2012 10-24 - ngs webinar

Sample & Assay Technologies

GeneRead DNAseq Targeted Exon Enrichment & GeneRead Library Quantification System for

Next Generation Sequencing

Shankar Sellappan, Ph.D.Global Product Manager

[email protected]

Sample & Assay Technologies Pathway-Focused Analysis Tools

2

Sample & Assay Technologies GeneRead DNAseq & Library Quant NGS System

3

Agenda

Introduction Targeted Enrichment Workflow Principles Data Analysis Pathway Content Performance Data Application Example

Library Quantification Workflow Application Example

Summary

Sample & Assay Technologies Biological Markers Define Biological Processes

Cell cycle Angiogenesis

P53MDM2CyclinsCDKs

VEGFbFGF

ANGPTPDGF

IL8TLRIFNγTNFβ

Indi

vidu

al

part

icip

ants

Inflammation

4

Sample & Assay Technologies Complete Biological Story

Built on Pathway / Network Analysis

5

Path

way

Cell cycle Angiogenesis Inflammation

Sample & Assay Technologies Determining DNA Differences

Patient sample = ATGCCATCTGGGACGGGTCAGTAGWild-type = ATGCCATCTGTGACGGGTCAGTAG

How could that SINGLE base difference make the person sick?

Let’s look at the amino acids that are translated in both samples:

Patient sample DNA = ATG CCA TCT GGG ACG GGT CAG TAGAmino Acid Sequence = Met P S G T G Q Stop

Compare the two amino acid sequences:

Patient sample AA Sequence = Met P S G T G Q StopWild-Type AA Sequence = Met P S V T G Q Stop

Valine Glycine

If the wild-type protein, with the Valine positioned here, looked like:

and in the patient sample, it is a Glycine, and it looks like:

Well….the protein just won’t work.6

Sample & Assay Technologies What is NGS (Next Generation Sequencing)?

Massively Paralleled Sequencing

7

Instead of sequencing a DNA sequence from

Sequence many small pieces at the same time

Sample & Assay Technologies When doing NGS analysis, what are you looking for?

Easy-to-use workflow and Data output

Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample

Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered.

8

Sample & Assay Technologies Your NGS research needs

9

Identify low frequency DNA mutation variantsWork with low quality DNA samples, such as FFPE

samplesFocus efforts on a focused set of genes important to

their research Simple methodology to make variant callsSelective sequencing saves sequencing capacity

Sample & Assay Technologies Traditional NGS Workflow

Isolate DNA

Library Prep & Quantification

NGS

Sequence Analysis & Variant ID

• Whole genome analysis• Too much irrelevant data• Poor quality reads / coverage

10

Sample & Assay Technologies New NGS Workflow with Targeted Enrichment

11

• Focused on your genes of interest• Why look at all 20,000

genes in the human genome when you are interested in only a few?

• Enables deep sequencing to ID low frequency mutation / rare variants

• Integrated controls to assess target enrichment

Achieve more sensitive mutation detection with 1 additional step

80 ng

Sample & Assay Technologies Target Enrichment: Principles

Multiplex PCR-enabled enrichment of gene of interest

Division of non-adjacent gene primer sets into 4 tubes increases amplification specificity.

12

We provide primer sets that produce overlapping PCR products• For any gene or set of genes in the human genome

Sample & Assay Technologies Targeted Enrichment: Details

13

~ 150 bp PCR products

Sample & Assay Technologies Complete Analysis Workflow

With integrated controls to assess sample quality / TE process

14

Sample & Assay Technologies NGS Sequence Analysis and Variant ID Software

FREE Complete & Easy to use Data Analysis with Web-based Software

15

Sample & Assay Technologies Read Mode: Paired End vs Single End

Goal: Increased # of Reads / Amplicon

TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA

Single End Sequencing:

Paired End Sequencing (both ends are sequenced):

Sequence of Interest:



AGTCGATCGTGATGCTGCTAGTCGTCAATGGCGTAGCTACGCAT

Sample & Assay Technologies How Genes on Panels Are Selected

Genes Involved in Disease

Genes with High Relevance

Comprehensive Cancer Panel (124 genes)

Disease Focused Gene Panels (20 genes)

Breast cancer

Colon Cancer

Gastric cancer

Leukemia

ALSO AVAILABLE: Custom Panels from ANY GENE or COLLECTION OF GENES in Human Genome

Biologically relevant gene content Clinically relevant: Published association with the

disease state – Multiple Publically accessible databases– Text mining tools– Manually curated

Technically relevant gene content Most frequently mutated genes Specific feedback from the thought leaders

Liver cancer

Lung Cancer

Ovarian Cancer

Prostate Cancer

17

Sample & Assay Technologies Targeted Enrichment: Panel Information

Sample & Assay Technologies NGS Target Enrichment Design Strategy

Commonly encountered issues solved by GeneRead Algorithm

20

• Design Coverage• How much of the gene is covered by your amplicons

• Sequence Coverage Uniformity• How much ease base pair is covered: Ideally, it should be uniform

• Specificity• % of reads mapped back to your sequence of interest

Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data

Design coverage

% C

over

ed b

y D

esig

n

Discover more potential variants by covering more exons for genes of interest in assay design

GeneRead DNAseq Custom Panel

GeneRead DNAseq Lung Cancer Panel

GeneRead DNAseq Comprehensive Cancer Panel

21


Sequence coverage uniformity

More bases sequenced above minimum read depth, generating more high-quality consensus calls.




22

GeneRead DNAseq Gene Panel: Performance data


Specificity (On-target reads)*

Spec

ifici

ty(%

on-

targ

et re

ads)

No wasting of sequencing capacity




* On-Target Reads= Number of reads on target out of total number of reads per run

23

GeneRead DNAseq Gene Panel: Performance data

Sample & Assay Technologies DNAseq Gene Panel Application Data

KRAS:G12V is present in all three FFPE lung adenocarcinomas

Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample

Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered.

NOTE: KRAS mutations confirmed by either Pyro or ARMS mutation assays (qBiomarker Somatic Mutation PCR Array)

24


Where does Library Quantification fit within the NGS workflow?

Next-generation sequencing workflow

GeneRead (DNAseq) Library Quantification and QC System

Sample enrichment

Purificationand

amplification

Library preparation

Next generation sequencing run

Result verification

Why do you want to:1. quantify their NGS DNA libraries2. know the quality of their NGS DNA libraries?

You have to, in order to ensure high quality reads Sequencing runs are expensive and time consuming, therefore, you want to ensure that

downstream sequencing analyses are performed on samples of adequate quality for NGS technology.

(Optional)

25

Sample & Assay Technologies Your needs

26

Your needs

Simple and easy to perform method, with convenient and high-throughput format

Fast Reliable and accurate quantification of sequencing targets Unmet need: Assess quality of target enriched DNA

Efficient use of NGS capacity

NGS methodology needs Too much DNA

Mixed signals and un-resolvable data Too little DNA

Reduced sequencing coverage Reduced read depth Empty runs Increase cost per run Wasted time

Potential problems in NGS if library not quantified

Potential methods for library QC qPCR Bioanalyzer Qubit

Sample & Assay Technologies Why choose qPCR for NGS Library Quantification?

1. BioAnalyzer measures total nucleic acids- Why is this a problem?

27

- For each technology, the greater the concentration of each sample (X-axis), the greater the # of clusters

- This should be a linear relationship

- Only qPCR provides this

2. Low limit of detection

3. Consistency of results

Sample & Assay Technologies NGS Library Quantification Made Easy

Adapters can be quantified with qRT-PCR

28

Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis.

Step 1: You have your DNA (whole genome or target enriched)

Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platform-specific adapters NOTE: The adapters are short pieces of DNA

Step 3: We provide you 2 reagents:1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters

Sample & Assay Technologies NGS Library Quantification Made Easy

Adapters can be quantified with qRT-PCR

29

Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis.

Step 1: You have your DNA (whole genome or target enriched)

Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platform-specific adapters NOTE: The adapters are short pieces of DNA

Step 3: We provide you 2 reagents:1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters

Sample & Assay Technologies GeneRead Library Quantification System

NGS library quantification for any sequencing application

30

, Ion Proton

Sample & Assay Technologies GeneRead DNAseq & LQ System: Summary

Focused: Biologically relevant content selection enables deep sequencing on

relevant genes and identification of rare mutations

Flexible: Mix and match any gene of interest

NGS platform independent: Functionally validated for IT PGM, MiSeq/HiSeq

Integrated controls: Enabling quality control of prepared library before sequencing

Free, complete and easy of use data analysis tool31


Questions?Contact Technical Support: 9 AM – 6 PM M – F ET

Contact: 1-800-742-4368 OR [email protected]

Shankar Sellappan, Ph.D. (Global Product Manager)[email protected]

Ph.D. Trained Application Scientists Available Before, During, and After Your Experiments for Consultation / Help

GeneRead DNAseq Panel & Library Quant System for NGS

32

2012 10-24 - ngs webinar

Documents

Transcript of 2012 10-24 - ngs webinar