23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on...

62
23-4-2015 Dr. Amira A. AL-Hosary 1

Transcript of 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on...

Page 1: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 1

Page 2: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Interpretation of sequence results

Amira A. AL-Hosary

PhD of infectious diseases

Department of Animal Medicine

(Infectious Diseases)

Faculty of Veterinary Medicine

Assiut University

Egypt

23-4-2015 Dr. Amira A. AL-Hosary 2

Page 3: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

An overview on DNA sequencing: • DNA sequencing involves determining the

linear nucleotide order of a segment of DNA.

• There are several methods of sequencing, but most are based on the Sanger Method.

• This is an enzymatic method that synthesizes DNA in vitro.

• It use a modified PCR reaction where both normal and labeled dideoxy-nucleotides are included in the reaction mix. Each dideoxy-nucleotides were labeled with fluorescent dyes (Each nucleotide has a different color).

23-4-2015 Dr. Amira A. AL-Hosary 3

Page 4: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

• Template is single-stranded DNA that you want to sequence.

• Primer is a short fragment of DNA that binds to one end of the template DNA.

• Deoxynucleotides (dNTPs) extend the primer, forming a DNA chain. All four nucleotides (A,T,G,C in deoxynucleotide form) are added to the sequencing reaction.

• Dideoxynucleotides (ddNTPs) are another form of nucleotide that inhibit extension of the primer. Once a ddNTP has been incorporated into then DNA chain, no further nucleotides can be added.

• DNA polymerase incorporates the nucleotides and dideoxynucleotides into the growing DNA chain.

• Buffer is a solution that stabilizes the reagents and products in the sequencing reaction.

An overview on DNA sequencing:

23-4-2015 Dr. Amira A. AL-Hosary 4

Page 5: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

At the end of the sequencing reaction,

Using a polyacrylamide gel (either a big thin slab

gel or a narrow capillary tube filled with gel

solution) that is scanned with a laser detection

device.

As each band moves past a viewer, the laser

excites the dye, and the color of fluorescence is

read by a photocell and recorded on a computer.

An overview on DNA sequencing:

23-4-2015 Dr. Amira A. AL-Hosary 5

Page 6: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Manual reading Vs. Automated reading of the Sequencing results:

The products of the sequence are loaded in four parallel

lanes on a gel.

A computer collects and analyzes this data, reading the sequence of the DNA. Thus automated sequencing is much faster and more efficient then manual sequencing. 23-4-2015 Dr. Amira A. AL-Hosary 6

Page 7: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

An overview on DNA sequencing:

23-4-2015 Dr. Amira A. AL-Hosary 7

Page 8: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Sequencer Ion Torrent

PGM 454 GS FLX HiSeq 2000 SOLiDv4 PacBio Sanger 3730xl

Manufacturer Ion Torrent (Life

Technologies)

454 Life Sciences

(Roche) Illumina

Applied

Biosystems (Life

Technologies)

Pacific Biosciences

Applied

Biosystems (Life

Technologies)

Amplification

approach Emulsion PCR Emulsion PCR

Bridge

amplification Emulsion PCR

Single-molecule;

no amplification PCR

Data output per run 100-200 Mb 0.7 Gb 600 Gb 120 Gb 100-700 Mb 1.9∼84 Kb

Accuracy 99% 99.9% 99.9% 99.94% 88.0% (>99.9%

CCS) 99.999%

Time per run 2 hours 24 hours 3–10 days 7–14 days 2-3 hours 20 minutes - 3

hours

Read length 200-400 bp 700 bp 100x100 bp paired

end

50x50 bp paired

end 5,500-10,000 bp 400-900 bp

Cost per run $350 USD $7,000 USD $6,000 USD (30x

human genome) $4,000 USD $125-300 USD

$4 USD (single

read/reaction)

Cost per Mb $1.00 USD $10 USD $0.07 USD $0.13 USD $0.20 - $3.00 USD $2400 USD

Cost per instrument $80,000 USD $500,000 USD $690,000 USD $495,000 USD $695,000 USD $95,000 USD

23-4-2015 Dr. Amira A. AL-Hosary 8

Page 9: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

1- The Band:

23-4-2015 Dr. Amira A. AL-Hosary 9

Page 10: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Interpreting Sequencing Results

Automated DNA Sequencers generate

1- A four-color chromatogram showing the results of the sequencing run.

2- In addition to a text file of sequence data.

23-4-2015 Dr. Amira A. AL-Hosary 10

Page 11: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

• When you obtain a sequence you should proofread it to ensure that all ambiguous sites are correctly called and determine the overall quality of your data.

• Base Designations

• “A” designation—green peaks

• “G” designation—black peaks

• “T” designation—red peaks

• “C” designation—blue peaks

• “N” designation—peaks that,

for whatever reason, are not clear enough to designate as A, G, T, or C.

Interpreting Sequencing Results

23-4-2015 Dr. Amira A. AL-Hosary 11

Page 12: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Interpreting Sequencing Chromatograms

Good sequence generally begins roughly around base 20.

Beginning of Sequence

End of sequence

23-4-2015 Dr. Amira A. AL-Hosary 12

Page 13: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

With a little practice, you can scan a chromatogram in less than a minute and spot problems.

It is not necessary to read each and every base.

Interpreting Sequencing Chromatograms

An example of excellent sequence. Note the evenly-spaced peaks and the lack of baseline 'noise'

23-4-2015 Dr. Amira A. AL-Hosary 13

Page 14: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Background noise

This example has a little baseline noise, but the 'real' peaks are still easy to call, so there's no problem with this sample.

Interpreting Sequencing Chromatograms

23-4-2015 Dr. Amira A. AL-Hosary 14

Page 15: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Interpreting Sequencing Chromatograms

Noise like the above most commonly arises when the sample itself is too dim, Contamination with salts or inefficient primer binding .

23-4-2015 Dr. Amira A. AL-Hosary 15

Page 16: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Types of Polymorphisms 1- Transitions: A G or C T

(purines to purines OR pyrimidines to pyrimidines)

2-Insertions: an extra base is present when compared to the Anderson reference sequence.

3- Deletions: a base is missing when compared to the Anderson reference sequence.

4- Mis-Called (a) Irregular spacing:

Common one for us is a G-A

dinucleotide, which leaves a little

extra space between them.

23-4-2015 Dr. Amira A. AL-Hosary 16

Page 17: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

4- Mis-Called (b) Mis-call a nucleotide:

Sometimes the computer will mis-call a nucleotide when a human could do better.

Most often, this occurs when the base caller calls a specific nucleotide, when the peak really was

ambiguous and should have been called as 'N'.

23-4-2015 Dr. Amira A. AL-Hosary 17

Page 18: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

4- Mis-Called (b) Mis-call a nucleotide:

23-4-2015 Dr. Amira A. AL-Hosary 18

Page 19: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

4- Mis-Called (b) The real problem comes when the base caller attempts to interpret a gap as a real nucleotide. Note the real T peak (nt 58) and the real C peak (nt 60), with the G barely visible between them. Despite it size, the baseline-noise G peak was picked as if it were real. The clues to spot are (i) the oddly-spaced letters, with the G squeezed in, and (ii) the gap in the 'real' peaks, containing a low noise peak. This is a great example of why a weak sample, with its consequent noisy chromatogram, is untrustworthy.

23-4-2015 Dr. Amira A. AL-Hosary 19

Page 20: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

5- Heterozygous (double) peaks:

A single peak position within a trace may have but two peaks of different colors instead of just one. This is common when sequencing a PCR product derived from diploid genomic DNA, where polymorphic positions will show both nucleotides simultaneously. Note that the base caller may list that base position as an 'N', or it may simply call the larger of the two peaks.

Here's a great example of a PCR

amplicon from genomic DNA,

with a clear heterozygous

single-nucleotide polymorphism

(SNP).

23-4-2015 Dr. Amira A. AL-Hosary 20

Page 21: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

6- Loss of resolution later in the gel:

As the gel progresses, it loses resolution. This is normal; peaks broaden and shift, making it harder to make them out and call the bases accurately. The sequencer will continue attempting to "read" this data, but errors become more and more frequent.

This is a typical example of data from a very good sample

the spacing between the basecall letters at top is regular, which is often a good indication of the reliability of the data.

23-4-2015 Dr. Amira A. AL-Hosary 21

Page 22: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

There are only a few base calls that can be considered reliable. The G at 981 may in fact be two G's, the N could be a G or an A, and who knows how many A's there are afterwards.

23-4-2015 Dr. Amira A. AL-Hosary 22

Page 23: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

7- Non-discrete peaks:

These may occur when several of the same nucleotide appears in a row.

For example, if the sequence includes the region TAAAAAT, it may be represented by one wavy peak as opposed to 5 distinct peaks.

23-4-2015 Dr. Amira A. AL-Hosary 23

Page 24: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

8- Good sequence with bad base calling:

Failed analysis, Ask the Sequencing Service to reanalyze the sequence.

23-4-2015 Dr. Amira A. AL-Hosary 24

Page 25: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

9- Abrupt Truncation: DNA template has a secondary structure:

Secondary structures create a distortion that makes it impossible for elongation to continue and so the sequence ends abruptly.

The sequence ends after approximately 200 bp 23-4-2015 Dr. Amira A. AL-Hosary 25

Page 26: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

10- Gradual truncation: Due to too much DNA

• So please quantitate your template DNA carefully, and use the recommended concentrations according to your work.

23-4-2015 Dr. Amira A. AL-Hosary 26

Page 27: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

11- Repetitive regions:

• The nucleotide composition, as well as the size, of a repetitive region can play a large role in the success of sequencing through such an area.

• In general, G-C and G-T (often seen in bisulfite-treated DNA) repeats tend to be the most troublesome, though the newest version of Applied Biosystems BigDye Terminator v3.1 contains some modifications that have allowed for some striking improvements in certain previously difficult templates.

23-4-2015 Dr. Amira A. AL-Hosary 27

Page 28: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Methylation-specific PCR (MSP)

MSP used in quantitative PCR provides quantitative information about the methylation state of a given C p G island.

23-4-2015 Dr. Amira A. AL-Hosary 28

Page 29: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

12- Negative samples / No DNA—chromatograms displaying peaks from which no useable sequence can be obtained may be due to an absence of DNA. These chromatograms generally have one or two predominant colors.

23-4-2015 Dr. Amira A. AL-Hosary 29

Page 30: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

13- DNA contamination:

23-4-2015 Dr. Amira A. AL-Hosary 30

Page 31: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Cause related to sequencing: Poor removal of unincorporated dye terminators during the post-sequencing clean up

14- Excess dye peaks at the beginning of the sequence

23-4-2015 Dr. Amira A. AL-Hosary 31

Page 32: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

15- Sharp peaks / spikes in the sequence

They are caused by tiny air bubbles within the liquid polymer or by small pieces of dried polymer that have flaked off and entered a capillary. 23-4-2015 Dr. Amira A. AL-Hosary 32

Page 33: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

16- Dye blobs:

Dye blobs are unincorporated dye terminator molecules that have passed through the cleanup columns and remain in solution with the purified DNA loaded into the sequencers. They are most often seen with samples that have low signal strength. 23-4-2015 Dr. Amira A. AL-Hosary 33

Page 34: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

17- Reaction failed, No sequencing data

23-4-2015 Dr. Amira A. AL-Hosary 34

Page 35: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Realize, too, that it's easy for a human to miss these. If you want to be sure you've

detected all of the polymorphic positions, you should be using a computer program

to scan your chromatograms

23-4-2015 Dr. Amira A. AL-Hosary 35

Page 36: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Interpreting of Sequencing Results

23-4-2015 Dr. Amira A. AL-Hosary 36

Page 37: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Determining homology:

In other words, is your sequence similar to any other published sequences and if so, to what degree?

This can be accomplished using BLAST, (Basic Local Alignment Search Tool): This program supported by the National Center for Biotechnology Information (NCBI).

The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. This program is accessible at: http://www.ncbi.nlm.nih.gov/BLAST/ (GenBank database; National Center for Biotechnology Information, National Institutes of health).

Interpreting of Sequencing Results

23-4-2015 Dr. Amira A. AL-Hosary 37

Page 38: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 38

Page 39: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

BLAST: Basic Local Alignment Search Tool blast.ncbi.nlm.nih.gov/

The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares

nucleotide or protein sequences to ... Nucleotide BLAST - Protein BLAST: ***search ... - Align two or more

sequences - Rat Nucleotide BLAST: Search nucleotide databases using a nucleotide ...

blast.ncbi.nlm.nih.gov/Blast.cgi?...blastn...BlastSearch... No BLAST database contains all the sequences at NCBI. BLAST

databases ... BLAST - Wikipedia, the free encyclopedia

en.wikipedia.org/wiki/BLAST In bioinformatics, Basic Local Alignment Search Tool, or BLAST, is an algorithm for comparing primary biological sequence

information, such as the amino-acid ... Background - Input - Output - Process

23-4-2015 Dr. Amira A. AL-Hosary 39

Page 40: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 40

Page 41: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Click the “Blast!” button at the bottom to submit your sequence data. 23-4-2015 Dr. Amira A. AL-Hosary 41

Page 42: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

This screen will come up next. Finally (sometimes after a lengthy wait), a new window will appear showing any “hits” your sequence made. The results will be color coded and annotated

23-4-2015 Dr. Amira A. AL-Hosary 42

Page 43: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

The bars show what places along your sequence are similar to other published sequences; the colors indicate how many bases were involved in homology determination.

23-4-2015 Dr. Amira A. AL-Hosary 43

Page 44: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Clicking on a “gi” link at the beginning of any line will take you to the GenBank accession page for a sequence showing similarity to yours. There you can find a wealth of information about the published sequence to which yours showed some homology. 23-4-2015 Dr. Amira A. AL-Hosary 44

Page 45: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 45

Page 46: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

INTERPRETATION OF SEQUENCES WHICH CODING FOR PROTEIN

23-4-2015 Dr. Amira A. AL-Hosary 46

Page 47: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Translation and Open Reading Frame Search Regions of DNA that encode proteins are first transcribed into messenger RNA and then translated into protein.

By examining the DNA sequence alone we can determine the sequence of amino acids that will appear in the final protein.

In translation codons of three nucleotides determine which amino acid will be added next in the growing protein chain.

It is important then to decide which nucleotide to start translation, and when to stop, this is called an open reading frame.

23-4-2015 Dr. Amira A. AL-Hosary 47

Page 48: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Once a gene has been sequenced it is important to determine the correct open reading frame (ORF).

Every region of DNA has six possible reading frames, three in each direction.

The reading frame that is used determines which amino acids will be encoded by a gene.

Typically only one reading frame is used in translating a gene and this is often the longest open reading frame.

Once the open reading frame is known the DNA sequence can be translated into its corresponding amino acid sequence. An open reading frame starts with an ATG (Met) in most species and ends with a stop codon (TAA, TAG or TGA). 23-4-2015 Dr. Amira A. AL-Hosary 48

Page 49: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

For example,

the following sequence of DNA can be read in six reading frames.

Three in the forward and three in the reverse direction.

The three reading frames in the forward direction are shown with the translated amino acids below each DNA seqeunce.

Frame 1 starts with the "a", Frame 2 with the "t" and Frame 3 with the "g". Stop codons are indicated by an "*" in the protein sequence.

23-4-2015 Dr. Amira A. AL-Hosary 49

Page 50: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

5' 3' atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa

1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa

M P K L N S V E G F S S F E D D V *

2 tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat

C P S * I A * R G F H H L R T M Y

3 gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata

A Q A E * R R G V F I I * G R C I

23-4-2015 Dr. Amira A. AL-Hosary 50

Page 51: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 51

Page 52: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Translation: Each sequence must be translate to its amino acids (aa) by using

Expasy.translatesoftware

23-4-2015 Dr. Amira A. AL-Hosary 52

Page 53: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 53

Page 54: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 54

Page 55: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 55

Page 56: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 56

Page 57: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

BLAST: Basic Local Alignment Search Tool blast.ncbi.nlm.nih.gov/

The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares

nucleotide or protein sequences to ... Nucleotide BLAST - Protein BLAST: ***search ... - Align two or more

sequences - Rat Nucleotide BLAST: Search nucleotide databases using a nucleotide ...

blast.ncbi.nlm.nih.gov/Blast.cgi?...blastn...BlastSearch... No BLAST database contains all the sequences at NCBI. BLAST

databases ... BLAST - Wikipedia, the free encyclopedia

en.wikipedia.org/wiki/BLAST In bioinformatics, Basic Local Alignment Search Tool, or BLAST, is an algorithm for comparing primary biological sequence

information, such as the amino-acid ... Background - Input - Output - Process

23-4-2015 Dr. Amira A. AL-Hosary 57

Page 58: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 58

Page 59: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 59

Page 60: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

The bars show what places along your aa are similar to other published; the colors indicate how many bases were involved in homology determination.

23-4-2015 Dr. Amira A. AL-Hosary 60

Page 61: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

23-4-2015 Dr. Amira A. AL-Hosary 61

Page 62: 23-4-2015 Dr. Amira A. AL-Hosary 1 - Assiut University Bioinformatics22.23-… · An overview on DNA sequencing: • DNA sequencing involves determining the linear nucleotide order

Thanks a lot with my Best Regards and My Best wishes

Amira A. AL-Hosary E-mail: Amiraelhosary @yahoo.com

Mob. (002) 01004477501

23-4-2015 Dr. Amira A. AL-Hosary 62