULTS

Isolate 1/

Colony 3 S2

Garden soil Bacillus spp. Bacillus cereus

Isolate 2/

Colony 6 S1

Marve

Beach soil

Cellulosimicrobium spp. Cellulosimicrobium

cellulans

Isolate 3/

Colony 3 S3

Garden soil Bacillus spp. Bacillus cereus strain

NOC2011

Isolate 4/

Colony 4 S4

Fish market

soil

Bacillus spp. Bacillus licheniformis



Figure 3.6: Bidirectional sequence of 16SrRNA gene for Isolate 1 using universal

bacterial 16SrRNA primers – 8F and 1391R

Figure 3.7: Phylogenetic tree analysis for Isolate 1 based on 16SrRNA sequences



Figure 3.8: Bidirectional sequence of 16SrRNA gene for Isolate 2 using universal

bacterial 16SrRNA primers – 8F and 1391R

Figure 3.9: Phylogenetic tree analysis for Isolate 2 based on 16SrRNA sequences



Figure 3.10: Bidirectional sequence of 16SrRNA gene for Isolate 3 using

universal bacterial 16SrRNA primers – 8F and 1391R

Figure 3.11: Phylogenetic tree analysis for Isolate 3 based on 16SrRNA

sequences



Figure 3.12: Bidirectional sequence of 16SrRNA gene for Isolate 4 using

universal bacterial 16SrRNA primers – 8F and 1391R

Figure 3.13: Phylogenetic tree analysis for Isolate 4 based on 16SrRNA

sequences

3. ISOLATION AND IDENTIFICATION OF CHITINASE...

Documents

Transcript of 3. ISOLATION AND IDENTIFICATION OF CHITINASE...