28(2), 314–322 Research Article Review - JMBprimarily β-keratin, azelon, and insoluble protein...

J. Microbiol. Biotechnol.

J. Microbiol. Biotechnol. (2018), 28(2), 314–322https://doi.org/10.4014/jmb.1708.08077 Research Article jmbReview

Biodegradation of Feather Waste Keratin by the Keratin-DegradingStrain Bacillus subtilis 8Zhoufeng He, Rong Sun, Zizhong Tang, Tongliang Bu, Qi Wu, Chenlei Li, Hui Chen*

College of Life Science, Sichuan Agricultural University, Ya’an 625014, P.R. China

Introduction

Protein constitutes over 90% of feather biomass, which is

primarily β-keratin, azelon, and insoluble protein extensively

cross-linked by disulfide bonds [1]. Hydrogen bonding,

ionic bonding, and the hydrophobic effect of the polypeptide

further endow it with mechanical strength, making hydrolysis

difficult for most proteases. Because feathers contain a

wealth of essential amino acids, they are considered to be a

quality protein feed source with unique values [2]. The

rational utilization of millions of tons of waste feathers in

poultry factories will not only ease the shortage of protein

resources, but will also improve the environment.

The limitations of traditional methods to hydrolyze keratin

have prompted the development of microbial degradation

methods that have achieved considerable success. At

present, more than 30 kinds of microorganisms, including

fungi [3-5], actinomycetes [6-8], and bacteria [5, 9-11], have

been reported to demonstrate keratinolytic properties. The

majority of reports on keratin-degrading microorganisms

focus on characterizing their keratinase (KT) activity and

disulfide bond-reducing (DRT) activity. In fact, the

biodegradation of keratin is a process that involves a

variety of biological factors and definitive mechanisms. It is

essential to understand the key factors of this process and

the synergistic relationships that exist in the degradation of

keratin.

In this study, we isolated B. subtilis 8 and observed that it

possesses keratinolytic properties but low KT and DRT

activities. To explain this phenomenon, we inferred the

degradation mechanism from fermentation products and

related enzymes secreted by B. subtilis 8.

Materials and Methods

Microorganism and Feathers

The keratinolytic strain B. subtilis 8 that was isolated from afeather disposal site by the Animal Micro-ecology Laboratory ofSichuan Agricultural University was applied for the present research.The strain was grown in basal feather medium consisting of thefollowing: 1.4 g/l K2HPO4, 0.7 g/l KH2PO4, 0.5 g/l NaCl, 0.5 g/lNH4Cl, 0.1 g/l MgCl2, 10.0 g/l feathers; pH 8.0. Feathers collectedfrom the chicken farm were washed thoroughly with detergentfollowed by ultrapure water 3 times to remove dirt and bloodstains. The feathers were then dried in an oven at 60°C for 24 h.

Received: September 21, 2017

Revised: November 10, 2017

Accepted: November 15, 2017

First published online

February 13, 2017

*Corresponding author

Phone: +86-835-2886126;

Fax: +86-835-2886126;

E-mail: [email protected]

upplementary data for this

paper are available on-line only at

http://jmb.or.kr.

pISSN 1017-7825, eISSN 1738-8872

Copyright© 2018 by

The Korean Society for Microbiology

and Biotechnology

Bacillus subtilis 8 is highly efficient at degrading feather keratin. We observed integrated

feather degradation over the course of 48 h in basic culture medium while studying the entire

process with scanning electron microscopy. Large amounts of ammonia, sulfite, and L-cysteic

acid were detected in the fermented liquid. In addition, four enzymes (gamma-

glutamyltranspeptidase, peptidase T, serine protease, and cystathionine gamma-synthase)

were identified that play an important role in this degradation pathway, all of which were

verified with molecular cloning and prokaryotic expression. To the best of our knowledge, this

report is the first to demonstrate that cystathionine gamma-synthase secreted by B. subtilis 8 is

involved in the decomposition of feather keratin. This study provides new data characterizing

the molecular mechanism of feather degradation by bacteria, as well as potential guidance for

future industrial utilization of waste keratin.

Keywords: Bacillus subtilis, keratin, purification, degradation mechanism, prokaryotic

expression

S

S

Degradation Mechanism of Keratin in Bacteria 315

February 2018⎪Vol. 28⎪No. 2

The chemical reagents used in this study were of pure analyticalgrade and purchased from Sigma or Tiangen (China).

Feather Degradation with B. subtilis 8 Fermentation

Feathers were completely degraded by B. subtilis 8 at 48 h. Thepercentage of feather degradation was measured by weightlessness[12]. Feathers still present in the medium after fermentation werefiltered through the speed filter paper. The feather residue wasthoroughly washed with ultrapure water and dried to a constantweight at 60°C, at which point it was weighed to determineweight loss.

Analysis of Keratinase Activity

KT activity measurement methods were modified from Gradisaret al. [3]. The fermentation broth was centrifuged at 4,000 ×g for15 min, and the supernatant was collected as a crude enzymesolution. The reaction system included 1.0 ml of the fermentationsupernatant and 2.0 ml of Tris-HCl buffer (0.05 M, pH 8.0) towhich 10.0 g of feather powder was added as the reactionsubstrate, followed by incubation in a 37°C constant temperaturewater bath for 1 h and subsequent termination by adding 2.0 ml of20% TCA (trichloroacetic acid). After centrifugation at 10,000 ×g

for 15 min at 4°C, the supernatant was gathered for measuring bychromometry at 280 nm. TCA (20%) was added before the enzymaticreaction as the control. An increase of corrected absorbance at280 nm with the control of 0.01 was considered one unit ofenzyme activity·ml-1·h-1 at 37°C.

Analysis of Disulfide Bond-Reducing Activity

The DRT activity was determined as described by Prakash et al.[13] with several modifications. The DRT activity was measuredspectrophotometrically at 412 nm by detecting the yellow-coloredsulfide formed upon reduction of DTNB (5,5’-dithio-bis(2-nitrobenzoic acid)). The supernatant (500 μl) as a crude enzymewas incubated with 0.02 g of feather powder at 37°C for 1 h. Thereaction was terminated by adding 4.0 ml of 2% TCA to thereaction mixture, mixed with 1.0 ml of 10.0 mM DTNB, andcentrifuged. After a 10 min incubation, spectrophotometricabsorbance was measured. One unit of DRT activity (U/ml) wasdefined as the enzyme dosage that catalyzes the formation of1 μM of sulfide per minute.

Scanning Electron Microscopy (SEM) Analysis of Feather

Degradation

Feather samples were recovered at various time intervals (0, 8,16, 24, and 32 h) for SEM to detect morphological changes thatoccur during different stages of feather degradation. The sampleswere dehydrated and placed in aluminum stubs. The stubs weresputter-coated with gold, observed, and photographed with an S-4800 microscope (Hitachi, Japan).

Analysis of Amino Acids and Sulfite

The culture supernatant was collected after 48 h of fermentation

by centrifugation at 10,000 ×g for 15 min and then filtered througha 0.22-μm cellulose membrane (Millipore, USA) before determination.In the control group, the processes were the same regarding theaddition of the seed solution. Amino acid analysis of the culturesupernatant was performed on an automatic amino acid analyzer,L-8900 (Hitachi). The sulfite content was determined by BaCl2

solution [14].

Enzyme Purification

All operations were performed below 4°C. The crude enzymewas obtained by centrifugation at 10,000 ×g for 15 min and laterprecipitated by adding solid ammonium sulfate up to 25-75%saturation. Salting-out enzyme precipitation was collected bycentrifugation at 10,000 ×g for 15 min at 4°C and then dissolved inultrapure water and dialyzed (MW: 3400, Cellophane membrane;Sigma) 3 times over 8 h intervals. The enzyme sample after dialysiswas concentrated by freeze-drying. The pellet was dissolved inTris-HCl (0.05 M, pH 8.0) and applied to a DEAE- Sepharose FastFlow anion-exchange column equilibrated against the samebuffer. The enzyme sample was eluted with the same buffer atdifferent ionic strengths (0.3, 0.5, 0.8, and 1.0 M NaCl). The activefractions showing keratinolytic properties were concentrated anddesalted using an Amicon Ultra-15 Centrifugal Filter Unit withUltracel-3 membrane (EMD Millipore, USA). Enzyme purity wasdetermined by SDS-PAGE on a 12% polyacrylamide gel using amini-PAGE instrument (Bio-Rad, USA) followed by gelatinzymography for enzymatic activity [4].

LC-MS/MS Analysis

After SDS-PAGE, the protein bands corresponding to thetransparent tape were cut out and extracted by in-gel digestionwith trypsin and analyzed by LC-MS/MS. Peptides were separatedby liquid chromatography, and isolated samples were identifiedby mass spectrometry. The reliability of the experimental resultsof LC-MS/MS was unused ≥ 1.1 and peptides (95%) ≥ 1 (p <0.05) as the standard. Database searches were performed using theUniProtKB database to obtain the complete protein sequence,which was then imported into the Blast2GO bioinformatic tool forgene ontology (GO) annotation. The analysis was implementedusing Blast2GO software suite 4.0 with the following settings:blast DB = nr; E-Value = 1.0E-3; number of blast hit = 20; blastmode = QBlast-NCBI; E-value-Hit-Filter = 1.0E-6; annotation cut-off = 55; and GO weight = 5 [15].

Molecular Cloning and Prokaryotic Expression

Purification of the enzymes from B. subtilis 8 was verified withmolecular cloning using gene-specific primers (Table 1). Then, wefurther studied the interaction of these proteases and anysynergistic effects that may exist using gene expression methods.The transformants with pET-30b (+) plasmids were cultured in a250 ml triangular flask at 30°C, with 1 mM IPTG for 6 h, andsamples were taken every 2 h. The collected precipitate wasdetected by SDS-PAGE after ultrasonic crushing.

316 He et al.


Hydrolysis Properties of Extracellular Proteolytic Enzymes

The KT and DRT activities of recombinant proteases withdifferent combinations were measured respectively using featherpowder as substrate. The combination of recombinant proteasesare shown in Table 2. At the same time, the hydrolysis ofrecombinant proteases with different combinations was observedin full feather medium in a water bath at 37°C for 4 days.

Results

Feather Degradation by B. subtilis 8 Fermentation

The feather weight loss (FWS), as well as KT and DRT

enzyme activities in B. subtilis 8, were measured after

fermentation for 12, 24, 36, 48, 60, and 72 h. All three

parameters gradually increased, and after 36 h of

fermentation, the shape of the feather in the shake bottle

was no longer visible with the naked eye. FWS reached a

maximum of 83.7% after 60 h of fermentation, indicating

the feather had been completely degraded by B. subtilis 8

(Fig. 1). In general, KT activity reached the maximum of

21.6 U/ml by 48 h, higher than DRT activity at that time

point (17.4 U/ml). The DRT activity values were lowest

(9.6 U/ml) at approximately 12 h, after which time they

increased significantly and reached maximum (17.4 U/ml)

levels over the next 12 h.

Scanning Electron Microscopy Analysis of Chicken-Feather

Degradation

The change of feather microstructure was studied using

SEM over the course of degradation (Fig. 2). Feather shafts

with barbs (Fig. 2A) and barbs with fine barbules could be

Table 1. Gene-specific primers used in molecular cloning.

Gene Primer Sequence (5’ → 3’) Product size (bp)

M-γ-Glu Forward ATGAAAAAGAAAAAGTTTATGAATC 1,776

Reverse TCATTTTTCACATTTTTTCAAGTTT

PeP T Forward ATGAAAAATGAAATCATTG 1,233

Reverse TTAAGCGCGCTCTTCAAAG

Cys P Forward ATGAAGAAAAAAACGCTGATGGTG 1,143

Reverse TTATAAAAGTGAATCAAGCGCCTG

Ser P Forward ATGAATGGTGAAATGCATTTGATTCC 960

Reverse TCAGAAAGACAGCAGCTGTGCCTGTT

Table 2. Combination of different proteases.

Enzyme combinationAddition of enzymes (V)

P-Glu P-Ser P-Pet P-Cys Buffer solution

P-Glu 1 0 0 0 3

P-Glu + P-Ser 1 1 0 0 2

P-Pet 0 0 1 0 3

P-Pet + P-Ser 0 1 1 0 2

P-Cys 0 0 0 1 3

P-Cys + P-Ser 0 1 0 1 2

P-Ser 1 0 0 0 3

P-Glu+P-Pet+P-Cys+P-Ser 1 1 1 1 0

Fig. 1. Keratinase and disulfide bond-reducing activities and

feather weight loss during the course of 72 h fermentation by

Bacillus subtilis 8 in the basal feather medium.



clearly observed in SEM images of uninoculated feathers.

Barbules and nearly all barbs were degraded by 8-16 h

(Figs. 2B-2C). Barbules were completely degraded, leaving

only the residual pinnule and feather shaft after 24 h

(Fig. 2D). Considerable degradation of feather shafts was

also observed after 32 h of incubation (Fig. 2E). The space

structure of the feather shaft began to collapse, and it also

was degraded by 40 h (Fig. 2F). The samples could not be

visualized at 48 h as the feather was completely degraded,

leaving behind no clear structure for identification by SEM.

Analysis of Amino Acids and Sulfite

Amino acids released during feather degradation by

B. subtilis 8 were analyzed from the cell-free culture

supernatant after 48 h of incubation (Table 3). During

fermentation, 17 free amino acids, including five essential

amino acids (lysine, methionine, phenylalanine, threonine,

and valine), were produced in the sample group. The

concentration of total amino acids was approximately

34.189 nmol/ml. The most abundant amino acid was

phenylalanine (16.094 nmol/ml), followed by tyrosine

(5.559 nmol/ml) and glycine (4.667 nmol/ml). Cysteic acid

(CySO3H) and large amounts of NH3 were also released

during fermentation. In the control group, amino acids were

Fig. 2. Scanning electron microscope analysis of chicken-feather degradation by Bacillus subtilis 8 in basal medium.

(A) Untreated chicken feather; (B, C) barb and barbule degradation after 8-16 h; (D) barbule degradation after 24 h; (E, F) feather shaft

degradation after 32-40 h.

Table 3. Composition and concentration of amino acids in the

cell-free supernatant of B. subtilis 8.

Amino acid Sample (nmol/ml) Control (nmol/ml)

Alanine

Arginine

Aspartic acid

Cysteine

Glutamic acid

Glycine

Isoleucine

Leucine

Lysine

Methionine

Phenylalanine

Proline

Serine

Threonine

Tyrosine

Valine

CySO3H

MetSON

Total

0.423

0.143

0.545

0.540

1.323

4.667

0.000

0.000

0.215

0.217

16.094

0.000

0.303

0.451

5.559

1.050

2.660

0.000

34.189

0.430

0.033

0.146

0.000

0.797

0.328

0.243

0.480

0.227

0.036

0.263

0.713

0.386

0.249

0.365

0.407

0.213

0.000

5.702

318 He et al.


less concentrated in the culture supernatant (5.702 nmol/ml)

and no cysteine was found at 48 h. A white precipitate

appeared after addition of BaCl2 solution, indicating the

presence of sulfite, which decolorizes KMnO4.

Purification of Enzymes and Zymography

Routine preparation of crude enzyme solution was

performed, and extracts were further purified using 25-

75% ammonium sulfate precipitation, followed by DEAE-

Sepharose Fast Flow anion-exchange column chromatography

and ultrafiltration (Fig. 3). Compared with peak 2, peak 1

showed keratinolytic activity by anion-exchange chromato-

graphy and gelatin zymography. As a result, peak 1 was

selected for the follow-up study and the retrieval rate of

enzyme activity was 34.2% with 2.2-fold purification (Table 4).

The purity was detected by SDS-PAGE followed by gelatin

zymogram activity staining (Fig. 4).

LC-MS/MS Analysis

Protein bands from SDS-PAGE were subjected to proteomic

analysis. The four primary bands were excised, digested,

and analyzed using LC-MS/MS. A peptide score equal to

or greater than the significance threshold (p < 0.05) was

considered a positive protein hit. A total of 70 proteins

Fig. 3. DEAE-Sepharose Fast Flow elution.

Elution peak 1: 0.1 M NaCl elution buffer; Peak 2: 0.3 M NaCl elution buffer; M: Purity detection by SDS-PAGE and gelatin zymography assay

(peak 1: lanes 1, 3; peak 2: lanes 2, 4).

Table 4. Purification of proteolytic enzymes from B. subtilis 8.

Purification steps Total protein (mg) Total activity (U) Specific activity (U/mg) Purification (fold) Yield (%)

Culture filtrate

Ammonium sulfate (25-75%)

DEAE-Sephacel

232

65

19

28,560

15,505

9,756

123.104

231.418

513.474

1

1.9

2.2

100

54.4

34.2

Fig. 4. Coomassie blue-stained SDS polyacrylamide gel

electrophoresis and zymogram analysis of the related

proteases secreted by Bacillus subtilis 8.

M, Marker proteins; 1, DEAE-Sepharose chromatography; 2, Gelatin

zymography (arrows indicate bands of proteolytic activity).



were identified after LC-MS/MS analysis. Based on molecular

weight, 15 proteins were selected for further classification

according to their GO annotations (Table S1). Notably, four

proteins (gamma-glutamyltransferase, peptidase T, serine

protease, and cystathionine gamma-synthase) were predicted

to be involved in feather-degradation according to GO

annotations (Table 5) [16-19].

Prokaryotic Expression

Using template DNA from B. subtilis 8, these four key

enzymes were amplified with specific primers individually

(Fig. S1), and successfully constructed and expressed in

Table 5. The four key enzymes of LC-MS/MS analyses with GO annotation.

Sequence name Seq description Length GO descriptions Enzyme descriptionsPeptides

(95%)

tr|S6FL14|S6FL

14_9BACI

Gamma-

glutamyltransferase

591 F: transferase activity, transferring acyl

groups; P: sulfur compound metabolic

process; P: cellular nitrogen compound

metabolic process

Acting on the CH-CH group of

donors; short-chain acyl-CoA

dehydrogenase

7

tr|A0A0K6LDR

2|A0A0K6LDR

2_BACAM

Peptidase T 410 C: cytoplasm; P: catabolic process;

F: ion binding; F: peptidase activity;

P: cellular nitrogen compound meta-

bolic process

Acting on peptide bonds

(peptidases); acting on peptide

bonds (peptidases); tripeptide

aminopeptidase

19

tr|A0A142FDD1

|A0A142FDD1_

BACAM

Serine protease 319 F: peptidase activity Acting on peptide bonds

(peptidases)

9

tr|S6FTM3|S6F

TM3_9BACI

Cystathionine

gamma-synthase

380 F: lyase activity; F: ion binding;

F: transferase activity, transferring alkyl

or aryl (other than methyl) group

Cystathionine gamma-synthase;

cystathionine gamma-lyase;

homocysteine desulfhydrase

21

Fig. 5. SDS-PAGE results of induced expression in E. coli BL21.

(A) P-Glu (64.3 kD); (B) P-Ser (33.9 kD); (C) P-Cys (40.7 kD); (D) P-Pet (45.6 kD).

320 He et al.


E. coli BL21. As shown in Fig. 5, the expression of P-Glu, P-

Cys, and P-Pet increased gradually with time, in striking

contrast to that of P-Ser. After 4 h induction, the amount of

expression reached the maximum, and the mycoprotein

decreased gradually with time as the target protein. The

KT activity of P-Cys measured 102.4 U/ml, the maximum

of the four enzymes (Table 6). In P-Ser fermentation,

remarkably, the KT and DRT activities were observed

respectively. Because a key step of keratin degradation was

the destruction of two sulfur bonds, P-Ser was chosen as

the material for subsequent experiments.

Hydrolysis Properties of Extracellular Proteolytic Enzymes

The effects of different protease combinations on feather

hydrolysis are shown in Table 7. The DRT activity was

improved in each combination after addition of P-Ser.

When the four proteases were mixed together, the KT

activity (228.1 U/ml) and DRT activity (27.4 U/ml) reached

the maximum, respectively. The preliminary results showed

that the four proteases played a synergistic role in the

degradation of keratin. At the same time, the degradation

of intact feather was observed with the different protease

combinations (Fig. 6). Compared with the addition of the

monohydrolase, the addition of P-Ser increased the rate of

hydrolysis of the intact feather and it began to decay, and

the medium became turbid after 4 days. The feather

hydrolysis effect was the most significant accompanied

with obvious softening and hydrolysis of the barbules. The

results showed that the hydrolysis of intact feathers by

P-Glu, P-Cys, and P-Pet was promoted by the addition of

P-Ser, whereas the synergistic reaction of the other three

proteases enhanced the hydrolysis efficiency of intact

feathers.

Discussion

B. subtilis 8 isolated from a feather disposal site has a high

keratin-degrading ability. An entire feather was degraded

within 48 h in basal culture medium. We observed that the

DRT activity quickly reached maximum values at 24 h,

followed by KT activity at 48 h. FWS took the longest to

peak, reaching a maximum value by 60 h. We speculate

Table 6. The keratinase (KT) and disulfide bond-reducing

(DRT) activities of several recombinant proteases.

Recombinant protease KT (U/ml) DRT (U/ml)

P-Ser 73.1 ± 0.64 14.1 ± 0.13

P-Glu 1.9 ± 0.03 0.1

P-Pet 58.6 ± 0.95 NO

P-Cys 102.4 ± 2.47 NO

Table 7. Determination of the enzyme activity of different

protease combinations.

Enzyme combinationsEnzymatic activity (U/ml)

DRT KT

P-Glu 0 35.5 ± 0.9

P-Glu+P-Ser 9.8 ± 0.2 77.6 ± 3.2

P-Pet 0 60.9 ± 2.9

P-Pet+P-Ser 11.2 ± 0.7 99.0 ± 1.7

P-Cys 0 96.3 ± 2.4

P-Cys+P-Ser 14.1 ± 0.3 148.6 ± 4.7

P-Ser 8.1 ± 0.2 64.9 ± 0.6

P-Glu+P-Pet+P-Cys+P-Ser 27.4 ± 1.6 228.1 ± 3.9

Fig. 6. Hydrolysis of natural feather by different combinations of proteases.



that the KT and DRT activities are acting in tandem on

feather degradation during the fermentation process,

consistent with the conclusion of Liu et al. [19].

We imaged the entire process of feather degradation via

SEM. We observed that feather degradation was the most

significant at 24 h (Fig. 2), at which time the DRT activity

also reached its maximum value (Fig. 1). High levels of

cysteic acid were detected in the fermentation broth

(Table 1). It is inferred that disulfide bonds of the cysteine

from feather keratin were broken, leading to the stable

secondary structure of feather keratin, which was then

destroyed [20]. The reaction is described as follows:

Finally, the relevant protease acted on the porous

structure of keratin so that feathers were thoroughly

degraded. Sulfite was also obtained in the fermentation

broth, indicating the presence of thiolysis [21] in the keratin

degradation by B. subtilis 8. The reaction proceeds as

follows: sulfite was secreted in some way by B. subtilis 8 to

promote the degradation of feather keratin, and feather

keratin after modification via sulfur was further hydrolyzed

by extracellular proteases. The following equation illustrates

this process:

Cys-S-S-Cys + HSO3

- → Cys-SH + Cys-S-SO3

-

In the present study, three different types of enzymes were

purified and identified from B. subtilis 8: hydrolases (peptidase

T and serine protease), a transferase (γ-glutamyltransferase),

and a lyase (cystathionine-γ-synthase). The function of

serine protease is similar to that of keratinase [18, 22], and

peptidase T could increase hydrolysis of the protein [23]. In

regard to transferases, γ-glutamyltransferase is a glycoprotein

bound to the plasma membrane that plays an important

role in the glutamyl cycle. This enzyme catalyzes the

transfer of the γ-glutamyl moiety of glutathione to a variety

of α-amino acids to generate free cysteinyl groups. These

cysteinyl groups act as strong reductants that accelerate

sulfitolysis of recalcitrant proteins, making them more

vulnerable to attack by keratinases [24, 25]. Cystathionine

γ-synthase is classified as a lyase, which catalyzes the

breakdown of carbon-sulfur bonds. It is involved in the

cysteine-met biosynthetic pathway, catalyzing pyridoxal

5’-phosphate-dependent γ-replacement, leading to the

formation of L-cystathionine from a homoserine ester and

L-cysteine that are subsequently converted to homocysteine

and finally to Met, releasing a large amount of NH3 and

H2S [26, 27]. The existence of sulfur hydrolysis and

production of NH3 (Table 1) are supported by the rotten-

egg smell in the fermentation broth. This is the first

discovery of cystathionine γ-synthase with keratin hydrolysis

activity in B. subtilis 8. However, the keratin degradation

mechanism of cystathionine γ-synthase in B. subtilis 8 has

not yet been reported.

In this study, we established a preliminary model of

keratin degradation by B. subtilis 8 by closely following the

products and related enzymes during the fermentation

process. The feather degradation process includes oxidative

reduction, sulfur hydrolysis, and enzymatic hydrolysis

(hypothesized) by B. subtilis 8, which eventually cooperate

to degrade feathers completely. First, the disulfide bonds of

feather keratin begin to be destroyed under mechanical

action, such as sterilization. Next, the stability of the

secondary feather structure is destroyed through the

interaction of oxidation, sulfite, γ-glutamyltransferase, and

cystathionine γ-synthase. Finally, the remaining loose

structure is completely degraded by peptidase T and serine

protease. This report is the first description of the mechanism

of keratin degradation by bacteria since the study by Tu

and Sun [28], which examined the biochemical mechanism

of keratin degradation by Streptomyces fradiae Var S-221Tu.

Our study helps to characterize the mechanism of keratin

degradation, and the effective biodegradation of feather

keratin by B. subtilis 8 could provide guidance for future

industrial utilization.

In this study, we found that the mechanism of keratin

degradation by B. subtilis 8 was similar to that of Streptomyces

B221, which was mainly mediated by thiolysis. Our

following experiments will take thiolysis as the research

direction and explore the generation and transformation

forms of sulfite and other sulfur-containing substances in

B. subtilis 8, in order to comprehensively analyze the

thiolysis mechanism of this B. subtilis strain.

Acknowledgments

This work was supported by the Science and Technology

Support Program of Sichuan Province (2013GZX0160). We

thank Professor Hui Chen for her critical reading of the

manuscript.

Conflict of Interest

The authors have no financial conflicts of interest to

declare.

322 He et al.


References

1. Ramnani P, Singh R, Gupta R. 2005. Keratinolytic potentialof Bacillus licheniformis RG1: structural and biochemicalmechanism of feather degradation. Can. J. Microbiol. 51: 191-196.

2. Feng J. 1995. Development and utilization of feather mealprotein feed. Feed Ind. 1995: 42-43.

3. Gradisar H, Friedrich J, Križaj I, Jerala R. 2005. Similaritiesand specificities of fungal keratinolytic proteases: comparisonof keratinases of Paecilomyces marquandii and Doratomyces

microsporus to some known proteases. Appl. Environ. Microbiol.

71: 3420-3426.4. Lopes FC, Silva LADE, Tichota DM, Daroit DJ, Velho RV,

Pereira JQ, et al. 2011. Production of proteolytic enzymes bya keratin-degrading Aspergillus niger. Enzyme Res. 2011:

487093.5. Huang Y, Busk PK, Lange L. 2015. Production and

characterization of keratinolytic proteases produced byOnygena corvina. Fungal Genom. Biol. 4: 119.

6. Ignatova Z, Gousterova A, Spassov G, Nedkov P. 1999.Isolation and partial characterisation of extracellular keratinasefrom a wool degrading thermophilic actinomycete strainThermoactinomyces candidus. Can. J. Microbiol. 45: 217-222.

7. Jayalakshmi T, Krishnamoorthy P, Ramesh G, Sivamani P.2010. Isolation and screening of a feather-degradingkeratinolytic actinomycetes from Actinomyces sp. J. Am. Sci.

6: 45-48.8. Matikevičienė V, Grigiškis S, Levišauskas D, Sirvydytė K,

Dižavičienė O, Masiliūnienė D, et al. 2013. Optimization ofkeratinase production by Actinomyces fradiae 119 and itsapplicaion in degradation of keratin containing wastes.Proceedings of the 8th International Scientific and PracticalConference. Environment Technology Resources 1: 294-300.

9. Williams CM, Richter C, Mackenzie J, Shih JC. 1990.Isolation, identification, and characterization of a feather-degrading bacterium. Appl. Environ. Microbiol. 56: 1509-1515.

10. Joshi SG, Tejashwini MM, Revati N, Sridevi R, Roma D.2007. Isolation, identification and characterization of a featherdegrading bacterium. Int. J. Poultry Sci. 6: 689-693.

11. Sudhir MR. 2016. Isolation and identification of featherdegrading bacteria from poultry farm soil and characterizationof enzyme. PhD Thesis. Narsee Monjee Institute of ManagementStudies, India.

12. Mazotto AM, Coelho RRR, Cedrola SML, De Lima MF,Couri S, De Souza EP, et al. 2011. Keratinous production bythree Bacillus spp. using feather meal and whole feather assubstrate in a submerged fermentation. Enzyme Res. 2011: 1-7.

13. Prakash P, Jayalakshmi SK, Sreeramulu K. 2010. Purificationand characterization of extreme alkaline, thermostablekeratinase, and keratin disulfide reductase produced byBacillus halodurans PPKS-2. Appl. Microbiol. Biotechnol. 87:

625-633.14. Qi Z. 2012. Research on keratin-degrading bacteria with

high disulfide bond-reducing capacity. Master degree thesis.Chinese Academy of Agricultural Sciences, Beijing, China.

15. Neilson KA, Ali NA, Muralidharan S, Mirzaei M, Mariani M,Assadourian G, et al. 2011. Less label, more free: approachesin label-free quantitative mass spectrometry. Proteomics

11: 535-553.16. Vermeij P, Kertesz MA. 1999. Pathways of assimilative

sulfur metabolism in Pseudomonas putida. J. Bacteriol. 181:

5833-5837.17. Pillai P, Archana G. 2008. Hide depilation and feather

disintegration studies with keratinolytic serine protease froma novel Bacillus subtilis isolate. Appl. Microbiol. Biotechnol. 78:

643-650.18. Tiwary E, Gupta R. 2010. Subtilisin-γ-glutamyl transpeptidase:

a novel combination as ungual enhancer for prospectivetopical application. J. Pharm. Sci. 99: 4866-4873.

19. Liu Q, Zhang T, Song N, Li Q, Wang Z, Zhang X, et al.

2014. Purification and characterization of four key enzymesfrom a feather-degrading Bacillus subtilis from the gut oftarantula Chilobrachys guangxiensis. Int. Biodeterior. Biodegradation

96: 26-32.20. Wang J, Zhu S, Xu C. 2002. Biological Chemistry, 3rd Ed.

Higher Education Press, Beijing, China.

21. Kunert J, Stransky Z. 1988. Thiosulfate production fromcystine by the keratinolytic prokaryote Streptomyces fradiae.Arch. Microbiol. 150: 600-601.

22. Suh HJ, Lee HK. 2001. Characterization of a keratinolyticserine protease from Bacillus subtilis KS-1. J. Protein Chem.

20: 165-169.23. Strauch KL, Miller CG. 1983. Isolation and characterization

Salmonella typhimurium mutants lacking a tripeptidase(peptidase T). J. Bacteriol. 154: 763-771.

24. Orlowski M, Meister A. 1970. The γ-glutamyl cycle: apossible transport system for amino acids. Proc. Natl. Acad.

Sci. USA 67: 1248-1255.25. Sharma R, Gupta R. 2012. Coupled action of γ-glutamyl

transpeptidase-glutathione and keratinase effectively degradesfeather keratin and surrogate prion protein, Sup 35NM.Bioresour. Technol. 120: 314-317.

26. Clausen T, Huber R, Prade L, Wahl MC, Messerschmidt A.1998. Crystal structure of Escherichia coli cystathionine-γ-synthase at 1.5 Å resolution. EMBO J. 17: 6827-6838.

27. Wallsgrove RM, Lea PJ, Miflin BJ. 1983. Intracellularlocalization of aspartate kinase and the enzymes ofthreonine and methionine biosynthesis in green leaves. Plant

Physiol. 71: 780-784.28. Tu G, Sun Y. 1998. Biochemical mechanism of the degradation

of keratin in Streptomyces. Acta Agric. Univ. Jiangxiensis

20: 164-169.

28(2), 314–322 Research Article Review - JMBprimarily β-keratin, azelon, and insoluble protein...

Documents

Transcript of 28(2), 314–322 Research Article Review - JMBprimarily β-keratin, azelon, and insoluble protein...