Abstract Listeria monocytogenes is an ubiquitous

gram-positive, opportunistic food-borne human and

animal pathogen. To date, five L. monocytogenes au-

tolysins have been characterized: p60, p45, Ami, MurA

and Auto and the preliminary results of our studies

show that FlaA, a flagellar protein of L. monocytoge-

nes, also has murein-degrading activity. In this study, a

gene coding a 144 kDa protein (Lmo0327) with murein

hydrolase activity was identified from a lambda Zap

expression library of L. monocytogenes EGD genomic

DNA, using a direct screening protocol involving the

plating of infected Escherichia coli XL1-blue MRF¢cells onto medium containing Bacillus subtilis murein,

a substrate for autolytic proteins. Protein Lmo0327 has

a signal sequence, a N-terminal LRR domain and a

C-terminal wall-anchoring LPXTG motif. In order to

examine the roles of this enzyme and the putative

transcription regulator coded by gene lmo0326 located

upstream of lmo0327, both structural genes were in-

sertionally inactivated by site-specific integration of a

temperature-sensitive plasmid. We show that Lmo0327

is a surface protein covalently linked to murein and

that the putative transcription regulator Lmo0326 can

be assumed to positively regulate the expression of

gene lmo0327. The enzyme, which we have shown to

have murein-hydrolysing activity, plays a role in cell

separation and murein turnover.

Keywords Listeria monocytogenes Æ Murein ÆMuramidases Æ Autolysin

Abbreviations

DEPC Diethylpyrocarbonate

EDTA Ethylenediaminetetraacetic acid

HPLC High pressure liquid chromatography

IPTG Isopropyl-beta-D-

thiogalactopyranoside

PMSF Phenylmethylsulfonylfluoride

SDS Sodium dodecyl sulfate

SDS-PAGE Sodium dodecyl sulfate polyacrylamide

gel electrophoresis

Introduction

Bacterial murein hydrolases, also referred to as auto-

lysins, are present in all bacteria synthesizing cell wall

murein (Ghuysen et al. 1969). The possibility that au-

tolysins are involved in selective hydrolysis of bonds in

murein has led to suggest that they are involved in

numerous cellular processes including cell growth, cell-

wall turnover, murein maturation, cell division, sepa-

ration, differentiation and pathogenicity (Berry et al.

1992, Shockman and Holtje 1994; Blackman et al.

1998).

The development of renaturing SDS-PAGE and the

construction of mutants inactivated in specific struc-

tural genes have allowed the description of the auto-

lytic complement of several bacteria. Analysis of the

Bacillus subtilis genome has revealed the presence of

more than 30 potential murein hydrolases (Smith et al.

M. Popowska (&) Æ Z. MarkiewiczDepartment of General Microbiology,Institute of Microbiology, Warsaw University,Miecznikowa 1, 02-096 Warsaw, Polande-mail: magdapop@biol.uw.edu.pl

Arch Microbiol (2006) 186:69–86

DOI 10.1007/s00203-006-0122-8

123

ORIGINAL PAPER

Characterization of Listeria monocytogenes protein Lmo0327with murein hydrolase activity

Magdalena Popowska Æ Zdzislaw Markiewicz

Received: 1 February 2006 / Revised: 24 April 2006 / Accepted: 11 May 2006 / Published online: 9 June 2006� Springer-Verlag 2006

2000) whereas zymographic analysis for Staphylococ-

cus aureus has revealed at least 20 lytic bands, although

>97% of the profile is due to processed forms of the

major bifunctional autolysin, Atl (Foster 1995; Oshida

et al. 1995).

Listeria monocytogenes is an ubiquitous, opportu-

nistic pathogen, which causes relatively infrequent but

often very serious food-borne infections in humans and

animals (Southwick and Purich 1996; Farber 1991;

Schlech 2000; Hof 2004). The infections are particularly

severe for newborns and immunocompromised indi-

viduals. L. monocytogenes has received much attention

and an impressive amount of data accumulated in recent

years has made this bacterium one of the best charac-

terized intracellular pathogens. L. monocytogenes in-

duces its own uptake into non-phagocytic mammalian

cells and then moves within the cells and spreads from

one cell to another by virtue of actin-based motility

(Portnoy et al. 1992; Cossart 1998, 2001; Braun and

Cossart 2000). Each step of the infection process is

dependent upon the production of virulence factors,

including InlA and InlB for entry, listeriolysin O (LLO)

and phospholipase (PI-PLC and Pc-PLC) for escape

from the primary and secondary vacuoles and ActA for

intra and intercellular movements. Expression of these

virulence factors is controlled by the pleiotropic tran-

scriptional activator PrfA (Vazquez-Boland et al. 2001).

The nature of the molecular association of some of these

proteins with the cell surface of L. monocytogenes has

also been elucidated in some detail (Lebrun et al. 1996).

The complete genome sequence of L. monocytogenes

strain EGD-e and of the non-pathogenic species L. in-

nocua (Glaser et al. 2001; Chakraborty et al. 2000) re-

vealed a large number of surface proteins (Cabanes

et al. 2002), including surface-bound autolytic enzymes.

To date, five L. monocytogenes autolysins have been

identified: p60 (syn. CwhA), p45, Ami, MurA and Auto

(Kuhn and Goebel 1989; Bubert et al. 1992; McLaugh-

lan and Foster 1997, 1998; Schubert et al. 2000; Park

et al. 2000; Milohanic et al. 2001; Lenz et al. 2003; Car-

roll et al. 2003; Pilgrim et al. 2003a, b; Cabanes et al.

2004). We have recently identified a putative sixth lis-

terial murein-degrading enzyme, which has been iden-

tified as FlaA, a flagellar protein of L. monocytogenes

(Popowska and Markiewicz 2004).

Analysis of the L. monocytogenes genome reveals

the presence of 11 proteins with murein hydrolysis

domain, thus possibly several autolysins are still

unidentified. In this study, we have used a direct

screening method for the isolation of autolysin-coding

genes. We describe the cloning and sequencing of a

gene coding a surface protein of L. monocytogenes that

functions as an autolysin. Sequence comparison with

the complete genome sequence of L. monocytogenes

strain EGD revealed 100% homology to the internalin-

like protein Lmo0327. This protein represents a new

class of Gram-positive protein with murein lytic

activity that has two characteristic features: an N-ter-

minal LRR domain and C-terminal LPXTG motif.

Materials and methods

Bacterial strains, plasmids, primers, and growth

conditions

Listeria monocytogenes strains were grown in Tryptic

Soy Broth (TSB; Oxoid) at 37�C with constant shaking

(150 r.p.m.) unless otherwise stated, or on TSB plates

(1%, w/v agar). E. coli XLOLR and XL-1 Blue MRF’

were grown in Luria-Bertani broth [LBL or LB agar

(1%, w/v) at 37�C]. Ampicillin or kanamycin (100 lg/

ml) and erythromycin (300 lg/ml for E. coli and

1–5 lg/ml for L. monocytogenes) were added to broth

or agar as needed. When necessary, 0.1 mM IPTG

(isopropyl-b-D-thiogalactopyranoside) and X-Gal

(5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside)

(20 lg/ml) were spread on agar plates 30 min prior to

plating. Bacterial strains, plasmids and primers used in

this study are shown in Tables 1, 2, 3.

Preparations for electron microscopy

Bacterial cells from log phase of culture were collected

on Millipore HA filter. The cells were fixed for 30 min

in 4% paraformaldehyde, washed three times in PBS

buffer, pH 7.4, then dehydrated using a series of 15 min

incubations in 25, 50, 75 and 100% ethanol. The

preparations were coated with gold and viewed in LEO

1430VP scanning microscope.

DNA isolation and manipulations

Standard protocols were used for recombinant DNA

techniques (Sambrook et al. 2001). DNA fragment

used in the cloning procedures and PCR products were

isolated from agarose gels with the DNA Gel-Out

extraction kit (A&A Biotechnology) according to the

manufacturer’s instructions. Plasmid DNA from E. coli

was isolated and purified with the Plasmid Miniprep

Plus kit (A&A Biotechnology). The procedures for the

isolation of plasmid and chromosomal DNA from

L. monocytogenes were performed as previously

described (McLaughlan and Foster 1998), starting with

digestion of the bacterial cell wall in 5–10 mg/ml

lysozyme-containing GTE buffer for 1 h at 37�C.

70 Arch Microbiol (2006) 186:69–86

123

RT-PCR

RNA was isolated as described elsewhere (De Paula

et al. 2001). Isolated RNA, in DEPC-treated water,

was incubated with buffer for DNase I and 5 U of

DNase I (RNase free) at room temperature for 15 min.

To stop the reaction, EDTA made up in DEPC-treated

water was added to final concentration 1 mM and

incubated for 10 min at 60�C. cDNA was synthesized

from 2 ll of RNA using RevertAidTM H Minus First

Strand cDNA Synthesis Kit (Fermentas) using se-

quence-specific primer. Aliquots (2 ll) of the resulting

cDNA were amplified by PCR with specific primers

(Table 3) and Taq polymerase and samples were taken

and run on agarose gels. In the case of mutant MP1, the

template used to demonstrate the presence of tran-

script for the gene upstream—lmo0326—was cDNA

formed with the use of RTA primer, for the gene

downstream—lmo0328—cDNA formed with the use of

Orf2A primer. For mutant MP2, the template used to

demonstrate the presence of the transcript for the gene

upstream—lmo0325—was cDNA formed using RT1

primer, for the gene downstream—lmo0327—cDNA

formed using Orf3A primer (Fig. 3a). Reverse trans-

criptase-PCR products were electrophoresed in 2%

agarose gel.

Table 1 Strains used in this study

Strain Genotype, description Reference or source

Listeria monocytogenes EGD Wild type Wuenscher et al. (1993)Escherichia coli XL-1 Blue MRF’ D(mrcA) 183 D(mrcCB-hsdSMR-mrr)173

supE44 recA1 endA1 gyrA96 thi-1 relA1 lacF’[proAB+lac1q lacZDM15 Tn10 Tetr

Stratagene

Escherichia coli XLOLR D(mrcA) 183 D(mrcCB-hsdSMR-mrr)173 endA1thi-1 recA1 relA1 lac [proAB+lac1q lacZDM15Tn10 Tetr

Stratagene

Escherichia coli TG1 F’ [traD36 proAB+ lacIq lacZDM15] supE44hsdD5 D(lac– proAB)

Collection of the Institute ofMicrobiology, Warsaw University

Escherichia coli DH5a F– F80d lacZDM15 (lacZY A-orgF) U169 deoRrecA1 endA1 hsdR17 phoA supE44 k– thi-1gyrA96 relA1

Collection of the Institute ofMicrobiology, Warsaw University

Bacillus subtilis Wild type Collection of the Institute ofMicrobiology, Warsaw University

Micrococcus luteus Wild type Collection of the Institute ofMicrobiology, Warsaw University

Table 2 Plasmids used and constructed in this study

Plasmids Marker Genotype, description Reference or source

pBK-CMV Kmr 4.5 kb; ori ColE1, MCS, LacZa StratagenepBGS18 Kmr 3.7 kb; ori ColE1, MCS, LacZa Spratt et al. (1986)pGem Apr 3.0 kb; ori ColE1, MCS, LacZa PromegaZAP Express wektor Dcl, Datt, Dint, Dxis, DKH54, Dnin5, red–gam+, bio StratagenepAUL-A Eryr 9.2 kb; ori z pMB9, MCS, LacZa thermosensitive replicon

from pE194Chakraborty et al. (1992)

pAUL-A::lmo0327 Eryr 9.7 kb; 0.5 kb fragment of gene lmo0327 from pMPZ6,cloned into the BamHI/EcoRI (MCS) site in pAULA

This work

pAUL-A::lmo0326 Eryr 9.7 kb; 0.5 kb, amplified by PCR, fragment of genelmo0326 cloned into the EcoRI (MCS) site in pAULA

This work

pMPZ6 Kmr 9.0 kb; 4.5 kb of Sau3A-Sau3A fragment of L. monocyt-ogenes DNA cloned into the BamHI (MCS) site of pBK-CMV

This work

pMPZ6/A Kmr 9.0 kb; 4.5 kb insert cloned in transverse orientation withregard to Plac

This work

pMPZ6/1 Kmr PMPZ6 with deletion of XhoI restriction site This workpMPZ6/2 Kmr PMPZ6 with deletion of ClaI restriction site This workpMPZ6/3 Kmr PMPZ6 with deletion of terminal 0.7 kb ClaI/ClaI site This workpMPZ6/4 Kmr PMPZ6 (3.2 kb) with deletion of initial 1,258 kb SmaI/

AccI siteThis work

MCS multiple cloning site

Arch Microbiol (2006) 186:69–86 71

123

Identification of lytic enzyme structural gene

A k ZAP Express library of 2–10 kb L. monocytogenes

EGD chromosomal DNA, partially digested with

Sau3AI, was constructed according to the manufac-

turer’s instructions (Stratagene), in BamHI-cut and

dephosphorylated vector. A total of 1·105 independent

insert-containing clones were produced and the library

amplified once. The library was screened for lytic

enzyme-producing clones by the plate assay, described

previously, using bacterial cell walls as the substrate

(Foster 1992). Lytic-enzyme-producing clones were

identified by a zone of clearing in the opaque wall

background and were picked and purified by further

rounds of plate screening. Purified clones were treated

to excise the phagemid (pBK-CMV) containing the

L. monocytogenes DNA inserts, according to the

manufacturer’s protocol (Stratagene), and clones were

checked for recombinant lytic activity by a plate test.

DNA was isolated from these clones and characterized

by restriction analysis.

Molecular analysis of the lytic enzyme clones

Several clones were prepared using restriction enzymes

based on the restriction map of the DNA insert and

used for sequencing. Synthetic oligonucleotide frag-

ments based on DNA sequence generated during this

work, or vector sequences, were used as primers.

Putative open reading frames were examined using the

Clone (Sci Ed Sofware) program and deduced amino

acid sequences were compared to the NCBI Entrez

protein databases by BLAST searches (http://

www.ncbi.nlm.nih.gov/BLAST/). Possible transcription

promoters were found using BDGP search tool (http://

www.fruitfly.org/seq_tools/promoter).

Mutational analysis of pMPZ6

To carry out mutational analysis, several derivatives of

plasmid pMPZ6 were constructed, pMPZ6/1-2 (Ta-

ble 2), in each of which a single gene was inactivated.

Mutations were introduced by digesting the plasmid (at

a unique site) with a restriction enzyme, removing the

single-stranded ends formed and ligating the obtained

linear fragments. Since the change (introduced in the

beginning region of each gene) embraced an 8 bp

segment, mutants with altered reading frame and

consequently not producing a given protein, were ob-

tained. Also, a deletion mutant lacking the terminal

700 bp fragment of ORF1–pMPZ6/3 and a second one

lacking the initial 1,258 bp fragment of pMPZ6 insert–

pMPZ6/4, were constructed (Table 2).

Preparation of fractions containing recombinant

enzyme

For biochemical analysis, 4 l cultures of E. coli con-

taining pMPZ6 were grown in the presence of IPTG

(1 mM), to OD600 1.5 after inoculation with 0.01·vol.

overnight culture. The cells were harvested by centri-

fugation (11,000g, 4�C, 10 min) and broken by soni-

cation in 40 ml 50 mM Tris/HCl (pH 7.5), 200 mM

NaCl, 0.5 mM PMSF at 4�C. After removal of debris

by centrifugation (100,000g, 4�C, 2 h), the supernatant

was dialyzed overnight against 100 volumes of 20 mM

potassium phosphate buffer (pH 7.4) at 4�C. The

dialysate was then centrifuged (100,000g; 4�C, 2 h) and

the pellet was resuspended in 20 mM Tris/HCl (pH

7.5) containing 200 mM NaCl, stored at –20�C and

used directly as the enzyme source (McLaughlan and

Foster 1998).

Assay for autolytic activity

Lytic activity of the enzyme extract was determined

spectrophotometrically as the ability of the extract to

decrease the optical density of a cell wall suspension.

Unless stated otherwise, the reaction contained 1 ml

20 mM Tris/HCl (pH 7.5), 200 mM NaCl and purified

cell walls to a final OD450 of 0.3 (Foster 1991).

Insertional inactivation of the autolysin-encoding

gene

Either (a) 530 bp fragment of gene lmo0326, or (b)

557 bp fragment of gene lmo0327, was cloned into

vector pAUL-A (Emr) (Schaferkordt and Chakraborty

1995). The fragments were amplified from chro-

mosomal DNA of strain EGD by PCR using the

Table 3 Primers used and constructed in this study

Primers Sequence

Orf1L 5¢AAGAAACTAATTGCCAACTGACACT3¢Orf1R 5¢CGGTGTTTTAATCTACGTTATGCTT3¢Orf2L 5¢TTATGGTGAGCTGATTCGGC3¢Orf2R 5¢CGGTATCTATCCAGCGTGTT3¢Orf2A 5¢AATACTAGCCAGCGCCGATT3¢Orf3L 5¢TTGGATTGATTTCGTCGAGCTATC3¢Orf3R 5¢CCACTTCGCCTTCTTTCATCCA3¢Orf3A 5¢TTGCCGAATCAGCTCACCAT3¢RTA 5¢TCCACTTCATCCGCTATGCA3¢RTB 5¢TCTTCCATTCGTGCTTGCTG3¢RTC 5¢GCAACAAGTAGGCAAGTGCA3¢RT1 5¢AGGCACTGAAGATATCGTCC3¢RT2 5¢TCGCTCTCGTCTTACCAGTT3¢RT3 5¢GAATTGTGCGGTGGAGAGAA3¢

72 Arch Microbiol (2006) 186:69–86

123

respective starters: orf2L and orf2R or orf1L and orf1R

(Table 3) and Taq polymerase. The amplified frag-

ments were then initially cloned into vector pGEM-T

Easy (Promega). In effect, two recombined plasmids

pGEM2 and pGEM1 (carrying fragments of genes

lmo0326 and lmo0327, respectively) were obtained.

Plasmids pGEM2 and pGEM1 were digested with

EcoRI, and the inserts isolated from agarose gel were

ligated into pAUL-A (pre-digested with EcoRI). The

correctness of the constructs, named pAUL-

A::lmo0326 and pAULA::lmo0327, respectively, was

confirmed by restriction analysis.

The obtained plasmids were introduced into

L. monocytogenes cells by electroporation at 30�C.

Since L. monocytogenes contains a thick cell wall

containing teichoic acids linked to murein, electro-

competent cells were prepared in the presence of

penicillin, as described by Park and Stewart (1990).

Following electrotransformation, colonies of L. mon-

ocytogenes EGD resistant to erythromycin 1 lg ml–1

(plasmid marker) were obtained. Transformants were

grown in TSB broth containing 1 lg erythromycin per

ml at 30�C for 12 h. The culture was diluted 1/100 into

fresh TSB containing erythromycin (2 lg ml–1) at

42�C. Overnight cultures of the obtained clones were

spread on plates containing erythromycin and incu-

bated at 42�C for 12 h. Consequently, single clones

(not containing autonomous form of plasmid) were

obtained, in which as a result of homologous recom-

bination (single ‘‘crossing-over’’) the plasmid was

incorporated into a specific site on the chromosome.

The site-specific insertion of the plasmid into the

chromosome (presence of pAUL-A::lmo0326 or

pAULA::lmo0327 in the chromosome of the L. mon-

ocytogenes mutants) was confirmed by PCR and by

hybridization (results not shown).

Extraction of surface-associated autolytic enzymes

Cells of L. monocytogenes were harvested by centri-

fugation, washed in saline and resuspended in an

ice-cold solution containing 4 M LiCl and 0.5 mM

phenylmethylsulfonylfluoride (PMSF) in 50 mM Tris-

HCl buffer, pH 7.0. The suspension was stirred for

30 min with the use of a magnetic bar in an ice bath,

after which the cells were harvested (20,000g, 10 min at

4�C). The supernatant was transferred to dialysis tub-

ing with cutoff value 3,500 (Spectrum) and dialyzed for

12 h at 4�C against 50 mM Tris–HCl, pH 7.0 containing

100 mM LiCl, with several changes of the buffer.

Alternatively, cells of L. monocytogenes were ex-

tracted with 1% (v/v) SDS at room temperature for

5 min, after which the cells were harvested (20,000g,

10 min at 4�C). The supernatant was analyzed on 12%

SDS-polyacrylamide gel and renaturing gel.

Isolation of cell wall

L. monocytogenes or B. subtilis cells were harvested by

centrifugation as above and resuspended in 1/40 of the

original culture volume of ice-cold saline. Glass beads

(diameter 150–215 lm; Sigma) were added (1 g per

1 ml cell suspension) and ten 1 min bursts of ultra-

sound waves were employed in VCX-600 ultrasonica-

tor (Sonics and Materials, USA) at amplitude 20%.

The crude cell wall preparation was sedimented by

centrifugation in a Beckman centrifuge (25 min,

100,000g at 4�C). Depending on the nature of the

experiments, the cells were either washed in appro-

priate buffer and then resuspended in it, or treated

with 1% SDS (final concentration).

Zymographic analysis in SDS-polyacrylamide gels

Samples containing murein hydrolases were prepared

and analysed by renaturing gel electrophoresis as

described elsewhere (Foster 1992) using 12% (w/v)

SDS-polyacrylamide gels containing 0.2% (w/v) puri-

fied B. subtilis cell walls (McLaughlan and Foster 1998)

or lyophilized Micrococcus luteus ATCC 4,698 cells

(Sigma). To allow for protein renaturation after elec-

trophoresis, the gels were gently shaken at room tem-

perature for 48 h, with one to three changes of 300 ml

of 25 mM Tris–HCl (pH 7.5) containing 1% (v/v)

Triton X-100. Bands of murolytic activity were visual-

ized by staining with 1% (w/v) methylene blue (Sigma)

in 0.01% (w/v) KOH and subsequent (1 to 4 h)

destaining with distilled water. Murein hydrolase

activity was detected as zones of clearing in the blue-

stained cell wall background.

Purification of murein

The cell pellet was suspended in ice-cold water and

added dropwise to the same amount of boiling 8% SDS

with vigorous stirring throughout. The samples were

kept boiling for 30 min and then allowed to stand at

room temperature overnight. Sacculi were collected by

centrifugation (30 min, 150,000g at 22�C) and the pel-

let was washed with room temperature water five

times. After each wash, the pellet was resuspended

homogeneously and centrifuged in the same condi-

tions. The SDS-free pellet was suspended in 49%

hydrofluoric acid and incubated for 40 h with stirring in

an ice bath to remove teichoic acid. The murein was

recovered by centrifugation as above and washed

Arch Microbiol (2006) 186:69–86 73

123

repeatedly to remove all hydrofluoric acid, suspended

in 10 mM Tris-HCl buffer, pH 7.0 and treated with

a-amylase (100 lg/ml) for 2 h at 37�C, then pre-

digested pronase E (200 lg/ml) was added and the

incubation was continued for 90 min at 60�C (Glauner

1988). Finally, the sample was mixed with 8% SDS and

incubated for 15 min at 100�C. SDS was removed by

washing and centrifugations as described above.

N-acetylation of murein was performed with acetic

anhydride in the presence of NaHCO3 according to

Hayashi et al. (1973). Murein and muropeptide

concentrations were calculated from their diamino acid

content. Samples were hydrolyzed in 6 N HCl (12 h,

105�C), vacuum dried and resuspended in an appro-

priate volume of distilled water.

High performance liquid chromatography (HPLC)

analysis of murein

N-acetylated murein prepared from the parental strain

and mutants was analyzed after digestion with the

muramidase Cellosyl (Hoechst AG) by HPLC using

the conditions described in detail by Glauner (1988) on

Hypersil RP18 column (250 mm·4 mm, particle size

3 lm diameter; Teknochroma). The elution buffers

were 50 mM sodium phosphate, pH 4.35 (A) and 15%

methanol in 75 mM sodium phosphate, pH 4.95 (B).

Elution conditions were 7 min isocratic elution in

buffer A, 115 of linear gradient to 100% buffer B and

28 min of isocratic elution in buffer B. The flow rate

was 0.5 ml/ml and the column temperature was 55�C.

The separated muropeptides were detected by UV-

absorption at 205 nm.

Autolysis of cell wall of L. monocytogenes

After sonication as above, the walls were sedimented

by centrifugation, washed in 10 or 50 mM Tris-hydro-

chloride buffer and resuspended in the same buffer

pre-warmed to 30 or 37�C. The suspension was incu-

bated with shaking at 30 or 37�C and changes in

absorbance were followed at 600 nm.

Cell autolysis

Culture of mutants and wild-type L. monocytogenes

strains were grown to early exponential phase (OD600

0.20) in TSB broth. To determine the effect of antibi-

otic-induced lysis, 1.20 lg penicillin G/ml (10·MIC),

1.20 lg imipenem/ml (10·MIC) or 9.6 lg nisin/ml

(4·MIC) was added, and the lysis of the culture was

followed spectrophotometrically (Novaspec II spec-

trophotometer LKB-13 Pharmacia) while continuing

incubation at 37�C with shaking. To determine the

effect of Triton X-100, the cells were grown to

OD600~0.6, harvested and resuspended in 50 mM Tris/

HCL (pH 7.5), 0.1% (v/v) Triton X-100. The lysis of

the suspension at 37�C was followed spectrophoto-

metrically.

Haemolytic activities

Bacteria were cultured on sheep blood agar at 37�C for

36 h. L. innocua and L. ivanovii were used as a nega-

tive and positive control, respectively. After incuba-

tion, the narrow ring of b-hemolysis produced by the

mutants was compared with that of L. monocytogenes

EGD.

Turnover of murein

Overnight cultures of L. monocytogenes strains were

inoculated 1:20 into warm (37�C) TSB medium sup-

plemented with [3H]N-acetyloglucosamine to 10 lCi/

ml (specific activity). When the culture reached the

value of OD A600–0.6 the culture fluid was removed

using a 0.22 lm Millipore nitrocellulose filter. The cells

deposited on the filter were washed with fresh, warm

(37�C) medium containing non-radiolabeled N-acety-

loglucosoamine (100 lg/ml). The bacteria were then

washed off the filter with fresh pre-warmed portion of

TSB and incubated with shaking. At 20 min intervals,

samples of the culture were removed and added to an

equal volume of boiling SDS solution. The samples

were boiled for 30 min, after which they were passed

through a 0.22 lm Millipore filter and the crude sacculi

remaining on the filters were washed with saline. The

filters were dried and the radioactivity remaining on

them was determined in Beckman type LS 355 scin-

tillation counter. Radioactivity at time ‘‘0’’ was taken

as 100%.

Modeling of the structure of Lmo0327

The potential tertiary structure of the LRR domain of

Lmo0327 was created based on ORFeus search server

available to the academic community via Structure

Prediction Meta Server (http://www.BioInfo.PL/Meta/)

(Ginalski et al. 2003) and BLAST and FFAS Software

(Rychlewski et al. 2000) (http://www.ncbi.nlm.nih.gov/

BLAST/). For molecular graphics visualization, Ra-

sMol program (version 2.7.2.1) from RCSB PDB

Software (http://www.rcsb.org/pdb/software-list) was

used. The atomic coordinates of the modeled LRR

structures are available at http://www.cmm.info.-

nih.gov/kajava.

74 Arch Microbiol (2006) 186:69–86

123

Results

Identification of lytic enzyme structural genes

A k Zap library of L. monocytogenes genomic DNA

was screened for lytic-enzyme-producing clones by a

direct screening protocol. Lytic enzyme clones are

characterized by a zone of clearing in the opaque wall

which overlays the plaque. After an initial screening of

approximately 2·103 insert-containing clones, a total of

10 lytic-enzyme-producing clones were isolated using

B. subtilis cell walls as substrate. The putative phage

clones were purified by re-screening prior to excision

as phagemids.

The ability of the clones to hydrolyse the cell walls

was not IPTG-dependent. E. coli expressing pBK-

CMV (vector without insert) showed no activity on

wall overlays. Restriction analysis and Southern blot-

ting (Kit DIG-High Prime, Boehringer Mannheim,

Germany) revealed the isolation of three distinct lytic-

enzyme-encoding genes. One of these genes was

present in three of the clones originally isolated by

plating on B. subtilis walls. For subsequent experi-

ments plasmid pMPZ6 containing an insert of 4,472 kb

was used for sequencing and further characterization.

Renaturing gel analysis

Cells of E. coli XLOLR strains expressing the re-

combinant enzymes were harvested at mid-exponential

phase (OD600 1.2) and cell extracts were prepared by

sonication and SDS method. The protein samples were

analyzed by renaturing SDS-PAGE. Lytic bands with

different molecular mass were seen in extracts from E.

coli XLOLR (pMPZ6). The E. coli XLOLR (pBK-

CMV) extract (plasmid without insert) showed no lytic

enzyme activity (results not shown).

Mutational analysis of pMPZ6

Cell suspensions of E. coli carrying derivatives of

plasmid pMPZ6 constructed by us, pMPZ6/1–4 (Ta-

ble 2) were disrupted with ultrasonic waves and the

soluble fractions were taken for determination of

murein-hydrolyzing activity. Electrophoresis in 12%

polyacrylamide gel was performed, with protein-free

cell wall of B. subtilis incorporated in the gel matrix

(zymogram). No murein-hydrolysing activity was ob-

served for pMPZ6/1–3, even when the incubation time

was prolonged to ten days, otherwise than for pMPZ6/

4 and parental pMPZ6 plasmids. Experiments in which

the orientation of the cloned DNA was reversed with

respect to the promotor of gene lacZ, pMPZ6/A (Ta-

ble 2) demonstrated that the gene coding for a protein

with murein hydrolase properties is expressed from its

own promoter. The change in the orientation of the

insert did not affect the production of active protein.

Construct pMPZ6/4 (3217 kb), shortened by a 1.2 kb

fragment, which also showed zymographic activity, was

used for further analysis.

Sequencing of the lytic enzyme clones

and identification of a new L. monocytogenes

protein with autolytic activity

Sequence analysis

The DNA sequence of the pMPZ6/4 insert was deter-

mined and three putative ORFs were identified

(Fig. 1). A comparison of all obtained sequences re-

vealed 100% identity and enabled the identification of

the cloned genes. It is worth mentioning that in the

case of all identified L. monocytogenes genes, coun-

terparts in the L. innocua genome were identified.

Fig. 1 Genetic map of fragment of L. monocytogenes EGDgenome cloned into pMPZ6 (4,472 bp) and pMPZ6/4 (3,217 bp).Open reading frames and direction of transcription are indicated

with arrows. The broken line indicates the sequence of listerialgenome embracing regions lmo0323 and lmo0327, which werenot present in the sequenced fragment. T putative terminators

Arch Microbiol (2006) 186:69–86 75

123

The 3.217 kb pMPZ6 insert contains three genes,

from lmo0325 to lmo0327 (Fig. 1). The two genes

lmo0325 and lmo0326 encode putative positive tran-

scriptional regulators of the Rgg type with typical

conserved HTH XRE domain. A comparison of the

sequences of proteins Lmo0325 and Lmo0326 revealed

high homology (32% identity, 58% similarity). The

greatest similarity is in the N-terminal part of both

proteins, in which the HTH XRE domains are located.

Gene lmo0327 is incomplete in the cloned insert,

1,036 out of 4,101 bp, and codes only the N-terminal

segment of the protein that is 310 amino acids long.

The presence of a proline/glycine-rich region

(LPXTG) (Schubert et al. 2001) in protein Lmo0327

indicates covalent binding to murein. Further searches

in the Listeria genome database (Glaser et al. 2001;

Cabanes et al. 2002) indicated the presence of other

LPXTG motif-containing proteins (Fig. 2a). Sequence

comparison analysis of Lmo0327 revealed the con-

served domain LRR (leucine reach repeat) character-

istic for internalin, which consists of tandem repeats of

20–22 amino acids with conserved leucine or isoleucine

residues. The potential LRR domain of protein

Lmo0327 is composed of 151 amino acids (from amino-

acid 25 to 176) (Fig. 2b, c). LRRs are known to be

involved in protein–protein interactions and in a vari-

ety of functions, such as adhesion, ligand-receptor

interactions and signalling (Kajava 1998; 2002). The

central part of the protein contains regions of amino

acid repeats with varied length (Fig. 2c), and in this

part of the protein, no known domains have been

identified. A comparison of the amino acid sequence of

the protein (BLAST), both of entire protein and only

its N-terminal end, revealed a similarity to murein-

bound surface proteins, such as the internalins and

other leucine-rich proteins. Protein database searches

showed that the Lmo0327 protein of L. monocytogenes

EGD and L. innocua (NP469697) are highly con-

served, with 95% identities at the amino acid level. At

this stage of our studies (taking into account the results

of sequence analysis of all the genes cloned into

pMPZ6), we formulated the hypothesis that the pro-

tein responsible for the studied murolytic activity is

Lmo0327 (N-terminal part) and that its expression may

Fig. 2 a Schematicrepresentation of domainstructure of protein Lmo0327.b Structure of LRR domain ofLmo0327. Secondarystructure is indicated by bars(a-helices) and arrows(b strands). c Amino acidsequence of the Lmo0327.The signal peptide is shown inbold, and the LRR domain(LRR 1–5) is shaded in darkgrey. Regions of amino acidrepeats are shaded in grey andLPXTG motif is shown inbold and underlined

76 Arch Microbiol (2006) 186:69–86

123

depend on the presence of potential transcription

activators coded upstream of lmo0327.

In silico modeling of the structure of Lmo0327 and

analysis of its potential tertiary structure

Available data bases contain crystallographic models

elaborated for the internalin proteins of L. mono-

cytogenes InlA, InlB and InlH (Kajava and Kobe

2002). Computer analysis of the amino acid sequence

of the LRR domain of Lmo0327 and of the

remaining part of the protein, enabled determination

of the probable tertiary structures of both parts. The

N-terminal domain—LRR (151 aa) forms a right-

handed beta-helix with a turn after each repeat of

the amino acid sequence. This model structurally

corresponds to an analogous domain identified in

proteins belonging to the very large internalin family

(Fig. 2b). Nucleotide sequence analysis of the

L. monocytogenes, genome identified 20 proteins of

this type in this bacterium (Cabanes 2002). The

spatial arrangement of the N-terminal domain prob-

ably enables more effective binding to other proteins,

as in the binding of InlA by means of the LRR

domain to E-cadherin—a surface receptor on

eukaryotic cells (Bergmann 2002).

A model of the tertiary structure of the remaining

part of protein Lmo0327 was also elaborated. The re-

peats in the central part of the protein form an a-helix

with a turn after repeat of the amino acid sequence and

a probable b-helix was also identified (data not shown).

Characterization of recombinant lytic enzyme

Partial purification by selective precipitation of re-

combinant lytic enzyme has been previously reported

(McLaughlan and Foster 1998). The enzyme from

pMPZ6 was not able to hydrolyze the cell wall of

L. monocytogenes and B. subtilis when the lytic

activity was determined by the ability of the extract

to decrease the optical density of cell wall suspen-

sion. The same sample was analyzed on 12% SDS-

polyacrylamide renaturing gel containing cell walls of

B. subtilis as substrate and clear zones in the opaque

gel indicating murolytic activity (data not shown)

were observed. The reason for this observation is

most probably that in the former case the formation

of protein aggregates takes place, which prevents the

degradation of murein. A similar situation was ob-

served when attempting the purification of protein

p60, which precluded determination of the hydrolytic

bond specificity the enzyme (Wuenscher et. al. 1993).

Construction of insertional mutations in the

chromosome of L. monocytogenes EGD

To determine the physiological role of Lmo0327 and to

determine the effect of a potential positive transcrip-

tion regulator on the studied murolytic activity, two

mutants of L. monocytogenes EGD insertionally inac-

tivated in genes lmo0326, lmo0327 were constructed.

Internal fragments of 530 bp from the lmo0326 gene

and 557 bp from the lmo0327 gene were amplified by

PCR and cloned into pAUL-A in E. coli to create two

clones, pAUL-A::lmo0326 and pAULA::lmo0327,

respectively (Table 2). The obtained plasmids were

introduced into L. monocytogenes EGD cells by elec-

troporation and maintained at a permissive tempera-

ture (30�C). Plasmid pAUL-A contains a temperature

sensitive replicon and when the cells were successively

subcultured at the non-permissive temperature (42�C),

the plasmid recombined at the region of homology

with the host chromosome, thus inactivating the

appropriate gene. The obtained insertion mutants

(Emr) EGD/pAUL-A::lmo0326 were designated: MP2

and EGD/pAUL-A::lmo0327 MP1. These mutants

were used in an analysis of the role of proteins

Lmo0326 and Lmo0327 in cell physiology.

Transcriptional analysis

The non-polar effects of insertion into lmo0327 (mu-

tant MP1) and into lmo0326 (mutant MP2) were con-

firmed by an RT-PCR reaction using MP1 or MP2

generated cDNA and specific primer pairs (Table 3)

for downstream/upstream gene. As a positive control

analogous PCR reactions were performed using cDNA

generated from EGD. The achieved results (the

insertions had no-polar effect) are in accordance with

the sequence prediction, which reveals the presence of

transcriptional terminators downstream of lmo0326

and lmo0327 (Fig. 1). All PCR amplifications were

performed according to the scheme presented in

Fig. 3a. The reactions resulted in products of equal

intensity, confirming the formation of transcripts for

lmo0326 and lmo0328 in the case of mutant MP1 and

also for lmo0325 and lmo0327 in the case of mutant

MP2 (Fig. 3b).

Autolytic activity of Lmo0327

Cell surface proteins (SDS and LiCl extractions) of

EGD and mutants MP1 and MP2 were isolated and

analyzed on SDS-polyacrylamide gels. As expected, a

band at ~144 kDa in the surface extracts of EGD was

Arch Microbiol (2006) 186:69–86 77

123

absent in the lmo0327 mutant (MP1) extracts. In

addition, we observed the absence of one other band at

~80 kDa in the mutant LiCl-extracts and different

pattern of bands at ~69 and 80 kDa from SDS-extracts

of the mutant strains. Significant quantitative changes

regarding other bands in the studied fractions were

observed (Fig. 3a). In the case of mutant MP2, the LiCl

fraction lacked a ~75 kDa band and there were

considerable quantitative changes in the bands in the

85–45 kDa range. Significant differences were also

observed in the protein profiles in the SDS fraction,

including the absence of ~144 kDa and ~80 kDa bands.

In the supernatant fraction, significant quantitative and

qualitative differences were observed, especially in the

case of mutant MP2 (Fig. 4c).

Cell surface proteins of both strains were also ana-

lyzed in renaturing SDS-polyacrylamide gels (12%)

containing 0.2% purified cell walls of Bacillus subtilis.

Multiple lytic bands, which represented cell wall

hydrolase activity, were detected in renaturing gels

(Fig. 4b, d). A ~144 kDa lytic band present in bacterial

surface LiCl-extracts and total protein fraction from

the EGD strain was absent in these fractions isolated

from the MP1 and MP2 mutants. We also observed

very weak murolytic activity of bands at ~80, ~75 and

~67 kDa in LiCl-extracts from mutant MP1 (Fig. 4b).

Similarly, in the case of LiCl-extracts and total protein

from mutant MP2 we observed the loss of p144 cell

wall hydrolase activity and in addition, in the LiCl

fraction, a protein with mass ~67 kDa (Fig. 4d). In the

culture supernatant from MP1 slight quantitative dif-

ferences were visible, whereas in the case of mutant

MP2 no zones of hydrolysis in this fraction were ob-

served (Fig. 4b, d). Weaker activity of an enzymatic

protein with mass ~60 kDa was also noted. No differ-

ence was observed in the bacterial surface SDS-ex-

tracts from all strains.

Taken together, the obtained results indicate that

Lmo0327 with hydrolase activity is a cell surface pro-

tein covalently linked to the murein of L. monocytog-

enes and that the transcription regulator Lmo0326

presumably positively affects the expression of gene

lmo0327.

The role of the lmo0327 gene was examined by a

phenotypic comparison of MP1 (lmo0327) and EGD

(wild-type). A similar experiment was carried out for

mutant MP2. No differences were detected with re-

spect to hemolytic activity on blood agar plates, growth

in TSB medium at 37�C, motility on swarm plates and

colony formation (data not shown). The cells of EGD,

Fig. 3 a Scheme of RT-PCRs. Arrows indicate theprimer, broken lines indicatecDNA, short lines indicatePCR product and rectanglesindicate insertionalinactivation. b RT-PCRexamination. 1 DNA ladderband (Fermentas), 2 10;Orf2L/Orf2R PCR products(MP1) and 3 (EGD), 4 RTC/RTB PCR products (MP1)and 5 (EGD) 6 Orf3L/Orf3RPCR products (MP2) and 7(EGD), 8 RT3/RT2 PCRproducts (MP2) and 9 (EGD)

78 Arch Microbiol (2006) 186:69–86

123

MP1 and MP2 were also examined by light and elec-

tron microscopy when the cultures were in logarithmic

phase of growth (OD600 of 0.6). Mutants MP1 and MP2

formed long chains, composed of cells that did not

separate following division, with fully formed septum

(Fig. 5). Sixty-eight percent of MP1 cells were

arranged in chains of 5 to 11 bacteria compared to no

chains formed by the wild-type strain. The data suggest

the involvement of Lmo0327 in cell separation. How-

ever, during stationary-phase growth, the MP1 cells

formed shorter chains than in the log phase and more

than 50% of MP1 cells grew as separate cells. These

Fig. 5 Scanning electron micrographs of L. monocytogenes EGD (a, d), mutant MP1 (b, e), mutant MP2 (c). Bar represents 2 lm (a, b,c) and 1 lm (d, e)

Fig. 4 Surface expression andautolytic activity of Lm00327.Samples were prepared asdescribed in Materials andmethods. a, c Surface proteinsof L. monocytogenes EGD,MP1 and MP2 were preparedby SDS-extraction and LiCl-extraction, separated on 12%SDS-PAGE gel and stainedwith Coomassie blue. b, d Theautolytic enzyme profile of L.monocytogenes EGD, MP1and MP2 was analyzed on a12% SDS-PAGE gelcontaining purified cell wallsof B. subtilis as substrate.Bands with autolytic activitywere observed as clear zonesin the opaque gel. Arrowsindicate the position ofLmo0327 at 144 kDa, lines,those of the other proteins

Arch Microbiol (2006) 186:69–86 79

123

observations suggest that other cell wall hydrolases

may compensate for the loss of p144 in MP1. Ultra-

structural analysis by electron microscopy did not re-

veal any significant differences in the morphology of

the cell wall. Analysis by HPLC of purified cell walls of

wild type EGD and mutants (MP1 and MP2) showed

no alteration in muropeptide profile (data not pre-

sented), except for small quantitative differences in the

case of some of the individual muropeptides. The

growth of MP1 and MP2 was compared to that of the

wild type at 25, 30, 37, and 42�C. No significant dif-

ference in the growth rate of the all strains was de-

tected at 30 and 37�C temperature (generation time at

both temperatures was 45 min). At 25 and 42�C the

growth of the strains differed—mutants MP1 and MP2

grew slower than the wild type (generation time for

EGD at 25�C was 90 min versus 180 and 240 min for

MP1 and MP2, respectively). At 42�C the generation

times were 55 min, 90 min and 240 min, respectively,

indicating that these mutations confer temperature

sensitivity but that protein Lmo0327 is not essential for

cell growth.

Penicillin- or imipenem-induced cell lysis was

determined by the addition of b-lactam to growing

cultures. After 5 h the treated EGD, MP1 and MP2

cultures all had final OD600 of 0.3–0.35, and after 24 h,

there still was no difference between the strains (data

not shown). From these results it appears that

Lmo0327 does not have a role in b-lactam-induced

lysis. During nisin-induced lysis a decrease of OD600

from 0.35 to 0.2 after 3 h treatment of MP1 cultures

and from 0.32 to 0.2 after 3 h treatment of MP2 cul-

tures compared to EGD culture (OD600 of 0.35 was at

the same level throughout the experiment) was ob-

served. The obtained results indicate the greater sus-

ceptibility of the cells of mutants MP1 and MP2 to the

action of nisin (Fig. 6). Lmo0327 is probably not in-

volved in Triton-X-induced lysis, as both the mutant

and the wild-type lysed at a similar rate (Fig. 7). Sim-

ilarly, the rate of autolysis of murein, isolated from

both EGD and MP1 strain, was similar. After 4 h

autolysis, the absorbance dropped by about 50% for

MP1, compared to about 60% for EGD (Fig. 8a). The

autolysis of mutant MP2 cells following induction with

Triton X-100 was significantly slower than for the wild-

type control. The drop in absorbance at the end of the

experiment was 35%, compared to 60% for the control

(Fig. 7). The second difference concerns the autolysis

of murein, including murein labeled with [3H]N-acet-

ylglucosamine, in which case MP2 was clearly distin-

guished by slower rate of murein degradation (Fig. 8b).

These differences are probably related to the possi-

bility of the regulation of other listerial proteins by the

regulator Lmo0326.

After labeling the bacterial cell wall with tritiated

N-acetyloglucosamine, it is possible to follow the re-

lease of old murein into the medium as new murein is

incorporated into it. By measuring the amount of

radioactivity either released to the medium, or

remaining in the cell wall the turnover of the macro-

molecule in time can be identified. In the case of mu-

tants MP1 and MP2, the rate of murein turnover was

much slower than for the wild type strain. After

150 min of the experiment, the radioactivity remaining

in the cell wall (murein) of the wild type strain EGD

was only 8% of the initial value, compared to 44% for

mutant MP1 and 46% for MP2 (Fig. 9). These results

show that Lmo0327 is involved in the process of mur-

ein turnover.

Discussion

Murein hydrolases are ubiquitous in murein-containing

bacteria but the participation of these enzymes in cell

elongation and division remains to be fully elucidated.

Fig. 6 Nisin-induced cell lysis of L. monocytogenes EGD, MP1 and MP2. Lysis was measured as decline in optical density. Filled circleEGD, symbol, MP1, filled triangle MP2, symbol nisin (4·MIC). The results are means from at least three independent experiments

80 Arch Microbiol (2006) 186:69–86

123

It is obvious that enzymes involved in such important

processes as cell growth and division or turnover of

murein should be under topological and temporal

control. The role of bacterial murein hydrolases in

cellular processes has been demonstrated in but a

limited number of cases, and more often their roles are

inferred indirectly. They are involved in cell growth

but on the other hand they can participate in autolytic

events resulting in cell death (Holtje 1998).

Analysis of the L. monocytogenes genome reveals

the presence of at least 11 proteins with possible

murein hydrolysis domain and so far, as mentioned in

the Introduction, six such enzymes have been identi-

fied. The rather unusual phenomenon among bacteria

of the death of L. monocytogenes cells in the presence

of penicillin, without accompanying autolysis (Chen

et al. 1996), indicates that the autolytic enzymes of this

bacterium are likely tightly regulated and their activity

is to some extent inhibited even after the death of the

cells. This fact makes the study of the autolysins of

L. monocytogenes particularly interesting.

In this study, we have identified a novel cell wall

hydrolase of L. monocytogenes and have characterized

the gene, lmo0327, encoding the enzyme. In addition,

we have characterized a putative positive transcription

regulator, coded by gene lmo0326, which may posi-

tively affect the expression of protein Lmo0327.

Comparative genome analysis of the region surround-

ing the gene lmo0327 shows that it is highly conserved

in the genus Listeria. For each of the genes cloned into

plasmid pMPZ6 (lmo0325–lmo0327) a counterpart

exists in the genome of the non-pathogenic L. innocua.

The similarity of the amino acid sequences of the

protein products of these genes is very high and aver-

ages 90%. Sequence and comparative analysis of the

genes identified in this study cloned into plasmid

pMPZ6 demonstrated that genes lmo0325 and lmo0326

code for positive transcription regulators of the Rgg

type. The sequence of both proteins contains a HTH

(helix-turn-helix) domain responsible for binding to

DNA and is characteristic of transcription regulators

belonging to the XRE family. Proteins of this type

function as transcription activators. This group of

regulators embraces, among others, protein PlcR of

Bacillus cereus (Slamati and Lereclus 2002), which

plays the role of a positive regulator for virulence

factors, as well as an activator of proteins participating

in germination and sporulation in B. subtilis (Foster

1992). Similarity to many other proteins being poten-

tial transcription activators in L. monocytogenes and

Fig. 7 Triton X-100-stimulated autolysis of L. monocytogenesEGD, MP1 and MP2. Autolysis was measured as decline inoptical density. The results are means from at least threeindependent experiments

Fig. 8 a Autolysis of L. monocytogenes EGD, MP1 and MP2 murein. Autolysis was measured as decline in optical density. b [3H]N-acetyloglucosamine labeled murein autolysis of L. monocytogenes EGD, MP2. Autolysis was measured as the amount of radioactivityreleased to the medium. The results are means from at least three independent experiments

Fig. 9 Turnover of murein of L. monocytogenes EGD, MP1 andMP2. The rate of turnover was measured as the amount ofradioactivity remaining in the cell wall. The results are meansfrom at least three independent experiments

Arch Microbiol (2006) 186:69–86 81

123

L. innocua has also been demonstrated. A comparison

of the amino acid sequences of both proteins showed

that they are homologues, with 58% similarity and

32% identity. The greatest similarity is in the N-ter-

minal part of the proteins, in which the domains HTH

XRE are located.

Computer analysis of the amino acid sequence of

protein Lmo0327 revealed the presence, in its N-ter-

minal part, of the domain LRR (leucine reach repeat).

In the C-terminal part, the strongly conserved motif

LPXTG has been identified, which points to the

probable sortase-mediated covalent binding of the

protein to murein. Comparative analysis of Lmo0237

revealed similarity to murein-bound surface proteins,

internalins and other leucine-rich proteins. Analysis in

silico of the sequence of domain LRR of Lmo0327 and

the remaining part of the protein allowed determining

its probable tertiary structure. The N-terminal do-

main—LRR (151 aa) forms a right-handed beta-helix

with a turn after each repetition of the amino acid se-

quence. Structurally, this model corresponds to an

analogous domain identified in proteins belonging to

the very numerous internal family. The amino acid

sequence is strongly conserved in this region in all

known internalins (Schubert et al. 2002). Twenty-two

internalin-like proteins have been identified in

L. monocytogenes, 14 of which carry both the LPXTG

motif as well as domain LRR. A model of the tertiary

structure of the remaining part of Lmo0327 was also

elaborated. The repeats in the central part of the

protein form an a-helix with a turn after each repeti-

tion of the amino acid sequence and two putative

b-helices were also identified. A comparison of the

possible tertiary structure of protein Lmo0327 with

crystallographic models in databases did not reveal any

similarity to other known proteins.

Since analysis of the DNA fragment of L. mono-

cytogenes EGD cloned into plasmid pMPZ6/4 did not

allow determining the potential protein responsible for

the observed murolytic activity, mutational analysis of

genes lmo0325, lmo0326 and lmo0327 in pMPZ6 was

carried out, accompanied by investigation of the mur-

olytic activity of the mutated clones. Zymographic

analysis of total proteins obtained after ultrasonic dis-

ruption of E. coli cells carrying the plasmid constructs

demonstrated the lack of murolytic activity in every

case, suggesting that the protein products of all the

studied genes are necessary for expression of this

activity. Computer analysis of the amino acid sequence

of the proteins suggests, however, that only one pro-

tein, Lmo0327, may be a candidate for a murein

hydrolase, especially since the other two proteins seem

to be putative transcription activators. An experiment

in which the orientation of the cloned DNA with re-

spect to the lacZ promotor was reversed indicated that

the gene coding a protein with murein-hydrolase is

expressed from its own promotor. The change of ori-

entation of the insert does not affect the production of

active protein.

In order to confirm that protein Lmo0327 is in fact

responsible for the investigated murolytic activity and

to determine the effect of the potential positive regu-

lator Lmo0326 on the enzyme, insertional inactivation

of genes lmo0326 and lmo0327 in the chromosome of

L. monocytogenes EGD was performed. Mutants were

selected under conditions being restrictive for the

autonomous replication of the vector pAUL-A (42�C)

in the presence of erythromycin (Schaferkordt and

Chakraborty 1995). The correctness of the construction

was confirmed by hybridization and the obtained mu-

tants were designated MP2 and MP1, respectively, and

subjected to physiological characterization.

Microscopic observations showed that MP1 and

MP2 cells grow in the form of chains following cell

division. No significant differences in colony mor-

phology of the mutant strains compared to strain EGD

were observed. Mutants devoid of autolysins fre-

quently do not manifest striking changes in cell mor-

phology or growth: a mutant of L. monocytogenes

lacking amidase activity (Ami–) does not demonstrate

any phenotypic changes besides reduced motility

(McLaughlan and Foster 1998) and no phenotypic

changes compared to wild type cells have been

observed in the case of the aut mutant of L. mono-

cytogenes (Cabanes et al. 2004). However, some

L. monocytogenes mutants defective in autolytic

activity show a tendency to form shorter or longer

chains, as observed for the deletion mutant DmurA or

mutant defective in p60 activity. Similarly, the only

consequence of the absence of LytA amidase activity

in a mutant of Streptococcus pneumoniae, was growth

in the form of chains composed of daughter cells with

developed septum (Tomasz et al. 1988).

The growth rate of wild-type L. monocytogenes and

the mutants (without antibiotic pressure) at several

temperatures was studied. The growth of both mutants

was found to be sensitive at the temperature extremes

(25�C and 42�C) examined. The growth of mutant MP2

carrying a mutation in the putative regulator was even

slower than that of mutant MP1. Its doubling time was

four times that of strain EGD. At 30�C and 37�C, the

growth of all the studied strains was comparable. At

25–30�C, L. monocytogenes EGD is able to move in

liquid medium by means of flagella. The role of auto-

lytic enzymes in the proper formation of flagellum has

been demonstrated, for instance for L. monocytogenes

82 Arch Microbiol (2006) 186:69–86

123

amidase Ami (McLaughlan and Foster 1998) as well as

for other specific muramidases involved in building a

functional flagellum (Holtje and Tuomanen 1991).

Since at 25�C the constructed mutants grow very

slowly, the test for motility was performed at 30�C. No

differences in motility in TSB medium between the two

mutants as well as between either of the mutants and

wild-type listeria, was observed.

Proteins containing the LPXTG motif have been

shown to play an important role in the adhesion and

entry of pathogens, including L. monocytogenes, into

non-professional phagocytic cells and colonization of

the intestine, using the mouse model (e.g. Cabanes

et al. 2005; Lalioui et al. 2005). In our studies we car-

ried out experiments aimed at determining the possible

role of Lmo0327 in adherence and entry of L. mono-

cytogenes into cells of the eukaryotic lines Int407 and

found that there is no difference in this regard between

wild-type cells and mutants carrying inactive Lmo0327

(data not presented). However, other cell lines should

be tested too.

The murein of Gram-positive bacteria undergoes

constant turnover. The process involves the highly

coordinated participation of murein hydrolases and

synthetases. The role of an amidase in the turnover of

murein in Bacillus subtilis (Hobot and Rogers 1991)

and of a muramidase in Lactobacillus acidophilus

(Coyette and Shockman 1973) has been determined. In

the case of L monocytogenes mutants MP2 and MP1,

slower metabolic turnover compared to the wild-type

was observed, which may reflect the role of protein

Lmo0327 in the process.

The phenomenon of autolysis is caused by the

degradation of murein by endogenous cellular

enzymes. L. monocytogenes has been shown to be

refractory to lysis induced by such agents as EDTA or

SDS, which may indicate the stricter regulation of

autolysis in this bacterium. As mentioned, in the

presence of b-lactam antibiotics L. monocytogenes

behaves differently compared to most other bacteria.

Death without autolysis is a very rare phenomenon

that has also been described for group A streptococci

(McDowell and Lemanski 1988). No differences in the

response of the mutants obtained by us to the presence

of penicillin or imipenem in the culture medium,

compared to the wild-type strain, were observed. The

induction of autolysis by the surfactant Triton X-100

showed significant differences for mutant MP2 com-

pared to strain EGD. The course of the process was

much slower, and a 40% drop in absorbance for the

mutant versus 80% for the wild-type strain during the

same time was observed. In the case of mutant MP1,

the rate of autolysis induced by Triton X-100 was

comparable with strain EGD, which points to the lack

of Lmo0327 involvement in induced autolysis. The

results for the mutant defective in the putative regu-

lator gene lmo0326 may suggest that Lmo0326 may

possibly also regulate the expression of other proteins,

whose absence may affect the course of autolysis.

The effect of the lantibiotic nisin on the studied

strains was examined. Nisin causes local disruption of

the cytoplasmic membrane and also binds to the mur-

ein precursor lipid II, resulting in inhibited cell wall

synthesis and violent lysis (Sahl and Bierbaum 1988).

The results indicate the greater susceptibility of the

mutant cells to nisin. This may be related to the growth

of the cells in the form of chains due to disturbed

separation of daughter cells following division but the

actual reason for this observation remains to be eluci-

dated, especially since spontaneous nisin-resistant

mutants of L. monocytogenes have been shown to have

elevated levels of PBP4, caused by an increase in his-

tidine kinase expression (Gravesen et al. 2004).

Because the autolysins of many Gram-positive bac-

teria are present in the inner layers of the cell wall, we

examined the rate of degradation of murein isolated

from the studied strains. Mutant MP2, with a mutation

in the gene coding positive transcription regulator,

showed a slower rate of murein degradation compared

to strain EGD. In the case of mutant MP1, in which the

mutation directly concerns the identified surface pro-

tein, no significant differences in the course of cell wall

autolysis compared to the wild-type strain were

observed. An analogous experiment in which [3H]N-

acetyloglucosamine was used, showed a similar

effect—slower rate of release of labeled fragments of

murein in the case of MP2, compared to strain EGD.

The use of high performance liquid chromatography

(Glauner 1988) to study the muropeptide composition

of murein from wild-type L. monocytogenes and mu-

tants MP1 and MP2 demonstrated the absence of the

role of the studied gene products on the structure of

the macromolecule. A comparison of the three chro-

matograms showed no qualitative differences in the

composition of murein.

Earlier studies have shown that proteins isolated

from various cell fractions show hydrolytic activity

against murein, as revealed by zymography

(McLaughlan and Foster 1997). Protein was isolated

from the cellular fractions of the studied strains and

both quantitative and qualitative differences in the

studied fractions between the studied mutants and wild

type strain were observed. In the case of all cellular

fractions from mutants MP1 and MP2, both SDS-PAGE

and zymography showed a protein of 144 kDa to be

missing, compared to analogous fractions from strain

Arch Microbiol (2006) 186:69–86 83

123

EGD. Worth attention is that in the case of mutant MP2,

no zones of hydrolysis were observed in a zymogram of

the fraction of proteins released to the growth medium.

Moreover, the protein profile of this fraction in SDS-

PAGE decidedly differs from that of the wild type

strain. This result may point to the role of protein

Lmo0326 in the expression or transport of proteins re-

leased to the medium. Further studies conducted by our

group will attempt to explain this observation.

The above observations taken together show that

Lmo0327 is an enzyme that is covalently linked to

murein and has murein-hydrolyzing activity. In view of

the fact that gene lmo0327 is incomplete (1,036 bp) in

the studied L. monocytogenes genome fragment

(pMPZ6) and it is the studied product (N-terminal part

of the protein—310 amino acids) that demonstrates

murein-hydrolysing activity, it can be concluded that

the active centre is in the N-terminal part of the protein.

Lmo0327 appears to be involved in cell separation and

turnover of murein and does not seem to be involved in

adhesion to and entry into eukaryotic cells, at least in

the case of the cell lines examined. A further study of

Lmo0327 may reveal other roles for this protein in

L. monocytogenes. The expression of gene lmo0327

coding for the autolysin is presumably positively regu-

lated by the transcription regulator of the Rgg type

Lmo0326, though conclusive proof, gained from further

studies, is required to justify this statement.

The characterization of mutant MP3, with a muta-

tion in a second regulatory gene lmo0325, has also

been initiated, which will allow studying the possible

effect of protein Lmo0325 on the expression of

Lmo0327 and/or other proteins with similar character.

Preliminary studies have revealed differences in pro-

tein and zymographic profiles between the mutants

characterized herein and MP3, which may suggest the

effect of transcription regulator Lmo0325 on the

expression and activity of other proteins.

Acknowledgments We are grateful to Paweł Szczesny (IBB,Polish Academy of Sciences) for modeling the potential tertiarystructure of the LRR domain of Lmo0327.

References

Bergmann B, Raffelsbauer D, Kuhn M, Goetz M, Hom S, Go-ebel W (2002) InlA- but not InlB-mediated internalizationof Listeria monocytogenes by non-phagocytic mammaliancells needs the support of other internalins. Mol Microbiol43:557–570

Berry AM, Paton JC, Hansman D (1992) Effect of insertionalinactivation of the genes encoding pneumolysin and autol-ysin on the virulence of Streptococcus pneumoniae type 3.Microb Pathog 12:87–93

Blackman SA, Smith TJ, Foster SJ (1998) The role of autolysinsduring vegetative growth of Bacillus subtilis 168. Microbi-ology 144:73–82

Braun L, Cossart P (2000) Interactions between Listeria mono-cytogenes and host mammalian cells. Microbiology 2:803–811

Bubert A, Kuhn M, Goebel W, Kohler S (1992) Structural andfunctional properties of the p60 proteins from differentListeria species. J Bacteriol 174:8166–8171

Cabanes D, Dehoux P, Dussurget O, Frangeul L, Cossart P(2002) Surface proteins and the pathogenic potential ofListeria monocytogenes. Trends Microbiol 5:238–245

Cabanes D, Dehoux P, Dussurget O, Frangeul L, Cossar P (2004)Auto, a surface associated autolysin of Listeria monocytog-enes required for entry into eukaryotic cells and virulence.Mol Microbiol 51:1601–1614

Cabanes D, Sousa S, Cebria A, Lecuit M, Garcıa-del Portillo F,Cossart P (2005) Gp96 is a receptor for a novel Listeriamonocytogenes virulence factor, Vip, a surface protein.EMBO J 24:2827–2838

Carroll SA, Hain T, Technow U, Darji A, Pashalidis P, JosephSW, Chakraborty T (2003). Identification and characteriza-tion of a murein hydrolase, MurA, of Listeria monocytoge-nes, a muramidase needed for cell separation. J Bacteriol185:6801–8

Chakraborty T, Leimeister-Wachter M, Domann E, Hartl M,Goebel W, Nichterlein T, Notermans S (1992) Coordinateregulation of virulence genes in Listeria monocytogenes re-quires the product of the prfA gene. J Bacteriol 174:568–574

Chakraborty T, Hain T, Domann E (2000) Genome organizationand the evolution of the virulence gene locus in Listeriaspecies. Int J Med Microbiol 290:167–174

Chen LJ, Wang J, Levin RE (1996) Effect of benzylpenicillin onthe viability and osmotic sensitivity of Listeria monocytog-enes. Lett Appl Microbiol 22:10–12

Cossart P (1998). Interactions of the bacterial pathogen Listeriamonocytogenes with mammalian cells: bacterial factors,cellular ligands, and signaling. Folia Microbiol 43:291–303

Cossart P (2001). Molecular and cellular basis of the infection byListeria monocytogenes, an overview. Int J Med Microbiol291:1722–1725

Coyette J, Shockman GD (1973). Some properties of the auto-lytic N-acetylmuramidase of Lactobacillus acidophilus. JBacteriol 114:34–41

De Paula SO, Nunes C, Matos R, de Oliveira ZM, Lima DM, daFonseca BA (2001) Comparison of techniques for extractingviral RNA from isolation-negative serum for dengue diag-nosis by the polymerase chain reaction. J Virol Methods98:119–25

Farber JM (1991) Listeria monocytogenes, a food-borne patho-gen. Microbiol Rev 55:476–511

Foster TJ (1991) Cloning, expression, sequence analysis andbiochemical characterization of an autolytic amidase ofBacillus subtilis 168 trpC2. J Gen Microbiol 137:1987–1998

Foster SJ (1992) Autolysis of the autolysins of Bacillus subtilis168 during vegetative growth and differentation by usingrenaturing polyacrylamide gel electrophoresis. J Bacteriol174:464–470

Foster SJ (1995) Molecular characterization and functionalanalysis of the major autolysin of Staphylococcus aureus8325/4. J Bacteriol 177:5723–5725

Ghuysen JM, Leyh-Bouille M (1969) The primary structure ofbacterial wall mureins. J Gen Microbiol 57:i–ii

Ginalski K, Pas J, Wyrwicz LS, von Grotthuss M, Bujnicki JM,Rychlewski L (2003) ORFeus: Detection of distant homol-ogy using sequence profiles and predicted secondary struc-ture. Nucleic Acids Res 31:3804–3807

84 Arch Microbiol (2006) 186:69–86

123

Glaser P, Frangeul L, Burchrieser C et al (2001) Comparativegenomics of Listeria species. Science 294:849–852

Glauner B (1988) Separation and quantification of muropeptideswith high-performance liquid chromatography. Anal Bio-chem 172:451–464

Gravesen A, Kallipolitis B, Holmstrom K, Hoiby PE, RamnathM, Knochel S (2004) pbp2229-mediated nisin resistancemechanism in Listeria monocytogenes confers cross-protec-tion to class IIa bacteriocins and affects virulence geneexpression. Appl Environ Microbiol 70:1669–1679

Hayashi H, Araki Y, Ito E (1973) Occurrence of glucosamineresidues with free amino groups on cell wall peptidoglycanfrom Bacillus as a factor responsible for resistance to lyso-zyme. J Bacteriol 113:592–598

Hobot JA, Rogers HJ (1991) Intracellular location of the auto-lytic N-acetylmuramyl-L-alanine amidase in Bacillus subtilis168 and in an autolysis-deficient mutant by immunoelectronmicroscopy. J Bacteriol 173:961–976

Hof H (2004) An update on the medical management of liste-riosis. Expert Opin Pharmacother 5:1727–1735

Holtje J-V, Tuomanen EI (1991) The murein hydrolases ofEscherichia coli: properties, functions and impact on thecourse of infections in vivo. J Gen Microbiol 137:441–454

Holtje J-V (1998) Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli Microbiol.Mol Biol Rev 62:181–203

Kajava AV (1998) Structural diversity of leucine-rich repeatproteins. J Mol Biol 277:144–158

Kajava AV, Kobe B (2002) Assessment of the ability to modelproteins with leucine-rich repeats in light of the lateststructural information. Protein Sci 11:1082–1090

Kuhn M, Goebel W (1989) Identification of an extracellularprotein of Listeria monocytogenes possibly involved inintracellular uptake by mammalian cells. Infect Immun57:55–61

Lalioui L, Pellegrini E, Dramsi S, Baptista M, Bourgeois N,Doucet-Populaire F, Rusniok C, Zouine M., Glaser P, KunstF, Poyart C, Trieu-Cuot P (2005) The SrtA sortase ofStreptococcus agalactiae is required for cell wall anchoringof proteins containing the LPXTG motif, for adhesion toepithelial cells, and for colonization of the mouse intestine.Infect Immun 73:3342–3350

Lebrun M, Mengaud J, Ohayon H, Nato F, Cossart P (1996).Internalin must be on the bacterial surface to mediate entryof Listeria monocytogenes into epithelial cells. Mol Micro-biol 21:579–592

Lenz LL, Mohammadi S, Geissler A, Portnoy DA (2003) SecA2-dependent secretion of autolytic enzymes promotes Listeriamonocytogenes pathogenesis. Proc Natl Acad Sci USA14:12432–12437

McDowell TD, Lemanski CL (1988) Absence of autolyticactivity (murein nicking) in penicillin-induced nonlyticdeath in a group A streptococcus. J Bacteriol 170:1783–1788

McLaughlan AM, Foster SJ (1997) Characterisation of themurein hydrolases of Listeria monocytogenes EGD. FEMSMicrobiol Lett 1:149–154

McLaughlan AM, Foster SJ (1998) Molecular characterization ofan autolytic amidase of Listeria monocytogenes EGD.Microbiol 144:1359–1367

Milohanic E, Jonquieres R, Coossart, Berche P, Gaillard J-L(2001) The autolysin Ami contributes to the adhesion ofListeria monocytogenes to eukaryotic cells via its cell wallanchor. Mol Microbiol 39:1212–1224

Oshida T, Suga M, Komatsuzawa H, Hong Y-M, Suginaka H,Tomasz A (1995) A Staphylococcus aureus autolysin thathas an N-acetylmuramoyl-L-alanine amidase domain and an

endo-b-N-acetylglucosaminidase domain: cloning, sequenceanalysis and characterization. Proc Natl Acad Sci USA92:285–292

Park JH, Lee YS, Lim YK, Kwon SH, Lee CU, Yoon BS (2000)Specific binding of recombinant Listeria monocytogenes p60protein to Caco-2 cells. FEMS Microbiol Lett. 186:35–40

Park SF, Stewart GS (1990) High-efficiency transformation ofListeria monocytogenes by electroporation of penicillin-treated cells. Gene 28:129–132

Pilgrim V, Kolb-Maurer A, Gentschev L, Goebel W, Kuhn M(2003a) Deletion of the gene encoding p60 in Listeriamonocytogenes leads to abnormal cell division and los ofactin-based motility. Infect Immun 71:3473–3484

Pilgrim V, Kolb-Maurer A, Gentschev L, Goebel W, Kuhn M(2003b) Deletion of the gene encoding p60 in Listeriamonocytogenes leads to abnormal cell division and loss ofactin-based motility. Infect Immun 71:3473–3484

Popowska M, Markiewicz Z (2004) Murein-hydrolyzing activityof flagellin FlaA of Listeria monocytogenes. Pol J Microbiol53:237–241

Portnoy DA, Chakraborty T, Goebel W, Cossart P (1992)Molecular determinants of Listeria monocytogenes patho-genesis. Infect Immun 60:1263–1267

Rychlewski L, Jaroszewski L, Li W, Godzik A (2000) Compar-ison of sequence profiles. Strategies for structural predic-tions using sequence information. Protein Sci 9:232–241

Sahl HG, Bierbaum G (1998) Lantibiotics: biosynthesis andbiological activities of uniquely modified peptides fromgram-positive bacteria. Annu Rev Microbiol 52:41–79

Sambrook J, Russel DW (2001) Molecular cloning. A laboratorymanual. Cold Spring Harbor Laboratory Press, Cold SpringHarbor

Schaferkordt S, Chakraborty T, (1995) Vector plasmid forinsertional mutagenesis and directional cloning in Listeriaspp. Biotechniques 19:720–725

Schlech WF (2000) Foodborne listeriosis. Clin Infect Dis 31:770–775

Schubert K, Bichlmaier AM, Mager E, Wolff K, Ruhland G,Fiedler F (2000) P45, an extracellular 45 kDa protein ofListeria monocytogenes with similarity to protein p60 andexhibiting murein lytic activity. Arch Microbiol 173:21–28

Schubert W-D, Gobel G, Diepholz M, Darji A, Kloer D, Hain T,Chakraborty T, Wehland J, Domann E, Heinz DW (2001)Internalins from the human pathogen Listeria monocytoge-nes combine three distinct folds into a contiguous internalindomain. J Mol Biol 312:783–794

Schubert WD, Urbanke C, Ziehm T, Beier V, Machner MP,Domann E, Wehland J, Chakraborty T, Heinz DW (2002)Structure of internalin, a major invasion protein of Listeriamonocytogenes, in complex with its human receptor E-cad-herin. Cell 111:825–836

Shockman GD, Holtje J-V (1994) Microbial murein (peptido-glycan) hydrolases. In: Ghuysen J-M, Hakenbeck R (eds)Bacterial Cell Wall pp. 131–144

Slamati L, Lereclus D (2002) A cell-cell signaling peptide acti-vates the PlcR virulence regulon in bacteria of the Bacilluscereus group. EMBO J 21:4550–4559

Smith TJ, Blackman SA, Foster SJ (2000) Autolysins of Bacillussubtilis: multiple enzymes with multiple functions. Microbiol146:249–262

Southwick FS, Purich DL (1996) Intracellular pathogenesis oflisteriosis. N Engl J Med 334:770–776

Spratt BG, Hedge PJ, te Heesen S, Edelman A, Broome-SmithJK (1986) Kanamycin-resistant vectors that are analogues ofplasmids pUC8, pUC9, pEMBL8 and pEMBL9. Gene141:337–342

Arch Microbiol (2006) 186:69–86 85

123

Tomasz A, Moreillon P, Pozzi G (1988) Insertional inactivationof the major autolysin gene of Streptococcus pneumoniae. JBacteriol 170:5931–5934

Vazquez-Boland JA, Kuhn M, Berche P, Chakraborty T, Do-minguez-Bernal G, Goebel W, Gonzales-Zorn B, WehlandJ, Kreft J (2001) Listeria pathogenesis and molecular viru-lence determinants. Clin Microbiol Rev 14:584–640

Wuenscher MD, Kohler S, Bubert A, Gerike U, Goebel W(1993) The iap gene of Listeria monocytogenes is essentialfor cell viability, and its gene product, p60, has bacteriolyticactivity J Bacteriol 175:3491–3501

86 Arch Microbiol (2006) 186:69–86

123