2009 2010 supplemental app0001

12

Transcript of 2009 2010 supplemental app0001

Page 1: 2009 2010 supplemental app0001
Page 2: 2009 2010 supplemental app0001
Page 3: 2009 2010 supplemental app0001
Page 4: 2009 2010 supplemental app0001
Page 5: 2009 2010 supplemental app0001
Page 6: 2009 2010 supplemental app0001
Page 7: 2009 2010 supplemental app0001
Page 8: 2009 2010 supplemental app0001
Page 9: 2009 2010 supplemental app0001
Page 10: 2009 2010 supplemental app0001
Page 11: 2009 2010 supplemental app0001
Page 12: 2009 2010 supplemental app0001

Tank 200-7 Supplemental Report to DEQ Nov 2009 44087710

Tank 200-7 Supplemental Report to DEQ Nov 2009 44087710

Supplemental Pension Plan Funding Relief Provisions Pension Seminar April 15, 2009 1.

Supplemental Pension Plan Funding Relief Provisions Pension Seminar April 15, 2009 1.

App0001 - w3.ual.es

App0001 - w3.ual.es

2009 Supplemental Bios

2009 Supplemental Bios

SUPPLEMENTAL - SNL · 2009. 8. 6. · This supplemental information package contains certain forward-looking statements within the meaning of Section 27A of the Securities Act of

SUPPLEMENTAL - SNL · 2009. 8. 6. · This supplemental information package contains certain forward-looking statements within the meaning of Section 27A of the Securities Act of

2006 Supplemental Transportation Budget - …leap.leg.wa.gov/leap/budget/lbns/2006partvi.pdfAgency Summary Report ... 2006 Supplemental Transportation Budget ... 2009), and then annual

2006 Supplemental Transportation Budget - …leap.leg.wa.gov/leap/budget/lbns/2006partvi.pdfAgency Summary Report ... 2006 Supplemental Transportation Budget ... 2009), and then annual

PROPOLIS and CANCER An Alternative and Supplemental Therapy CMAC 2009 Glenn Perry.

PROPOLIS and CANCER An Alternative and Supplemental Therapy CMAC 2009 Glenn Perry.

Supplemental Information Fourth Quarter 2009

Supplemental Information Fourth Quarter 2009

Supplemental material Supplemental figures

Supplemental material Supplemental figures

The Impact of the 2009 Special Supplemental Nutrition ...

The Impact of the 2009 Special Supplemental Nutrition ...

Accommodations and Supplemental Aids 2009-2010. Agenda Introductions It’s the LAW! Accommodations Manual Navigating TEA website Supplemental Aids a. Appendix.

Accommodations and Supplemental Aids 2009-2010. Agenda Introductions It’s the LAW! Accommodations Manual Navigating TEA website Supplemental Aids a. Appendix.

Senate & House Conference Budget and Legislation for K-12 Education 2009-11 Biennium 2009-10 and 2010-11 SY 2009 Supplemental, 2008-09 SY April 30, 2009.

Senate & House Conference Budget and Legislation for K-12 Education 2009-11 Biennium 2009-10 and 2010-11 SY 2009 Supplemental, 2008-09 SY April 30, 2009.

March 2009 Supplemental Order/Late Labels and Extended Data Corrections 1 2009 STAR Supplemental Order/Late Labels and Extended Data Corrections Webcast.

March 2009 Supplemental Order/Late Labels and Extended Data Corrections 1 2009 STAR Supplemental Order/Late Labels and Extended Data Corrections Webcast.

DRAFT SUPPLEMENTAL FACT SHEET › ... › 2009 › Jul › item8 › SupDoc5_Fa… · DRAFT Supplemental Fact Sheet 18 June 09 Page 1 of 51 . DISCUSSION: Revised Tentative Order No.

DRAFT SUPPLEMENTAL FACT SHEET › ... › 2009 › Jul › item8 › SupDoc5_Fa… · DRAFT Supplemental Fact Sheet 18 June 09 Page 1 of 51 . DISCUSSION: Revised Tentative Order No.

App0001 - MarketClub · 2007. 12. 4. · Title: App0001.bmp Author: Kathy Redington Created Date: 6/20/2003 8:29:55 PM

App0001 - MarketClub · 2007. 12. 4. · Title: App0001.bmp Author: Kathy Redington Created Date: 6/20/2003 8:29:55 PM

Supplemental Materials and Methods Protein, primers ...genesdev.cshlp.org/content/suppl/2009/04/29/gad...Apr 29, 2009  · MG1655, MIT17, MIT78 and MIT80 using P1 transduction. 5 Supplemental

Supplemental Materials and Methods Protein, primers ...genesdev.cshlp.org/content/suppl/2009/04/29/gad...Apr 29, 2009  · MG1655, MIT17, MIT78 and MIT80 using P1 transduction. 5 Supplemental

Supplemental Environmental Assessment Helena Wildfire ... · Supplemental Environmental Assessment Helena Wildfire Mitigation Lewis and Clark County, Montana HMGP-DR-1767-MT-2009-11;

Supplemental Environmental Assessment Helena Wildfire ... · Supplemental Environmental Assessment Helena Wildfire Mitigation Lewis and Clark County, Montana HMGP-DR-1767-MT-2009-11;

The Extent of Trafficking in the Supplemental Nutrition ... · PDF fileThe Extent of Trafficking in the Supplemental Nutrition Assistance Program: 2009–2011 Authors: Richard Mantovani,

The Extent of Trafficking in the Supplemental Nutrition ... · PDF fileThe Extent of Trafficking in the Supplemental Nutrition Assistance Program: 2009–2011 Authors: Richard Mantovani,

App0001 - MarketClubtv.ino.com/media/INLV97HP/workbook.pdf · Title: App0001.bmp Author: Kathy Redington Created Date: 1/7/2004 3:54:50 PM

App0001 - MarketClubtv.ino.com/media/INLV97HP/workbook.pdf · Title: App0001.bmp Author: Kathy Redington Created Date: 1/7/2004 3:54:50 PM

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac

SUPPLEMENTAL INFORMATION SUPPLEMENTAL EXPERIMENTAL PROCEDURES · supplemental information supplemental experimental procedures ... (ch001/ch005) g cccaagctttcatcagcaccacattgatctgac