Name:

Unit 7 Molecular Genetics

Students will be able to:

7.1 Understand the structure and role of DNA

Explain the structure of DNA (monomer and polymer)

Discuss the process of DNA replication (basic steps, base pairing, semiconservative replication)

7. 2 Explain, based on evidence, how the structure of DNA determines the structure of proteins

Identify the differences between DNA and RNA

Understand that the different types of RNA (mRNA, tRNA, rRNA) carry out different roles in the

process of protein synthesis

Discuss the processes of transcription and translation

Explain how different types of mutations occur (point, frameshift, stop, silent) and predict the

consequences

7.3 Understand the recent advances in genetic research and the basics of biotechnology.

Discuss the social significance of using different technologies.

Understand the basics of various technologies:

o Genetic engineering and how it affects DNA

o Epigenetics and its influence on gene expression and DNA.

o CRISPR and its role in editing the genome

Keywords:

DNA

Double-helix

Genes

Nucleotides

Nitrogen base

Purines

Pyrimidines

Semi-conservative

replication

DNA Helicases

DNA polymerases

Transcription

Codon

Messenger RNA

Transfer RNA

Anticodon

Translation

Mutations

Trait

Genetic Engineering

CRISPR

Epigenetics

Molecular Genetics Unit

Date Topic

1/30 DNA Structure Notes

1/31 DNA Structure Model and Coloring

2/1 DNA Replication Notes and Practice

2/4 Course Selection with Counselors

2/5 Protein Synthesis-Transcription Notes and Coloring

2/6 Protein Synthesis-Translation Notes and Coloring

2/7 Protein Synthesis Practice

2/8 DNA Model Structure, Replication and Protein Synthesis

2/11 Regulation of Genes Notes and DNA Dan Activity

2/12 Protein Structure and Function Notes and Protein Folding Activity

2/13 Protein Synthesis Lego Activity

2/14 Mutation Notes and Card Activity

2/15-2/18 NO SCHOOL-Teacher Inservice, Presidents Day

2/19 Biotechnology Notes

2

1/30/19

Objective: Students will be able to describe the structure and function of DNA.

Warm-Up:

1. What are two things that I want you to know by the end of this unit?

2. When is your unit test?

7.1 Structure of DNA

DNA Discovery

Scientists’ originally believed proteins, not DNA, carried genetic information, due to the

___________________________________________________________.

o A series of experiments found that DNA was in fact the carrier of genetic information

_______________________ used x-ray diffraction to show DNA is a double helix

_______________________ used clues from the x-ray to build a model that explained the

specific structure and properties of DNA

What is DNA?

Stands for: _______________________________

Carries our genetic material from one generation to the next in ______________

DNA is arranged in a ___________________ -two strands are twisted around each other like a

winding staircase.

If you unwind a single human chromosome of DNA, it will be about ___________

What does our DNA do?

Only about ___________________________________ is made up of our genes.

• A is a series of DNA bases that are the instructions to make a

protein.

• All the genes together are called the .

Up until recently, scientists believed that the rest of our DNA was noncoding-they thought these

sequences were “_________”!

However, a research project called Encode studied these sections and found:

o Parts of the DNA that don’t code for genes contain about ______________

__________________________________________________________:

Determine when the gene turns on and off

_____________________________________________________

Switches for a variety of diseases

Affects every cell, but can do so at different times in our lifetime

2/20 Ghost in Our Genes Video

2/21 Epigenetics Webquest

2/22 Unit Review

2/25 Molecular Genetics Unit Test

3

Examples:

• Instructions for the cells to be different types of cells (brain cell vs liver

cell)

• Instructions for pancreas cell to make insulin after a meal

• Instructions for cells to reproduce to replace dead or damaged cells (like

skin cells replacing those that sloughed off).

Structure

Nucleic Acids: ____________________________________________________

________________________________________________________________

o Nucleotides are made up of 3 things:

A phosphate group (same on all nucleotides)

5 Carbon sugar molecule (same on all nucleotides)

_____________________________ (Different on each nucleotide)

Adenine (A) (__________________: 2 rings of

Guanine (G) Carbon and Nitrogen)

Thymine (T) (__________________: single ring of

Cytosine (C) Carbon and Nitrogen)

Draw a Purine and Pyrimidine in the space below:

o The phosphate of one nucleotide is attached to the sugar of the next nucleotide with a

__________________________ (strong)

o The base pairs on each strand of DNA are bound together with ________

______________ (weak)

Base pairing:

Purines are always paired with Pyrimidines

o __________ always pairs with _____________ (forms 2 hydrogen bonds)

o ___________ always pairs with ___________ (forms 3 hydrogen bonds)

This is called ___________________________-the sequence on one strand determines the

sequence on the other.

DNA has a direction-it is polar!

o It goes from the 5’ end to the 3’ end.

o The opposite strand also goes from the 5’ to the 3’ end,

4

Structure of DNA: Use the following key to color the diagram of DNA:

Phosphate group: Yellow

Sugar: Orange

Thymine: Red

Adenine: Purple

Cytosine: Blue

Guanine: Green

Hydrogen bonds: Pink

1/31/19

Objective: Students will be able to describe the structure and function of DNA.

Warm-Up:

1. Who is credited with discovering the structure of DNA?

2. Why did scientists think that proteins were the carries of genetic information,

not DNA?

3. What does the diagram on the right represent? Label the 3 parts: phosphate,

sugar, nitrogen base.

5

6

2/1/19

Objective: Students will be able to describe the process of DNA replication: steps, enzymes, base pairs

and semiconservative replication.

Warm-Up:

1. What nucleotide sequence represents the complement to the DNA strand: ATCGGATTC?

2. What Nitrogen bases are pyrimidines? Purines?

7.2 DNA Replication

As you read:

Underline Key Ideas

Draw an arrow to link ideas.

Put a question mark next to ideas that you don’t understand.

Think About It Before a cell divides, its DNA must first be copied. How might the double-helix

structure of DNA make that possible? What might happen if one of the nucleotides were damaged or

chemically altered just before the copying process? How might this affect the DNA inherited by each

daughter cell after cell division?

Copying the Code What role does DNA polymerase play in copying DNA?

When Watson and Crick discovered the structure of DNA, they immediately recognized one genuinely

surprising aspect of the structure. Base pairing in the double helix explains how DNA can be copied, or

replicated, because each base on one strand pairs with one-and only one-base on the opposite strand.

Each strand of the double helix therefore has all the information needed to reconstruct the other half by

the mechanism of base pairing. Because each strand can be used to make the other strand, the strands

are said to be complementary.

The Replication Process Before a cell divides, it duplicates its DNA in a

copying process called replication. This process, which occurs during late

interphase of the cell cycle, ensures that each resulting cell has the same

complete set of DNA molecules. During replication, the DNA molecule

separates into two strands and then produces two new complementary

strands following the rules of base pairing. Each strand of the double helix

of DNA serves as a template, or model, for the new strand.

Figure 12-8 shows the process of DNA replication. The two

strands of the double helix have separated, or “unzipped”, allowing two

replication forks to form. As each new strand forms, new bases are added

following the rules of base pairing. If the base on the old strand is

adenine, then thymine is added to the newly forming strand. Likewise,

Vocabulary:

Replication:

Picture:

7

guanine is always paired to cytosine. For example, a strand that had the base sequence TACGTT

produces a strand with the complementary base sequence ATGCAA. The result is two DNA molecules

identical to each other and to the original molecule. Note that each DNA molecule resulting from

replication has one original strand and one new strand.

The Role of Enzymes DNA replication is carried out by a series of enzymes. These enzymes first

“unzip” a molecule of DNA by breaking the hydrogen bonds between base pairs and unwinding the two

strands of the molecule. Each strand then serves as a template for the attachment of complementary

bases. You may recall that enzymes are proteins with highly specific functions. For this reason, they are

often named for the reactions they catalyze. The principal enzyme involved in DNA replication is called

DNA polymerase (PAHL ih mur ayz). DNA polymerase is an enzyme that joins individual nucleotides to

produce a new strand of DNA. Besides producing the sugar-phosphate bonds that join nucleotides

together, DNA polymerase also “proofreads” each new DNA strand, so that each molecule is a near-

perfect copy of the original.

What are two important roles of DNA polymerase?

8

Telomeres DNA at the tips of chromosomes are known as telomeres. (Figure

12-9). This DNA is particularly difficult to replicate. Cells use a special enzyme,

called telomerase, to solve this problem by adding short, repeated DNA

sequences to the telomeres. In rapidly dividing cells, such as stem cells and

embryonic cells, telomerase helps to prevent genes from being damaged or

lost during replication. Telomerase is often switched off in adult cells. In

cancer cells, however, telomerase may be activated, enabling these cells to

grow and proliferate rapidly.

Replication in Living Cells How does DNA replication differ in prokaryotic cells and eukaryotic cells?

DNA replication occurs during the S phase of the cell cycle. As we saw during the Cell Growth and

Division unit, replication is carefully regulated, along with the other critical events of the cycle so that it

is completed before a cell enters mitosis or meiosis. But where, exactly, is DNA found inside a living

cell?

The cells of most prokaryotes have a single, circular DNA molecule in the cytoplasm, containing

nearly all the cell’s genetic information. Eukaryotic cells, on the other hand, can have up to 1000 times

more DNA. Nearly all of the DNA of eukaryotic cells is found in the nucleus, packaged into

chromosomes. Eukaryotic chromosomes consist of DNA, tightly packed together with proteins to form a

substance called chromatin. Together, the DNA and histone molecules form beadlike structures called

nucleosomes. Histones, you may recall, are proteins around which chromatin is tightly coiled.

Prokaryotic DNA Replication In most prokaryotes, DNA

replication does not start until regulatory proteins bind to a

single starting point on the chromosome. These proteins then

trigger the beginning of the S phase, and DNA replication

begins. Replication in most prokaryotic cells starts from a

single point and proceeds in two directions until the entire

chromosome is copied. This process is shown in Figure 12-10.

Often, the two chromosomes produced by replication are

attached to different points inside the cell membrane and are

separated when the cell splits to form two new cells.

Eukaryotic DNA Replication Eukaryotic chromosomes are

generally much bigger than those of prokaryotes. In

eukaryotic cells, replication may begin at dozens or even

hundreds of places on the DNA molecule, proceeding in both

directions until each chromosome is completely copied.

Although a number of proteins check DNA for chemical

damage or base pair mismatches prior to replication, the

system is not foolproof. Damaged regions of DNA are

sometimes replicated, resulting in changes to DNA base

sequences that may alter certain genes and produce serious

consequences.

9

The two copies of DNA produced by replication in each chromosome remain closely associated

until the cell enters prophase of mitosis. At that point, the chromosomes condense, and the two

chromatids in each chromosome become clearly visible. They separate from each other in anaphase of

mitosis, producing two cells, each with a complete set of genes coded in DNA.

Using the chart below, describe how prokaryotic replication and eukaryotic replication are similar and

different.

Similarities Differences

Color the following diagram.

10

2/4/19-Course Selection with the Counselors

2/5/19

Objective: Students will be able to explain the differences between DNA and RNA and the different

types of RNA and their roles in protein synthesis and the steps of transcription.

Warm-Up:

1. Why is replication described as semiconservative?

2. What are the two enzymes that are used during replication? How do you know they are

enzymes?

7.3 Protein Synthesis- Transcription

A gene’s instructions for making proteins are coded in the sequence of nucleotides.

Making a protein happens in two steps: _________________________________

Both of these processes use the nucleic acid _______

Ribonucleic Acid (RNA)

A nucleic acid that is made up of linked nucleotides

Differs from ______ in 3 ways:

o RNA is a ____________ of nucleotides, not two strands

o RNA contains the 5 carbon sugar called _______, instead of deoxyribose

o RNA has the nitrogen bases A, C, G and ____________ instead of _____

A bonds with ____

C bonds with ____

U is considered a _____________

Transfer of DNA to RNA: Transcription

Transcription (mRNA Synthesis): ______________________________________

________________________________________________________________

____________________________

Steps of Transcription:

1. RNA polymerase _________________________- 3 nucleotides in a specific sequence.

Ex: AUG

2. RNA polymerase then _____________________ two strands of the _____________,

exposing the DNA nucleotides on each strand.

3. RNA polymerase ______ and then _____ complementary nucleotides as it

_________________________.

o Transcription follows the same base-pairing rules as DNA, but U pairs

with A instead of T.

4. RNA polymerase continues until it reaches a “______” codon (UUA, UGA, UAG)

11

5. DNA closes by reforming _________________ after the RNA polymerase adds

__________________o the strand.

Many strands of RNA are made at one time from a single double helix of DNA.

2/6/19

Objective: Students will be able to describe the process of translation and how the structure of DNA

determines the structure of proteins.

Warm-Up:

1. What are the three ways the DNA is different from RNA?

2. In the RNA strand, what bonds with Adenine? In the DNA strand?

3. What is the purpose of transcription?

7.4 Protein Synthesis- Translation

Types of RNA:

______________________: a form of RNA that carries the instructions from the DNA in the

nucleus to the site of protein synthesis in the cell: _______________

o The instructions are written as 3 nucleotide sequences called codons

o Each codon __________________________ or start or stop signal for translation

_______________________: a type of RNA that is found in the ribosome and accounts for 80%

of the RNA found in the cell.

_______________________: single strands of RNA that temporarily carries a specific amino acid

on one end.

o Contains the _____________: a 3 nucleotide sequence on a tRNA that is

______________________ to a codon on the mRNA strand.

Translation:

________________________________________________________________

o Takes place at the ribosomes, which attach to mRNA and travel its length

Steps of Translation:

1. mRNA leaves the nucleus and joins to _________ subunits in the ___________.

o The tRNA that carries the amino acid Methionine binds to the start codon on the

___________ strand, ________.

o ________________________________________________

2. The next codon on the ___________ strand binds to the ____________ on the ________ strand

carrying a specific________________

3. An enzyme binds the two amino acids carried by the tRNA, forming a _______________

4. The tRNA detaches, ________________________________________________

5. The ribosomes, containing rRNA, moves down the mRNA strand to the next codo. A tRNA

carrying the amino acid _________________________________.

12

6. _____________________________________ to the amino acid chain and the tRNA detaches

again.

7. Steps 2-6 are repeated until a stop codon is reached.

o Stop codons are: UAG, UAA, or UGA

o There is no complementary anticodon to these stop codons so there will be no

tRNA to fit into this spot. When that happens, the amino acid chain is released

into the cell.

Summary of protein synthesis:

In the nucleus, DNA uncoils and zips RNA nucleotides pair up with DNA bases to form mRNA

________________________________ tRNA adds amino acids using the mRNA strand

_____________________________

All cells have the same DNA, but differ due to some genes being expressed in some cells and not

others.

Key:

13

2/7/19

Objective: Students will be able to describe how the structure of DNA determines the structure of

proteins and how the genes lead to our traits.

Warm-Up:

1. Where is a codon found? An anticodon?

2. What is the start codon?

3. Where does transcription take place? Translation?

2/8/19

Objective: Students will be able to describe how the structure of DNA determines the structure of

proteins and how the genes lead to our traits.

Warm-Up: Use the following mRNA strand to answer the following questions.

mRNA strand: AUA/GGC/AGU/CCA

1. What is the original DNA strand that represents this mRNA strand?

2. What are the anticodons for the mRNA strand?

3. What portion of the protein molecule is coded for by the piece of mRNA? (Hint: use your codon

table)

2/11/19

Objective: Students will be able to describe how the structure of DNA determines the structure of

proteins and how the genes lead to our traits.

Warm-Up:

1. Is photocopying a document similar to DNA replication? Think of the original materials, the

copying process, and the final products. Explain how the two processes are alike. Identify major

difference.

14

7.5 Gene Regulation and Expression

Remember:

A gene is a series of DNA bases that are the instructions to make a .

Only a small percentage of the genome makes up our genes-

called .

The majority of our genetic sequence acts as “switches”-

called .

All somatic cells contain the entire genome but do not need to transcribe all of their genes at

the same time!

o The environment as well as internal signals tell the cell to

transcribe.

Prokaryotic Gene Regulation

Prokaryotic cells turn genes on and off by controlling .

Some of these regulatory proteins help switch genes on, while others turn genes off

The genes in bacteria are organized into -a group of genes that are

regulated together and usually have related functions.

Operon Structure

o On each side of the operon’s genes is a regulatory region

A is a DNA segment that allows a gene to be transcribed

by allowing RNA polymerase to bind.

An is part of DNA that turns a gene “on” and “off”

o An operon includes a promotor, and operator, and one or more structural that

code for all the proteins needed to do a job.

The lac operon was one of the first examples of gene regulation to be

discovered

The lac operon has three genes that code for enzymes that break down lactose.

o Example:

The lac operon acts like a switch

The lac operon is “off” when lactose is not present

The lac operon is “on” when lactose is present.

Eukaryotic Gene Regulation

Eukaryotes genes expression at many points

o sets of are expressed in different types

of .

o Transcription is controlled by regulatory DNA sequences and transcription factors.

Regulatory DNA Sequences

o Most Eukaryotes have a promotor-this is a DNA

sequence that is found just a gene.

This box binds a protein that helps position

Transcription Factors

o Transcription factors are that bind to the DNA at the regulatory

region (TATA box)

15

o Transcription factors either encourage the gene to be expressed OR they keep the gene

from being expressed

o Gene promotors (TATA box) have binding sites for transcription

factors

Some factors activate many genes all at once, dramatically changing patterns of

gene expression in the cell

Only form a response to chemical signals (like hormones)

Other factors: mRNA leaving the nucleus, stability of the mRNA strand,

breakdown of a gene’s protein, uncoiling tightly packed chromatin

o Multiple transcription factors must bind before RNA polymerase can bind to the

promotor region-they the !

mRNA Processing

o RNA processing is also an important part of gene regulation in Eukaryotes.

o mRNA processing includes 3 major steps:

are

and

are spliced

A is added

A is added

RNA Interference

o Most cells contain small RNA molecules that with mRNA

o A “dicer” enzyme cuts the interfering RNA into strands about long.

o These small strands of RNA to proteins to form a

complex.

o The silencing complex binds to the complementary mRNA to it to

keep them from making a .

Genetic Control of Development

Regulating gene expression is especially important during the of an

organism-each cell in the adult originates from the same single cell!

Gene regulation helps cells undergo -becoming specialized cells

o As development occurs, different sets of genes are regulated by transcription factors

and repressors.

Edward B. Lewis’ Fruit Fly Experiment

o First to show that a specific controls the identities of body

parts in the embryo of the common fruit fly.

A mutation in one of these genes resulted in a leg instead of an antenna!

o The result: : a set of that

regulates organs that develop in specific parts of the body.

Master control genes are like that trigger particular patterns

of development and differentiation in cells and tissues.

Two important types: Homeobox genes and HOX genes

Homeobox Genes

o Molecular studies of the DNA show that the homeotic genes share a very similar 180

base DNA sequence-named Homeobox genes

16

code for that

activate other genes that are important in cell development and differentiation.

When these genes are activated in certain regions of the body, they encourage

growth of the in that region.

HOX Genes

o Appear in a cluster

o determines the identities of each of a

fly’s body.

o Arranged in the exact order they are expressed from head to foot.

o living organisms have HOX genes that function in the same way.

Environmental Factors

o Environmental factors like temperature, salinity, and nutrient availability can influence

gene expression.

The environmental factors can / transcription

factors that will function at the molecular level.

Examples:

Lac operon in E. coli is switched on only when lactose is present

Metamorphosis

2/12/19

Objective: Students will be able to describe how the structure of DNA determines the structure of

proteins and how the genes lead to our traits.

Warm-Up:

The nucleotides in DNA include the nitrogenous bases adenine, cytosine, guanine, and thymine. The

energy from UV light can produce chemical changes in these bases, damaging the DNA molecule and

producing errors when DNA is replicated.

1. Using your understanding of gene expression, describe how UV light might change the function

of a cell.

2. Using your understanding of the cell cycle, explain how the UV light might cause cancer.

7.6 Proteins

Structural Proteins

Fibrous proteins that create provide structure of the body.

o ________________________: protein for hair and nails

o ________________________: proteins of muscle tissue

o ________________________: protein for ligaments, tendons and skin

Functional Proteins

17

Functional proteins perform a specific function within the body.

o _____________________: Proteins such as enzymes are catalysts for reactions

o ___________________________: Proteins such as antibodies help fight disease

o __________________: Protein hormones such as insulin communicate between cells

and cell receptors help transport substances across the cell membrane.

Basic Structure

Monomer: _____________

Contains the following molecules: __________

Amino Acids have common features.

o ________________________________________

o ________________________________________

o ________________________________________

o _____________ -different for each Amino Acid

Polar or Non-Polar (Hydrophilic or Hydrophobic)

Acidic or Basic

Contains Sulfur (forms disulfide bridges)

o Draw an Amino Acid below.

Proteins in the Body

o There are 20 different amino acids used the body.

o The body can synthesize 12 of the amino acids, but the rest must come from food.

Complex-polymer

o Proteins are made up of __________ of _____________________

o The chain of amino acids is called a __________________ .

The bond between amino acids is called a and is

created through dehydration synthesis.

o Amino acids within the polypeptide interact with each other to create a well-defined 3-

D structure. The correct structure is essential to the function of the protein.

o 4 Levels of Protein Structure-Protein Folding

Called the “backbone”

18

Primary Structure: of

in the chain

Determined by the gene on the DNA

Secondary Structure: folding along short

sections of the polypeptide

Caused by an interaction between the elements

in the of amino

acids

Forms an helix or a pleated sheet

Tertiary Structure: whole molecule folding

caused by interactions between

in distant

.

Acids bond to bases

Hydrophilic bonds to hydrophilic

Hydrophobic bonds to hydrophobic

Sulfur bonds to sulfur (creates disulfide bridges)

Quaternary Structure:

bonding to form a protein.

When proteins lose their function:

Proteins can be __________________ .

o Ex: ____ causes it to lose its shape and its functionality.

o __ can also cause the protein to lose its shape and functionality.

Proteins in Food: There are 8 essential amino acids that must be obtained from food.

Animal products, ______________________________________________, generally contain all

eight essential amino acids.

Plant-based foods, _______________________________________, do not and must be eaten in

combination with other foods to obtain all 8 essential amino acids.

Example: ____________________________

2/13/19

Objective: Students will be able to explain how different types of mutations occur (point, frameshift,

stop, silent) and predict the consequences to the protein.

Warm-Up:

1. If every cell contains the same DNA, why do different types of cells have different functions?

19

7.7 Mutations

What are mutations?

Mutations: _______________________________

An organisms traits are based on their DNA sequence because: DNA sequence amino acid

sequence protein shape function trait

If there are changes in the DNA sequence, it can lead to changes in traits.

Types of Mutations:

______________________: Change to one letter (base) in the DNA

______________________: Addition or deletion of a letter (base) in the DNA sequence.

o Both of these shift the DNA so it changes how the codons are read.

_____________________: Causes the protein to stop forming prematurely or causes continued

translation beyond where the stop would be.

_____________________: Changes in the number or structure of chromosomes

______________________: Mutations in the DNA that do not significantly alter the expression

of genes.

Causes of Mutations:

________________________________________________________________

External agents cause DNA to break down.

o Examples: Environmental toxins, radiation, smoke, etc.

2/14/19

Objective: Students will be able to describe how the structure of DNA determines the structure of

proteins and how the genes lead to our traits.

Warm-Up:

1. What do all amino acids have in common?

2. How are an enzyme and substrate related? How does this relate to protein folding?

2/15/19-2/18/19-NO SCHOOL-Teacher In-service and President’s Day

2/19/19

Objective: Students will be able to describe the recent advances in genetic research and the basics of

biotechnology (CRISPR and Epigenetics) and discuss the social significance of using different

technologies.

Warm-Up:

1. None

20

7.8 Biotechnology

As you read:

Underline Key Ideas

Draw an arrow to link ideas.

Put a question mark next to ideas that you don’t understand.

Think About It Suppose you have an electronic game you want to change. Knowing that the game

depends on a coded program in a computer microchip, how would you set about rewriting the

program? First you’d need a way to get the existing program out of the microchip. Then you’d have to

read the program, make the changes you want, and put the modified code back into the microchip.

What does this scenario have to do with genetic engineering? Just about everything. Genetic

engineering is one type of Biotechnology: the application of a technological process, invention, or

method to living organisms.

Copying DNA How do scientists copy the DNA of living organisms?

It is relatively easy to extract DNA from cells and tissues. The extracted DNA can be cut into

fragments of manageable size using restriction enzymes. These restriction fragments can then be

separated according to size using gel electrophoresis or anther similar technique. That’s the easy part.

The tough part comes next: How do you find a specific gene?

The problem is huge. If we were to cut DNA from a bacterium like E. coli into restriction

fragments averaging 1000 base pairs in length, we would have 4000 restriction fragments. In the human

genome, we would have 3 million restriction fragments. How do we find the DNA of a single gene

among millions of fragments? In some respects, it’s the classic problem of finding a needle in a

haystack-we have an enormous pile of hay and just one needle.

Finding Genes In 1987, Douglas Prasher, a biologist at Woods Hole Oceanographic Institute in

Massachusetts, wanted to find a specific gene in a jellyfish. The gene he hoped to identify is the one

that codes for molecules called green fluorescent protein, or GFP.

To find the GFP gene, Prasher worked backwards. He first studied the amino acid sequence for

part of the GFP protein. Using a codon table, he was able to predict the base sequence on a strand of

mRNA. Next, Prasher used a complementary base sequence to “attract” a full mRNA strand that

matched his partial sequence and would bind to that sequence by base pairing. After screening a

genetic “library” with thousands of different mRNA sequences from jellyfish, he found one that bound

perfectly.

After Prasher located the mRNA that produced GFP, he set out to find the actual gene. Taking a

gel in which restriction fragments from the jellyfish genome had been separated, he found that one of

the fragments bound tightly to the mRNA. That fragment contained the actual gene for GFP, which is

now widely used to label proteins in living cells. The method he used, shown in the figure below, is

called Southern blotting. Today it is often quicker and less expensive for scientists to search for genes in

computer databases where the complete genomes or many organisms are available.

21

Use Prasher’s method to find the gene for the following partial amino acid sequence.

Partial Amino Acid Sequence: Tyrosine-Tryptophan-Histidine

mRNA:

DNA:

Gene 1: CCGTAGCTTTCACTCTCAGGCGATGCGATG

Gene 2: CGTATAGCTCGATGACCGTGCGATCGCTAG

Gene 3: CTAGATCGCTAGCTACGACTTTCGCATATG

Polymerase Chain Reaction Once they find a gene, biologists

often need to make many copies of it. A technique known as

polymerase chain reaction (PCR) allows them to do exactly that.

At one end of the original piece of DNA, a biologist adds a short

piece of DNA that complements a portion of the sequence. At

the other end, the biologist adds another short piece of

complementary DNA. These short pieces are known as primers

because they prepare, or prime, a place for DNA polymerase to

start working.

As the figure to the right suggests, the idea behind the

use of PCR primers is surprisingly simple. The first step in using

the polymerase chain reaction method to copy a gene is to heat a

piece of DNA, which separates into its two strands. Then, as the

DNA cools, primers bind to the single strands. Next, DNA

polymerase starts copying the region between the primers.

These copies can serve as templates to make still more copies. In

this way, just a few dozen cycles of replication can produce

billions of copies of the DNA between the primers.

Where did Kary Mullis, the American scientist who

invented PCR, find a DNA polymerase enzyme that could stand

repeated cycles of heating and cooling? Mullis found it in

bacteria from the hot springs of Yellowstone National Park in the

22

northwestern United States-a powerful example of the importance of biodiversity to biotechnology!

List the steps of PCR below.

Changing DNA How is recombinant DNA used?

Just as they were beginning to learn how to read and analyze DNA sequences, scientists began

wondering if it might be possible to change the DNA of a living cell. As many of them realized, this feat

had already been accomplished decades earlier. Do you remember Griffith’s experiments on bacterial

transformation? During transformation, a cell takes in DNA from outside the cell, and that added DNA

becomes a component of the cell’s own genome. Today, biologists understand the Griffith’s extract of

heat-killed bacteria contained DNA fragments. When he mixed those fragments with live bacteria, a few

of them took up the DNA molecules, transforming them and changing their characteristics. Griffith, of

course, could only do this with DNA extracted from other bacteria.

Combining DNA Fragments With today’s technologies, scientists can produce custom-built DNA

molecules in the lab and then insert those molecules-

along with the genes they carry-into living cells. The first

step in this sort of genetic engineering is to build a DNA

sequence with the gene or genes you’d like to insert into

a cell. Machines known as DNA synthesizers can produce

short pieces of DNA, up to several hundred bases in

length. These synthetic sequences can then be joined to

natural sequences using DNA ligase or other enzymes

that splice DNA together. These same enzymes make it

possible to take a gene from one organism and attach it

to the DNA of another organism, as shown in the figure to

the left. The resulting molecules are called recombinant

DNA. This technology relies on the fact that any pair of

complementary sequences tends to bond, even if each

sequence comes from a different organism.

Recombinant-DNA technology-joining together DNA from

two or more sources-makes it possible to change the

genetic composition of living organisms. By manipulating

DNA in this way, scientists can investigate the structure and function of genes.

Calculate: How many copies of the

DNA fragment in the diagram on the

previous page will there be after six

PCR cycles?

23

Plasmids and Genetic Markers Scientists working with recombinant DNA soon discovered that

many of the DNA molecules they tried to insert into host cells

simply vanished because the cells often did not copy, or replicate,

the added DNA. Today scientists join recombinant DNA to another

piece of DNA containing a replication “start” signal. This way,

whenever the cell copies its own DNA, it copies the recombinant

DNA too.

In addition to their own large chromosomes, some bacteria

contain small circular DNA molecules known as plasmids. Plasmids,

like those shown in Figure 15-9, are widely used in recombinant

DNA studies. Joining DNA to a plasmid, and then using the

recombinant plasmid to transform bacteria, results in the

replication of the newly added DNA along with the rest of the cell’s

genome.

Plasmids are also found in yeasts, which are single-celled eukaryotes that can be transformed

with recombinant DNA as well. Biologists working with yeasts can construct artificial chromosomes

containing centromeres, telomeres, and replication start sites. These artificial chromosomes greatly

simplify the process of introducing recombinant DNA into the yeast genome.

The figure below shows how bacteria can be transformed using recombinant plasmids. First, the

DNA being used for transformation is joined to a plasmid. The plasmid DNA contains a signal for

replication, helping to ensure that if the DNA does get inside a bacterial cell, it will be replicated. In

addition, the plasmid also has a genetic marker, such as a gene for antibiotic resistance. A genetic

marker is a gene that makes it possible to distinguish bacteria that carry the plasmid from those that

don’t. Using a genetic markers, researchers can mix recombinant plasmids with a culture of bacteria,

add enough DNA to transform just one cell in a million, and still locate that one cell. After

transformation, the culture is treated with an antibiotic. Only those rare cells that have been

transformed survive, because only they carry the resistance gene.

Figure: Plasmid DNA Transformation Scientists can insert a piece of DNA into a plasmid if both the

plasmid and the target DNA have been cut by the same restriction enzymes to create sticky ends. With

this method, bacteria can be used to produce human growth hormone. First, a human gene is inserted

into bacterial DNA. Then, the new combination of genes is returned to a bacterial cell, which replicates

the recombinant DNA over and over again. Why might scientists want to copy the gene for human

growth hormone?

24

Transgenic Organisms How can genes from one organism be inserted into another organism?

The universal nature of the genetic code makes it possible to construct organisms that are transgenic,

containing genes from other species. Transgenic organisms can be produced by the insertion of

recombinant DNA into the genome of a host organism. Like bacterial plasmids, the DNA molecules used

for transformation of plant and animal cells contain genetic markers that help scientists identify which

cells have been transformed.

Transgenic technology was perfected using mice in the 1980’s. Genetic engineers can now

produce transgenic plants, animals, and microorganisms. Be examining the traits of genetically modified

organism, it is possible to learn about the function of the transferred gene. This ability has contributed

greatly to our understanding of gene regulation and expression.

Transgenic Plants Many plant cells can be transformed

using Agrobacterium. In nature this bacterium inserts small

DNA plasmid that produces tumors in a plant’s cells.

Scientists can deactivate the plasmid’s tumor-producing gene

and replace it with a piece of recombinant DNA. The

recombinant plasmid can then be used to infect and

transform plant cells, as shown in the figure to the right.

There are other ways to produce transgenic plants as

well. When their cell walls are removed, plant cells in culture

will sometimes take up DNA on their own. DNA can also be

injected directly into some cells. If transformation is

successful, the recombinant DNA is integrated into one of the

plant cell’s chromosomes.

Transgenic Animals Scientists can transform animal cells

using some of the same techniques used for plant cells. The

egg cells of many animals are large enough that DNA can be

injected directly into the nucleus. Once the DNA is in the

nucleus, enzymes that are normally responsible for DNA

repair and recombination many help insert the foreign DNA

into the chromosomes of the injected cell.

Recently it has become possible to eliminate particular

genes by carefully engineering the DNA molecules that are

used for transformation. The DNA molecules can be

constructed with two ends that will sometimes recombine

with specific sequences in the host chromosome. Once they

do, the host gene normally found between these two

sequences may be lost or specifically replaced with a new

gene. This kind of gene replacement has made it possible to

pinpoint specific functions of genes in many organisms,

including mice.

25

Cloning A clone is a member of a population of genetically identical cells produced from a single cell.

The technique of cloning uses a single cell from an adult organism to grow an entirely new individual

that is genetically identical to the organism from which the cell was taken.

Cloned colonies of bacteria and other microorganisms are easy to grow, but this is not always

true of multicellular organisms, especially animals. Clones of animals were first produced in 1952 using

amphibian tadpoles. In 1997, Scottish scientist Ian Wilmut stunned biologists by announcing that he had

produced a sheep, called Dolly, by cloning.

The figure below shows the basic steps by which an animal can be cloned. First, the nucleus of

an unfertilized egg is removed. Next, the egg cell is fused with a donor cell that contains a nucleus,

taken from an adult. The resulting diploid egg develops into an embryo, which is then implanted in the

uterine wall of a foster mother, where it develops until birth. Cloned cows, pigs, mice, and even cats

have since been produced using similar techniques.

Apply Concepts: Why won’t the cloned lamb resemble its foster mother?

2/20/19

Objective: Students will be able to describe the recent advances in genetic research and the basics of

biotechnology (CRISPR and Epigenetics) and discuss the social significance of using different

technologies.

Warm-Up: (3 Questions)

1. What is a mutation?

2. What are some causes of mutations?

26

3. Identify each type of mutation a. TCAGGCAGC becomes TCAGGAGC ______________________________ b. TCAGGCAGC becomes TCACGCAGC _____________________________ c. TCAGGCAGC becomes TCATGGCTAGC ___________________________

2/21/19

Objective: Students will be able to describe the recent advances in genetic research and the basics of

biotechnology (CRISPR and Epigenetics) and discuss the social significance of using different

technologies.

Warm-Up:

1. What surprised you the most about epigenetics?

2. What changes could you make in your life today that would have an effect on your epigenetics

and potential offspring?

2/22/19

Objective: Students will be able to describe their knowledge of molecular genetics on a unit review.

Warm-Up:

1. Go back to the front page of this packet and read through the essential outcomes. Put a

question mark next to the topics that you still have questions about. Put a check mark next to

the topics that you feel confident about.

2. How are you going to go about learning those topics that have a question mark next to them?

2/25/19

Objective: Students will be able to describe their knowledge of molecular genetics on a unit exam.

Warm-Up:

1. Turn in your homework to the basket.