2 zygotic genome activation Drosophila · 15/07/2020 · 19 Mary McKenney [email protected]...

1

CLAMP and Zelda function together as pioneer transcription factors to promote 1

Drosophila zygotic genome activation 2

Jingyue Ellie Duan1,*,✝, Leila E. Rieder2,*, Annie Huang1, William T. Jordan, III1, Mary 3

McKenney1, Scott Watters3, Nicolas L. Fawzi3, and Erica N. Larschan1,✝ 4

1Department of Molecular Biology, Cellular Biology and Biochemistry, Brown University, 5

Providence, RI, 02912, USA 6

2Department of Biology, Emory University, Atlanta, GA, 30322, USA 7

3Department of Molecular Pharmacology, Physiology, and Biotechnology, Brown 8

University, Providence, RI, 02912, USA 9

* These authors contributed equally 10

✝ Correspondence/Lead Contact: [email protected]; 11

[email protected] 12

13

AUTHOR INFORMATION 14

Jingyue E. Duan, [email protected] 15

Leila E. Rieder, [email protected] 16

Annie Huang, [email protected] 17

William T. Jordan, III, [email protected] 18

Mary McKenney [email protected] 19

Scott Watters [email protected] 20

Nicolas Fawzi [email protected] 21

Erica N. Larschan, [email protected] 22

.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made

The copyright holder for this preprint (whichthis version posted July 15, 2020. ; https://doi.org/10.1101/2020.07.15.205054doi: bioRxiv preprint

mailto:[email protected]









https://doi.org/10.1101/2020.07.15.205054

http://creativecommons.org/licenses/by-nc-nd/4.0/

2

ABSTRACT 23

24

Because zygotic genome activation (ZGA) is an essential process across metazoans, it 25

is key to evolve multiple pioneer transcription factors (TFs) to protect organisms from 26

loss of a single factor. Pioneer TF Zelda (ZLD) is the only known factor which increases 27

accessibility of chromatin to promote ZGA in the early Drosophila embryo. However, 28

many genomic loci remain accessible without ZLD and have GA-rich motifs. Therefore, 29

we hypothesized that other pioneer TFs that function with ZLD have not yet been 30

identified in early embryos, especially those that bind to GA-rich motifs, such as CLAMP 31

(Chromatin-linked adaptor for Male-specific lethal MSL proteins). Here, we determine 32

that CLAMP is a novel pioneer TF which interacts directly with nucleosomes, regulates 33

zygotic genome transcription, promotes chromatin accessibility, and facilitates the 34

binding of ZLD to promoters. Thus, the maternal factor CLAMP functions with ZLD as a 35

pioneer TF to open chromatin and drive zygotic genome activation. 36

37

KEYWORDS WORDS Zygotic genome activation, pioneer transcription factors, 38

CLAMP, Zelda, Drosophila embryo, nucleosomal gel shift 39

40



https://doi.org/10.1101/2020.07.15.205054


3

INTRODUCTION 41

42

During zygotic genome activation (ZGA), dramatic reprogramming occurs in the 43

zygotic nucleus to initiate global transcription and prepare the embryo for further 44

development (Jukam et al., 2017). Chromatin changes that activate the zygotic genome 45

during ZGA rely on cooperation among transcription factors (TFs) (Lee et al., 2014). 46

However, only pioneer TFs (Cirillo and Zaret, 1999; Mayran and Drouin, 2018) can bind 47

to ‘closed’ chromatin prior to ZGA because most TFs lack the ability to bind to 48

nucleosomal DNA (Soufi et al., 2015). 49

50

In Drosophila, the pioneer TF Zelda (ZLD; Zinc-finger early Drosophila activator) 51

plays a key role during ZGA (Liang et al., 2008). ZLD exhibits several key 52

characteristics of pioneer TFs, including: 1) binding to nucleosomal DNA (Sun et al., 53

2015; McDaniel et al., 2019); 2) targeting early zygotic genes (Harrison et al., 2011); 54

and 3) modulating chromatin accessibility to increase the ability of other non-pioneer 55

TFs to bind to DNA (Schulz et al., 2015). However, a large subset of ZLD binding sites 56

(60%) are highly enriched for GA-rich motifs and have constitutively open chromatin 57

even in the absence of ZLD (Schulz et al., 2015). Therefore, we and others (Schulz et 58

al., 2015) hypothesized that other pioneer TFs that are able to directly bind to GA-rich 59

motifs work together with ZLD to activate the zygotic genome. 60

61

GAGA-associated factor (GAF, Farkas et al., 1994) and Chromatin-linked 62

adaptor for male-specific lethal (MSL) proteins (CLAMP, Soruco et al., 2013) are the 63



https://www.zotero.org/google-docs/?81mzRE

https://www.zotero.org/google-docs/?tXAch1

https://www.zotero.org/google-docs/?GUJbos

https://www.zotero.org/google-docs/?gqf4a3

https://www.zotero.org/google-docs/?TruFST

https://www.zotero.org/google-docs/?S0b16k

https://www.zotero.org/google-docs/?S0b16k

https://www.zotero.org/google-docs/?y9saTG

https://www.zotero.org/google-docs/?K146LL

https://www.zotero.org/google-docs/?kO3VXo

https://www.zotero.org/google-docs/?oOzsCB

https://www.zotero.org/google-docs/?oOzsCB

https://www.zotero.org/google-docs/?aUXqJk

https://www.zotero.org/google-docs/?JziurA

https://doi.org/10.1101/2020.07.15.205054


4

only two known TFs that are able to bind to GA-rich motifs and regulate transcriptional 64

activation in Drosophila (Fuda et al., 2015; Kaye et al., 2018). GAF is known to perform 65

several essential functions in early embryos, including chromatin remodeling (Leibovitch 66

et al., 2002), nuclear divisions (Bhat et al., 1996) and RNA Pol II recruitment (Fuda et 67

al., 2015). Recently, Harrison and colleagues demonstrated that GAF regulates ZGA 68

and opens chromatin in the early embryo but functions largely independent from ZLD 69

(companion submission). 70

71

CLAMP is essential for early embryonic development (Rieder et al., 2017) and 72

plays several key roles including: 1) recruiting the MSL dosage compensation complex 73

to the male X-chromosome prior to ZGA (Rieder et al., 2019); 2) activating coordinated 74

regulation of the histone genes (Rieder et al., 2017). Therefore, we hypothesized that 75

CLAMP as a new GA-binding pioneer TF which regulates ZGA either interdependently 76

with or independent of ZLD. 77

78

Here, we identify the GA-binding factor CLAMP as a new pioneer transcription 79

factor, one of only two known pioneer TFs in Drosophila. We combine genomic and 80

biochemical approaches to demonstrate: 1) CLAMP is a novel pioneer factor which 81

binds to nucleosomal DNA, activates zygotic transcription, and increases chromatin 82

accessibility; 2) CLAMP and ZLD function interdependently to regulate transcription, 83

chromatin accessibility and each other’s occupancy at a subset of promoters; 3) When 84

ZLD is bound to a locus but does not increase chromatin accessibility, CLAMP can 85

often function redundantly to open the chromatin. Because ZGA is an essential process, 86



https://www.zotero.org/google-docs/?YBXAlL

https://www.zotero.org/google-docs/?bM4NiQ

https://www.zotero.org/google-docs/?bM4NiQ

https://www.zotero.org/google-docs/?UaKZZQ

https://www.zotero.org/google-docs/?y7rfea

https://www.zotero.org/google-docs/?y7rfea

https://www.zotero.org/google-docs/?UaDaml

https://www.zotero.org/google-docs/?YwV8jl

https://www.zotero.org/google-docs/?19S8P2

https://doi.org/10.1101/2020.07.15.205054


5

redundant pioneer TFs protect organisms from lethality that would be caused by 87

mutation of a single non-redundant factor. 88

89

RESULTS 90

91

CLAMP binds to nucleosomal DNA and activates zygotic transcription 92

93

One of the intrinsic characteristics of pioneer transcription factors is their capacity 94

to bind nucleosomal DNA and compacted chromatin (Cirillo and Zaret, 1999). To test 95

the hypothesis that CLAMP is a novel pioneer factor, we performed electromobility shift 96

assays (EMSAs) that directly test the intrinsic capacity of CLAMP to directly interact with 97

nucleosomes in vitro (Figure 1). First, we identified a 240 bp region of the X-linked 5C2 98

locus (Figure 1A) that CLAMP binds to in vivo and had decreased chromatin 99

accessibility in the absence of CLAMP (J. Urban et al., 2017). This region is also 100

normally occupied by nucleosomes (Figure 1A), suggesting that CLAMP promotes 101

accessibility of this region while binding to nucleosomes in vivo. Furthermore, CLAMP 102

binding to 5C2 is important for transcriptional activation mediated by this locus 103

(Alekseyenko et al., 2008). 104

105

Next, we performed in vitro nucleosome assembly using 240 bp of DNA from the 106

5C2 locus that contains three CLAMP-binding motifs and used 5C2 naked DNA as a 107

control. We found that both the CLAMP DNA binding domain (DBD, Figure 1B) and full-108

length protein (F/L, Figure 1C) (both kept soluble by an N-terminal maltose binding 109



https://www.zotero.org/google-docs/?BbsHL3

https://www.zotero.org/google-docs/?zr51UC

https://www.zotero.org/google-docs/?jSmTUt

https://doi.org/10.1101/2020.07.15.205054


6

protein fusion) can bind and shift naked 5C2 DNA and nucleosomes assembled with 110

5C2 DNA. Increased protein concentration results in a secondary “super” shift species 111

(Figure 1B & 1C), indicating that the three CLAMP-binding motifs may be occupied by 112

multiple CLAMP molecules. This is the first experiment that demonstrates the ability of 113

CLAMP to directly bind nucleosomal DNA, the essential feature of a pioneer TF. 114

115

The second characteristic of a pioneer TF is its ability to directly target zygotic 116

genes for activation (Zaret and Carroll, 2011). To define how CLAMP regulates 117

transcription in early embryos, we examined the effect of maternal CLAMP depletion by 118

RNAi on expression of maternally-deposited or zygotically-transcribed genes using 119

mRNA-seq data (Rieder et al., 2017). We found that only the expression levels of 120

zygotically-transcribed genes but not maternally-deposited genes were significantly (p < 121

0.05, Student’s t-test) downregulated in embryos lacking CLAMP (Figure 1D). We next 122

asked whether the ability of CLAMP to bind to genes directly regulates zygotic gene 123

activation by performing ChIP-seq on CLAMP in early embryos at two time ranges: 1) 0-124

2 hours after egg laying; 2) 2-4 hours after egg laying. Similar to a previous study 125

(Harrison et al., 2011) that defined the role of ZLD in early embryos, we determined that 126

genes strongly bound by CLAMP showed a higher level of gene expression reduction 127

after clamp RNAi than weakly bound or unbound genes (Figure 1E). Furthermore, the 128

relationship between CLAMP-binding and gene activation is stronger at zygotically-129

transcribed genes compared to genes encoding maternally-deposited mRNA (Figure 130

S1A-B). Therefore, the direct binding of CLAMP to genes regulates their transcriptional 131

activation during ZGA, confirming the second key characteristic of pioneer TFs. 132



https://www.zotero.org/google-docs/?OMAP9Y

https://www.zotero.org/google-docs/?wfLq53

https://doi.org/10.1101/2020.07.15.205054


7

133

Next, we compared and contrasted the transcriptional roles of CLAMP and ZLD 134

in early embryos. We found that binding of CLAMP was enriched at mid- and late-135

transcribed zygotic genes (categories defined in Li et al., 2014), while ZLD binds more 136

strongly to early-transcribed zygotic genes (Figure S1C & S1D). Overall, we 137

demonstrate that like the pioneer factor ZLD, CLAMP also functions as a pioneer 138

transcriptional activator that directly activates zygotically-transcribed genes during early 139

development. 140



https://www.zotero.org/google-docs/?vZEMzC

https://doi.org/10.1101/2020.07.15.205054


8

141

Figure 1. CLAMP exhibits two features of pioneer transcription factors: binding to nucleosomal DNA and activating zygotic transcription 142 A. Genome browser tracks are shown for a region of the CES 5C2 locus used to make in vitro reconstituted nucleosomes (Urban et al., 2017). 143

CLAMP ChIP-seq normalized sequencing reads are shown in green. MNase-seq MACC scores from S2 cells or S2 cells depleted for maternal 144 clamp are shown in dark blue. The nucleosome profile is shown in purple. The dashed rectangle highlights the genomic region used to 145 reconstitute nucleosomes. 146

B. Electrophoretic mobility shift assay (EMSA) shows the binding of increasing amounts of CLAMP DNA-binding domain (fused to MBP) to 5C2 147 naked DNA or 5C2 in vitro reconstituted nucleosomes. 148

C. EMSA shows the binding of increasing amounts of full-length CLAMP (fused to MBP) to 5C2 DNA or 5C2 nucleosomes. 149 D. Effect of maternal CLAMP depletion on maternally-deposited (orange) or zygotically- transcribed (yellow) gene expression log2 (clamp-i/MTD) in 150

0-2hr (left) or 2-4hr (right). Maternal vs. zygotic gene categories were as defined in Lott et al. (2011). 151 E. Gene expression changes caused by maternal CLAMP depletion at genes with strong, weak and no CLAMP occupancy as measured by ChIP-152

seq in 0-2hr (left) or 2-4hr (right) embryos.153



https://doi.org/10.1101/2020.07.15.205054


9

CLAMP regulates chromatin accessibility in early embryos 154

155

Another essential characteristic of pioneer transcription factors is that they are 156

able to establish and maintain the accessibility of their DNA target sites, allowing other 157

TFs to bind to DNA and activate transcription (Zaret and Carroll, 2011; Iwafuchi-Doi et 158

al., 2016). We previously used MNase-seq (J. Urban et al., 2017) to determine that 159

CLAMP guides MSL complex to GA-rich sequences by promoting an accessible 160

chromatin environment on the male X-chromosomes in cell lines. Furthermore, GA-rich 161

motifs enriched in regions that remain accessible in the absence of pioneer factor ZLD 162

(Schulz et al., 2015; Sun et al., 2015). Therefore, we hypothesized that CLAMP 163

regulates chromatin accessibility during ZGA. 164

165

To test our hypothesis, we performed Assay for Transposase-Accessible 166

Chromatin using sequencing (ATAC-seq) at 0-2hr and 2-4hr embryos with wild-type 167

levels of CLAMP [maternal triple driver (MTD) alone] and embryos depleted for 168

maternally contributed CLAMP using the MTD driver (clamp-i) as we performed 169

previously (Rieder et al., 2017). Knockdown of CLAMP was validated by qPCR and 170

western blot (see Materials and Methods). 171

172

Next, we defined differentially accessible (DA) regions (Figure 2A) by 173

comparing ATAC-seq reads between MTD and clamp-i embryos using Diffbind (Stark 174

and Brown, 2019). High Pearson correlation for DA regions among replicates indicate 175

strong reproducibility of our data (Figure S2A-B). There were hundreds of genomic 176



https://www.zotero.org/google-docs/?ccSvmn

https://www.zotero.org/google-docs/?ccSvmn

https://www.zotero.org/google-docs/?LOlu4q

https://www.zotero.org/google-docs/?PfF845

https://www.zotero.org/google-docs/?pE9Cax

https://www.zotero.org/google-docs/?oLoMOI

https://www.zotero.org/google-docs/?oLoMOI

https://doi.org/10.1101/2020.07.15.205054


10

regions that had reduced chromatin accessibility in the absence of CLAMP (Figure 2A, 177

0-2hr: 636; 2-4hr: 419), indicating that CLAMP is required for the chromatin accessibility 178

of these regions. In contrast, very few regions (0-2hr: 13; 2-4hr: 85) increased their 179

accessibility in the absence of CLAMP (Figure 2A). Gene Ontology (GO) analysis 180

(Figure S2C-D) indicates that CLAMP increases accessibility of chromatin regions that 181

are mainly within DNA-binding, RNA Pol II binding, and enhancer-binding TF encoding 182

genes (Figure S2C-D). 183

184

Moreover, a subset of DA regions were bound by CLAMP suggesting that 185

CLAMP directly regulates chromatin accessibility [22% (138/636) at 0-2hr; 55% 186

(229/419) at 2-4hr ]. For example, a DA site with a cluster of CLAMP enrichment was 187

located at the promoter of cg11023 (Figure 2B). We also determined how DA sites and 188

CLAMP binding sites were distributed throughout the genome (Figure 2C). While DA 189

sites were highly enriched in promoter regions (81.2%), CLAMP binds to both promoters 190

(36.8%) and other introns (23.9%). Therefore, CLAMP is required to establish or 191

maintain open chromatin at promoters, but could also play other roles, such as 192

regulating pre-mRNA splicing at intronic regions. Motif analysis also identified both GA-193

rich motifs and ZLD motifs enriched at regions which require CLAMP for their 194

accessibility (Figure 2D). These data suggest that CLAMP also regulates the 195

accessibility of some ZLD binding sites, a hypothesis that we will discuss further below. 196

197

We further determined whether CLAMP-mediated accessibility could specifically 198

drive early transcription by examining the relationship between the chromatin 199



https://doi.org/10.1101/2020.07.15.205054


11

accessibility changes (ATAC-seq) and gene expression of the nearest gene as 200

measured by RNA-seq (Rieder et al., 2017). We obtained positive R values with 201

significant Pearson correlation p-values between CLAMP-mediated chromatin 202

accessibility changes and gene expression changes at both time points: 0-2hr (R = 203

0.24, p = 3.6e-08) and 2-4hr (R = 0.14, p = 0.0046, Figure 2E). Therefore, CLAMP-204

mediated chromatin accessibility is positively correlated with gene expression. Overall, 205

our ATAC-seq data indicate that CLAMP promotes accessibility of chromatin during 206

ZGA, a key property of pioneer TFs. 207



https://www.zotero.org/google-docs/?BR3q0e

https://doi.org/10.1101/2020.07.15.205054


12

208

Figure 2. CLAMP regulates chromatin accessibility throughout ZGA 209

A. Differential accessibility (DA) analysis by ATAC-seq from MTD embryos versus clamp-i embryos in 0-2hr (left) or 2-4hr (right). 210 Blue dots indicate non-differentially accessible sites. Pink dots indicate significant (p < 0.05) differential peaks after CLAMP 211 depletion, identified by DiffBind (DESeq2). Number of peaks in each class is noted on the plot. 212

B. Example of genomic locus with CLAMP binding (ChIP-seq) which shows significant ATAC-seq signal reduction after clamp RNAi. 213

C. Genomic features of regions that require CLAMP for chromatin accessibility compared with all CLAMP binding sites (ChIP-seq). 214 D. Motifs enriched in regions that require CLAMP for chromatin accessibility. 215 Pearson correlation between CLAMP-mediated changes in gene expression (mRNA-seq) and ATAC-seq signal.216



https://doi.org/10.1101/2020.07.15.205054


13

Four classes of CLAMP-related genomic loci regulate zygotic transcription 217

differently 218

219

In order to determine how the direct binding of CLAMP relates to CLAMP-220

mediated chromatin accessibility, we integrated CLAMP binding sites from ChIP-seq 221

with ATAC-seq peaks. Inspired by a FAIRE-seq (Formaldehyde-Assisted Isolation of 222

Regulatory Elements) study which identified ZLD-mediated chromatin accessible 223

regions (Schulz et al., 2015), we defined four classes of CLAMP-related peaks: 1) DA, 224

CLAMP-bound (0-2hr: 138 peaks; 2-4hr: 229 peaks); 2) DA, CLAMP non-bound (0-2hr: 225

501 peaks; 2-4hr: 191 peaks); 3) Non-DA, CLAMP-bound (0-2hr: 427 peaks; 2-4hr: 226

1307 peaks); 4) Non-DA, CLAMP non-bound (0-2hr: 3641 peaks; 2-4hr: 4395 peaks) 227

(Figure 3A). Average profiles of ATAC-seq read counts validated these four classes of 228

sites in control MTD and clamp-i embryos: DA regions had a significant decrease in 229

accessibility in embryos lacking CLAMP, while Non-DA regions maintained accessibility 230

in the absence of CLAMP (Figure 3A). 231

232

To compare CLAMP- and ZLD-mediated chromatin accessibility during ZGA, we 233

also defined four ZLD-related classes of genomic loci using ZLD binding sites from 234

ChIP-seq (generated in this study) and ATAC-seq datasets (Hannon et al., 2017) 235

generated in wildtype (wt) and zld-i embryos at the NC14 (2-3hr) stage. Specifically, we 236

defined four classes of genomic loci as described above for CLAMP-related classes: 1) 237

DA, ZLD-bound (806 peaks); 2) DA, ZLD non-bound (426 peaks); 3) Non-DA, ZLD-238

bound (1,331 peaks); 4) Non-DA, ZLD non-bound (2,269 peaks) (Figure 3A). ATAC-239



https://www.zotero.org/google-docs/?nVbdez

https://www.zotero.org/google-docs/?xUsF04

https://doi.org/10.1101/2020.07.15.205054


14

seq average profiles for each ZLD-related class also confirmed our classification 240

(Figure 3A). 241

242

We performed pairwise intersection of genomic regions among four classes of 243

CLAMP-related peaks and four classes of ZLD-related peaks (Table 1). We observed 244

significant (p < 0.05, Hypergeometric test) overlap between the classes of sites that are 245

bound by CLAMP and ZLD compared to classes of sites that are not bound by CLAMP 246

or ZLD for both DA and Non-DA sites. This relationship among classes of sites 247

suggests that CLAMP and ZLD act interdependently: CLAMP promotes chromatin 248

accessibility at sites that are bound by ZLD but do not require ZLD for their accessibility 249

and vice versa. Therefore, as Schulz et al. (2015) predicted a GA-binding TF can 250

increase the accessibility of sites that are bound by ZLD but do not require ZLD for 251

chromatin accessibility, we observed that CLAMP is one of these GA-binding TFs. 252



https://www.zotero.org/google-docs/?JaU57u

https://doi.org/10.1101/2020.07.15.205054


15

253

Table 1. Significance of pairwise overlaps among four classes of CLAMP-related peaks and four classes of ZLD-related 254

peaks 255

256

DA, w CLAMP

2-4hr DA, wo CLAMP

2-4hr Non-DA, w CLAMP

2-4hr Non-DA, wo CLAMP

2-4hr

DA, w ZLD 2-3hr

0.015 - 1.43e-09 -

DA, wo ZLD 2-3hr

- - - -

Non-DA, w ZLD 2-3hr

1.15e-37 - 1.61e-154 -

Non-DA, wo ZLD 2-3hr

- - - 6.96e-49

257

“-” not significant 258

w: with; wo: without 259



https://doi.org/10.1101/2020.07.15.205054


16

Next, we used ChIP-seq average profiles to measure the relative strength of 260

CLAMP or ZLD binding over each class of the classes of sites in control MTD vs. clamp-261

i embryos (Figure 3B) and control MTD vs. zld-i embryos (Figure 3C). First, we 262

examined the binding of each factor at the four classes of sites defined based on 263

regulation of chromatin accessibility by the same factor. Throughout ZGA, both DA and 264

Non-DA sites with CLAMP or ZLD bound had significantly higher enrichment in MTD 265

control embryos than in their RNAi embryos (Figure 3B & 3C), as expected in ChIP-seq 266

due to protein depletion in RNAi embryos (Figure S3A). Furthermore, CLAMP binding 267

is slightly enriched at DA sites compared with Non-DA sites in control MTD embryos 268

suggesting that higher levels of CLAMP occupancy promote chromatin accessibility. 269

(Figure 3B). Similarly, ZLD binding is enriched at DA sites compared with non-DA sites 270

in control MTD embryos (Figure 3C), consistent with a previous study (Schulz et al., 271

2015). The opposite result was observed in zld-i embryos: ZLD is less enriched at DA 272

sites than non-DA sites (Figure 3C). It is important to note that ZLD levels also 273

increased in zld-i embryos at 2-4 hours at the ChIP (ChIP-seq, Figure S3B), mRNA 274

(qPCR, Figure S3C) and protein (western, Figure S3D) levels. 275

276

Prior work demonstrated that genes that require ZLD for chromatin accessibility 277

were downregulated in the absence of ZLD (Schulz et al., 2015). To determine the 278

functional impact of the four classes of CLAMP-related ATAC-seq sites on early zygotic 279

transcription, we measured the expression of genes associated with each class of sites 280

in clamp-i compared to control MTD embryos from RNA-seq data (Rieder et al., 2017) 281

(Figure 3D). Genes in the two CLAMP-bound classes (DA and non-DA) showed more 282



https://www.zotero.org/google-docs/?1v7Cbq

https://www.zotero.org/google-docs/?s63z9a

https://doi.org/10.1101/2020.07.15.205054


17

significant (p < 0.05, Student’s t-test) downregulation in the absence of CLAMP 283

compared to the two CLAMP non-bound classes (DA and non-DA) at the 0-2hr time 284

point (Figure 3D). In contrast, later in development (2-4hrs), genes associated with the 285

two DA classes (CLAMP-bound and CLAMP non-bound) showed significant (p < 0.05, 286

Student’s t-test) reduction in expression compared to two non-DA classes (CLAMP-287

bound and CLAMP non-bound Figure 3D). Overall, these results indicate that CLAMP 288

binding in the absence of chromatin accessibility changes can regulate gene expression 289

early in development (0-2 hrs). However, later in development (2-4hrs) changes in 290

chromatin accessibility are more important for regulating gene expression than CLAMP 291

binding alone. 292



https://doi.org/10.1101/2020.07.15.205054


18

293 Figure 3. CLAMP-mediated chromatin accessibility is correlated with early CLAMP-dependent gene expression 294

A. Four classes of CLAMP-related peaks defined by combining ATAC-seq and CLAMP ChIP- seq peaks. 295 Dark green: DA (differentially accessible) CLAMP-bound; Light green: DA, CLAMP non-bound; 296 Dark red: Non-DA, CLAMP-bound; Light red: Non-DA, CLAMP non-bound. 297 Similarly, four classes of ZLD-related peaks were defined by combining ATAC-seq (Hannon et al., 2017) and ZLD ChIP-seq 298 peaks (from this study) for further analysis: 299 Dark blue: DA ZLD-bound; Light blue: DA, ZLD non-bound; 300 Dark yellow: Non-DA, ZLD-bound; Light yellow: Non-DA, ZLD non-bound. 301

B. The enrichment of CLAMP ChIP-seq signals over four classes of CLAMP-related peaks. 302

C. The enrichment of ZLD ChIP-seq signals over four classes of ZLD-related peaks. 303 D. Gene expression differences caused by maternal CLAMP depletion among four classes of CLAMP-related peaks.304



https://doi.org/10.1101/2020.07.15.205054


19

CLAMP and ZLD bind interdependently to many promoters 305

306

Due to the significant overlap between accessible regions that are both bound by 307

CLAMP and ZLD (Table 1), we hypothesized that these two pioneer TFs bind to 308

chromatin interdependently. To test this hypothesis, we identified motifs enriched in the 309

DNA sequences underlying the bound CLAMP-dependent ATAC-seq peaks (DA, 310

CLAMP bound, Figure 4A) or bound ZLD-dependent ATAC-seq peaks (DA, ZLD 311

bound, Figure 4B). As predicted, GA-rich motifs and ZLD motifs were enriched in 312

CLAMP-dependent peaks at the 0-2hr time point and ZLD-dependent peaks at the 2-3hr 313

time point. However, the ZLD motif is not present within CLAMP-dependent ATAC-seq 314

peaks at the 2-4hr time point (Figure 4A). This result suggests that an interdependent 315

relationship between CLAMP and ZLD may be a developmental stage-specific event 316

during ZGA. 317

318

To directly determine how CLAMP and ZLD impact each other’s binding, we 319

performed ChIP-seq (Figure S4A-B) for CLAMP and ZLD in control MTD embryos and 320

embryos that were maternally depleted for each protein by RNA-i at two time points: 1) 321

before (0-2hr) ZGA and 2) during and after (2-4hr) ZGA. Overall, ZLD has more peaks 322

(0-2hr: 6,464; 2-4hr: 7,199) across the whole genome than CLAMP (0-2hr: 3,754, 2-4 323

hr: 6,071) in MTD embryos. As we hypothesized, CLAMP and ZLD peaks significantly 324

(p < 0.05, Hypergeometric test) overlapped (Figure S4C). Prior to ZGA (0-2hrs), ZLD 325

showed a higher enrichment at promoters than CLAMP, while CLAMP had a similar 326

distribution compared to ZLD at 2-4hr time point, indicating CLAMP binds to promoters 327



https://doi.org/10.1101/2020.07.15.205054


20

later than ZLD (Figure 4C). Moreover, depletion of either maternal zld or clamp mRNA 328

altered the genomic distribution of CLAMP and ZLD: both peaks shifted from promoters 329

to introns. Interestingly, maternal zld RNAi no longer affects CLAMP binding to 330

promoters at 2-4hr (Figure 4C). 331

332

Next, we defined the differential binding (DB, Figures 4D & 4E) of CLAMP and 333

ZLD in the absence of each other’s maternally deposited mRNA using Diffbind (Stark 334

and Brown, 2019). ZLD binding was significantly reduced in the absence of CLAMP. 335

There were 274 (0-2hr) and 1,289 (2-4hr) down-DB sites where ZLD binding decreased 336

in clamp-i compared to MTD controls (Figures 4D & S4D). Fewer ZLD binding sites 337

increased in occupancy after clamp RNAi: 8 sites (0-2hr) and 233 (2-4hr) up-DB sites. 338

The majority of the ZLD binding sites were not affected (non-DB sites, 0-2h: 3,144; 2-339

4h: 5,672, Figures 4D & S4D). In contrast, loss of ZLD had a more minor impact on 340

CLAMP binding, especially at 2-4hr: 390 (0-2 hr) and 30 (2-4 hr) down-DB sites 341

(Figures 4E & S4E). Very few up-DB sites were identified where CLAMP occupancy is 342

increased after zld RNAi (0-2hr: 54, 2-4hr: 3). The majority of CLAMP binding sites 343

remained unchanged after zld RNAi (non-DB, 0-2h: 4,184, 2-4h: 7,351, Figures 4E & 344

S4E). 345

346

Therefore, we conclude that CLAMP impacts ZLD throughout ZGA and has 347

major effects at the 2-4hr time point, while ZLD has a modest effect on CLAMP binding 348

that occurs largely within the 0-2hr time window. An important caveat to note is that ZLD 349

levels begin to recover (Figure S3B-D) in zld-i embryos by 2-4hr, likely due to 350



https://www.zotero.org/google-docs/?MlqSic

https://www.zotero.org/google-docs/?MlqSic

https://doi.org/10.1101/2020.07.15.205054


21

expression from the zygotic zld gene, which could influence our interpretation of these 351

results. Moreover, CLAMP and ZLD down-DB sites or non-DB sites were also 352

significantly (p < 0.05, Hypergeometric test) overlapped throughout ZGA (Figure S4F), 353

suggesting an interdependent relationship between CLAMP and ZLD in early 354

development. 355

356

Next, we asked whether CLAMP chromatin accessibility could specifically drive 357

ZLD binding and vice versa. Therefore, we measured the enrichment of CLAMP or ZLD 358

binding by ChIP-seq four classes of regions defined based on RNAi for the opposite 359

factor (Figure 4F & 4G). For example, we examined CLAMP occupancy at sites defined 360

based ZLD RNAi ATAC-seq data and vice versa. We found that ZLD binds preferentially 361

to CLAMP-bound regions, independent of whether these loci depend on CLAMP for 362

accessibility or not (Figure 4F). ZLD enrichment was also significantly reduced upon 363

CLAMP depletion throughout ZGA (Figure 4F). In contrast, a different pattern was 364

observed in CLAMP ChIP enrichment in ZLD-related regions: CLAMP also favors those 365

that are ZLD-bound, but it is highly enriched in peaks that do not require ZLD for 366

chromatin accessibility (non-DA, ZLD-bound, Figure 4G), consistent with the role of 367

CLAMP in maintaining the accessibility of these sites (Table 1). Moreover, ZLD 368

depletion caused a significant reduction in CLAMP largely at ZLD-dependent ATAC-seq 369

sites (DA, ZLD-bound) at 0-2hr, rather than at non-DA ZLD-bound sites (Figure 4G). At 370

2-4hr, loss of ZLD was no longer able to reduce the CLAMP enrichment at non-DA ZLD-371

bound sites (Figure 4G). Overall, CLAMP and ZLD exhibit inter-dependent binding that 372



https://doi.org/10.1101/2020.07.15.205054


22

correlates with high levels of enrichment of both factors, and CLAMP binding is mainly 373

enriched at non-DA ZLD-bound groups, even after ZLD depletion. 374



https://doi.org/10.1101/2020.07.15.205054


23

375 Figure 4. CLAMP and ZLD depend on each other for chromatin binding 376

A. Motifs enriched in regions that depend on CLAMP for accessibility and have CLAMP binding in 0-2hr and 2-4hr embryos. 377 B. Motifs enriched in regions that depend on ZLD for accessibility and have ZLD binding (2-3hr). 378 C. Genomic distribution fractions for CLAMP and ZLD peaks in the Drosophila genome in 0-2hr and 2-4hr embryos (MTD, clamp-i and zld-i). 379 D. Scatter plots of ZLD peaks from MTD embryos versus clamp-i embryos in 0-2hr (left) or 2-4hr (right). Blue dots indicate non-differential binding 380

sites. Pink dots indicate significant (p < 0.05) differential peaks identified by DiffBind (DESeq2). The number of peaks changed in each direction 381 is noted in the plot. 382

E. Scatter plots of CLAMP peaks from MTD embryos versus zld-i embryos in 0-2hr (left) or 2-4hr (right). Blue dots indicate non-differential binding 383 (non-DB) sites. Pink dots indicate significant (p < 0.05) differential binding (DB) peaks identified by DiffBind (DESeq2). Number of peaks in each 384 direction is noted in the plot. 385

F. The enrichment of ZLD ChIP-seq signals over four classes of CLAMP-related peaks. 386 G. The enrichment of CLAMP ChIP-seq signals over four classes of ZLD-related peaks. 387



https://doi.org/10.1101/2020.07.15.205054


24

CLAMP and ZLD interdependently regulate zygotic transcription 388

389

To determine how CLAMP and ZLD regulate each other’s binding and 390

transcription at sites where they bind dependently vs. independently, we further defined 391

dependent sites as down-DB sites and independent sites as non-DB sites. Interestingly, 392

the dependent sites for both CLAMP and ZLD showed a much broader binding pattern 393

compared to independent sites (Figures 5A & 5B). On average, the peak size of 394

dependent sites (400-500bp) is almost double that of independent sites (200-250bp), 395

with significant (p < 0.001, Mann-Whitney U-test) differences in peak size for both TFs 396

at both time points (Figure 5C). Moreover, dependent sites are enriched at promoters 397

and TSS, while independent sites are mainly localized at introns (Figure 5D). Overall, 398

dependent sites are broad and localized at promoters while independent sites are 399

narrower and located within introns. 400

401

Previous proteomic studies (J. A. Urban et al., 2017) found no evidence that 402

CLAMP and ZLD could directly contact each other at the protein level, suggesting that 403

CLAMP and ZLD might regulate each other via binding to their own motifs. Therefore, 404

we asked whether the motifs enriched at dependent vs. independent sites differed from 405

each other. We found that dependent sites are enriched for motifs specific for the 406

protein required for the binding of the other factor (Figures S5A & S5C), which are not 407

present at independent sites (Figures S5B & S5D). Therefore, the presence of specific 408

CLAMP and ZLD motifs correlates with the ability of CLAMP and ZLD to promote each 409

other’s binding. 410



https://www.zotero.org/google-docs/?N1JWti

https://doi.org/10.1101/2020.07.15.205054


25

411

To further understand how CLAMP and ZLD regulate each other’s binding via 412

their own motifs, we calculated the frequency of their motifs per peak at dependent and 413

independent sites (Figures S5E & S5F). Throughout ZGA, the number of binding motifs 414

for the required protein is significantly (p < 0.01, Mann-Whitney U-test) higher at the 415

dependent sites than at the independent sites for both TFs (Figures S5E & S5F), 416

explaining the broader binding pattern at dependent peaks compared with independent 417

peaks. 418

419

Next, we asked whether CLAMP and ZLD regulate each other’s binding to 420

specifically drive transcription of target genes. Thus, we incorporated mRNA-seq data 421

from embryos in which either maternal zld (Combs and Eisen, 2017, GSE71137) or 422

clamp (Rieder et al., 2017, GSE102922) has been depleted. Absence of maternal zld 423

significantly (p < 0.05, Mann-Whitney U-test) reduces the expression of genes at sites 424

where CLAMP is dependent on ZLD more than independent sites at the 0-2hr but not 425

the 2-4hr time point (Figure 5E). Therefore, ZLD specifically regulates early genes 426

where ZLD promotes CLAMP binding. Also, compared to independent genes, genes 427

where ZLD binding is dependent on CLAMP had a significant (p < 0.05, Mann-Whitney 428

U-test) expression reduction after clamp RNAi at both 0-2hr and 2-4hr time points 429

(Figure 5F). Thus, CLAMP also regulates genes targeted by ZLD. Overall, our analysis 430

revealed that enrichment of ZLD and CLAMP motifs at promoters drives binding of both 431

TFs such that they interdependently regulate transcriptional activation during ZGA. 432



https://www.zotero.org/google-docs/?xRXbzf

https://www.zotero.org/google-docs/?2cGN7Q

https://doi.org/10.1101/2020.07.15.205054


26

433 434 Figure 5. CLAMP and ZLD exhibit broad dependent binding sites at promoters and narrow independent binding sites at 435 introns 436

A. ChIP-seq profile of an example of a CLAMP differential binding (DB) peak at the promoter region (upper) or non-differential 437 binding (non-DB) peak at the intron (down) in MTD vs. zld-i. CLAMP and ZLD motifs are marked in blue. 438

B. Average profiles show the size of DB or non-DB peaks of CLAMP in MTD versus zld-I embryos and ZLD in MTD versus clamp-i 439

embryos. 440 C. Bar plot of the size of DB and non-DB peaks. *** p < 0.001, **** p < 0.0001. 441 D. Stacked barplots of CLAMP and/or ZLD DB (left) or non-DB peaks (right) distribution fraction in the Drosophila genome in 0-2hr 442

and 2-4hr. 443 E. Expression of CLAMP bound genes in DB and non-DB peaks in MTD vs. zld-i embryos. 444 Expression of ZLD bound genes in DB and non-DB peaks in MTD vs. clamp-i embryos.445



https://doi.org/10.1101/2020.07.15.205054


27

Chromatin accessibility differs at CLAMP and ZLD dependent and independent 446

sites 447

448

Given the strong interdependent relationship between CLAMP and ZLD binding 449

to chromatin, we next asked whether chromatin accessibility at dependent and 450

independent sites is changed by RNAi of required proteins. The average ATAC-seq 451

signals are significantly reduced at sites where ZLD depends on CLAMP for binding in 452

clamp-i embryos compared to MTD controls (Figures 6A & 6B). Furthermore, the 453

accessibility at independent sites is lower than that at dependent sites (Figures 6A & 454

6B), consistent with independent regions being mainly located in introns (Figure 5D) 455

which usually have reduced chromatin accessibility compared to o promoters. 456

457

We also performed analysis of chromatin accessibility at sites where CLAMP is 458

dependent or independent of ZLD for binding (Figures 6C & 6D). As expected, the 459

largely intronic independent regions showed a very low level of chromatin accessibility. 460

Interestingly, at sites where CLAMP depends on ZLD to bind, the accessibility was 461

slightly increased upon the loss of ZLD, at 0-2hr (Figure 6C). This observation indicates 462

that ZLD may reduce chromatin accessibility at those sites, consistent with the previous 463

finding (Schulz et al. 2015) that over one hundred genomic loci had increased chromatin 464

accessibility in the absence of ZLD. Moreover, at the 2-4hr time point (Figure 6D), sites 465

where CLAMP is dependent on ZLD to bind had reduced accessibility in zld-i embryos. 466

However, there are very few sites (n=30) in this class that CLAMP still depends on ZLD 467



https://doi.org/10.1101/2020.07.15.205054


28

to bind at 2-4hr. Overall, these results provide new insight into a specific subclass of 468

genomic loci where ZLD reduces chromatin accessibility. 469

470

Lastly, we further tested our hypothesis that CLAMP and ZLD regulate 471

transcription interdependently by comparing the genes regulated by each factor with 472

each other. Therefore, we overlapped the down-regulated genes (log2 fold change < 0) 473

from embryos in which either maternal zld (Combs and Eisen, 2017, GSE71137) or 474

clamp (Rieder et al., 2017, GSE102922) was depleted. We identified a significant (p < 475

0.05, Hypergeometric test) overlap between genes that are downregulated in the 476

absence of either CLAMP or ZLD at the 0-2hr time point (Figure 6E). In contrast, 477

CLAMP and ZLD down-regulated genes do not have a significant overlap at the 2-4hr 478

time point (Figure 6F), consistent with the observation that CLAMP binds independently 479

from ZLD at this later time point. However, over three-hundred genes require both 480

factors for expression at 2-4 hrs (Figure 6F). Therefore,CLAMP and ZLD significantly 481

co-regulate transcription early in development and co-regulate several hundred genes 482

during and after ZGA. Taken together, our results are consistent with the direct action of 483

CLAMP and ZLD on chromatin accessibility that influences the binding of both TFs to 484

their binding sites and regulates target gene expression. 485



https://doi.org/10.1101/2020.07.15.205054


29

486

487

Figure 6. CLAMP and ZLD functioning together to mediate chromatin accessibility and zygotic genome activation 488

A. Average profiles show chromatin accessibility at ZLD-dependent and independent sites at the 0-2hr time point. 489

B. Average profiles show chromatin accessibility at ZLD-dependent and independent sites at the 2-4hr time point. 490 C. Average profiles show chromatin accessibility at CLAMP-dependent and independent sites at the 0-2hr time point. 491

D. Average profiles show chromatin accessibility at CLAMP-dependent and independent sites at the 2-4hr time point. 492

E. Down-regulated genes in the absence of CLAMP (clamp-i, green) and ZLD (zld-i, orange) and overlapped genes that are down-493 regulated after knockdown of both TFs at 0-2hr time points. P-value represents the significance (hypergeometric test) of their 494 overlap. 495

F. Down-regulated genes in the absence of CLAMP (clamp-i, green) and ZLD (zld-i, orange) and overlapped genes that are down-496 regulated after knockdown of both TFs at 2-4hr time points. P-value represents the significance (hypergeometric test) of their 497 overlap. 498



https://doi.org/10.1101/2020.07.15.205054


30

DISCUSSION 499

500

Two questions central to embryogenesis of all metazoans are how and where do 501

early transcription factors work together to drive chromatin changes and zygotic 502

genome activation. We identified CLAMP as a pioneer transcription factor that directly 503

binds to nucleosomal DNA, regulates zygotic genome activation (Figure 1), establishes 504

and/or maintains chromatin accessibility (Figure 2-3), and facilitates the binding of ZLD 505

to promoters (Figure 4). We further discovered that CLAMP and ZLD interdependently 506

regulate each other’s binding during ZGA (Figure 5). Also, we identified the direct 507

action of CLAMP and ZLD on chromatin accessibility that influences the binding of both 508

TFs to their binding sites (Figure 6). Overall, we identify a new pioneer TF and provide 509

key insight into how CLAMP and ZLD function interdependently to remodel zygotic 510

genome accessibility which drives zygotic genome activation. 511

512

CLAMP and ZLD act together to define an open chromatin landscape and activate 513

transcription in early embryos 514

515

Our ATAC-seq and EMSA data suggest that CLAMP is a novel pioneer 516

transcription factor in early Drosophila embryos. Pioneer transcription factors (Mayran 517

and Drouin, 2018), such as FoxA1 (Cirillo et al., 2002), have distinct characteristics from 518

other TFs such as: direct biochemical interaction with nucleosomes, activating gene 519

expression in the embryo, establishing accessible chromatin domains, and facilitating 520

binding of additional TFs. Analogous to prior work on ZLD (Schulz et al., 2015; 521



https://www.zotero.org/google-docs/?01mKJ4

https://www.zotero.org/google-docs/?01mKJ4

https://www.zotero.org/google-docs/?801iw6

https://www.zotero.org/google-docs/?zfr6Ib

https://doi.org/10.1101/2020.07.15.205054


31

McDaniel et al., 2019), we demonstrate that CLAMP also possesses these 522

characteristics of a pioneer factor. 523

524

We defined four classes of CLAMP-related and ZLD-related peaks in early 525

embryos, which reveal both interdependent and redundant roles of CLAMP and ZLD in 526

defining chromatin accessibility during ZGA (Figure 7). ZLD binding is enriched in both 527

DA CLAMP-bound and non-DA CLAMP-bound groups, and CLAMP is required for ZLD 528

binding at those two groups of sites. These results indicate that CLAMP could directly 529

(DA) or indirectly (non-DA) mediate ZLD binding to DNA (Figures 4F & 7). 530

531

In contrast, CLAMP binding is mainly enriched at non-DA ZLD-bound groups, 532

even after ZLD depletion (Figures 4G & 7). Therefore, CLAMP functions redundantly 533

with ZLD to maintain chromatin accessibility at regions that are bound by ZLD but that 534

do not require ZLD for chromatin accessibility. TF redundancy is increased with 535

organism complexity and it is a key to protect organisms from lethality that would be 536

caused by loss of a single non-redundant factor (Rosanova et al., 2017). Moreover, a 537

previous study found that GAF is also enriched at these non-DA ZLD-bound regions 538

(Schulz et al., 2015). Both CLAMP and GAF are deposited maternally (Rieder et al., 539

2017; Hamm et al., 2017) and bind to similar GA-rich motifs (Kaye et al., 2018). 540

Furthermore, Gaskill et al. (companion paper), demonstrate that GAF is also a key 541

regulator of ZGA, but functions largely independent from ZLD unlike CLAMP. 542



https://www.zotero.org/google-docs/?zfr6Ib

https://www.zotero.org/google-docs/?oteFnd

https://www.zotero.org/google-docs/?5C73CI

https://www.zotero.org/google-docs/?djUaY2

https://www.zotero.org/google-docs/?djUaY2

https://www.zotero.org/google-docs/?MjP1He

https://doi.org/10.1101/2020.07.15.205054


32

543

Figure 7. Model for integration of pioneer factor function in defining chromatin 544 accessibility 545 ZLD binding regulates chromatin accessibility at early embryonic promoters and intronic 546 regions, allowing CLAMP to access its binding sites. Also, CLAMP binding regulates chromatin 547 accessibility at early embryonic promoters, allowing ZLD to access its binding sites. Therefore, 548 CLAMP and ZLD are two pioneer TFs which function interdependently at promoters to open 549 chromatin. At many loci, CLAMP and/or ZLD bind to chromatin but they are not required for 550 accessibility. There is also functional redundancy between pioneer TFs because CLAMP can 551 facilitate chromatin opening at sites bound by ZLD but which do not require ZLD for chromatin 552 opening and vice versa. 553 554



https://doi.org/10.1101/2020.07.15.205054


33

Although we have demonstrated an instrumental role for CLAMP in defining open 555

chromatin landscape in early embryos, our data show that CLAMP does not increase 556

accessibility at all genomic loci. Therefore, other pioneer TFs, such as GAF, are likely to 557

compensate for the depletion of CLAMP or ZLD. To test this hypothesis, we tried to 558

perform GAF RNAi in the current study to prevent GAF from compensating for the loss 559

of CLAMP. However, we could not achieve depletion of GAF in early embryos by RNAi, 560

likely due to its prion-like self-perpetuating feature (Tariq et al., 2013). In the companion 561

study, Gaskill et al. used a degron approach to deplete GAF and show that GAF is also 562

critical for ZGA and functions independently of ZLD. 563

564

We previously demonstrated that competition between CLAMP and GAF at GA-565

rich binding sites is important for MSL complex recruitment in S2 cells (Kaye et al., 566

2018). However, we also observed interdependence between CLAMP and GAF at 567

many additional binding sites not involved in MSL complex recruitment (Kaye et al., 568

2018). Yet, the relationship between CLAMP and GAF in early embryos remains 569

unknown. It is very possible that the competitive relationship has not been established 570

in early embryos, since dosage compensation has not yet been initiated (Prayitno et al., 571

2019). Moreover, the GA-rich sequences targeted by CLAMP and GAF are distinct in 572

vivo and in vitro. GAF motifs (GAGAGAGAGA) show a uniform GA distribution with at 573

least 5-bp of contiguous repeat, while CLAMP can bind to sequences that contain non-574

contiguous GA repeats (GA _ GAGA _ )(Kaye et al., 2018). Therefore GAF and CLAMP 575

may have overlapping and non-overlapping functions at different loci, tissues or 576

developmental stages. In the future, an optogenetic inactivation approach could be used 577



https://www.zotero.org/google-docs/?RXnX4P

https://www.zotero.org/google-docs/?AndEK8

https://www.zotero.org/google-docs/?AndEK8

https://www.zotero.org/google-docs/?bWnAPZ

https://www.zotero.org/google-docs/?bWnAPZ

https://www.zotero.org/google-docs/?mwr4d1

https://www.zotero.org/google-docs/?mwr4d1

https://www.zotero.org/google-docs/?BN6AZe

https://doi.org/10.1101/2020.07.15.205054


34

to remove both CLAMP and GAF simultaneously in a spatial and temporal manner 578

(McDaniel et al., 2019). 579

580

CLAMP and ZLD mediate each other’s binding via their own motifs 581

582

ZLD is an essential TF that regulates activation of the very first set of zygotic 583

genes during the minor wave of ZGA, as well as thousands of genes transcribed during 584

the major wave of ZGA at NC14 (Liang et al., 2008; Harrison et al., 2011). ZLD also 585

establishes and maintains chromatin accessibility of specific regions and facilitates 586

transcription factor binding and early gene expression (Sun et al., 2015; Schulz et al., 587

2015). We previously demonstrated that maternally deposited CLAMP is also essential 588

for early embryonic development (Rieder et al., 2017). CLAMP regulates histone gene 589

expression (Rieder et al., 2017) and establishes/maintains chromatin accessibility at 590

promoters genome-wide (J. Urban et al., 2017). Nonetheless, it remained unclear 591

whether and how CLAMP and ZLD functionally interact during ZGA. Here, we 592

demonstrate an interdependent relationship between CLAMP and ZLD at hundreds of 593

promoters genome-wide. Furthermore, ZLD often regulates CLAMP earlier than CLAMP 594

regulates ZLD occupancy. 595

596

Genomic loci at which CLAMP is dependent on ZLD early (0-2hr) in development 597

often became ZLD-independent later (2-4hr) in development. Therefore, it is possible 598

that CLAMP requires the pioneering activity of ZLD to access specific loci prior to ZGA, 599

but ZLD is no longer required once the binding is established. Also, our results suggest 600



https://www.zotero.org/google-docs/?FF1ljX

https://www.zotero.org/google-docs/?i9tKqi

https://www.zotero.org/google-docs/?aKJbIZ

https://www.zotero.org/google-docs/?aKJbIZ

https://www.zotero.org/google-docs/?xHbPSP

https://www.zotero.org/google-docs/?26nrqQ

https://www.zotero.org/google-docs/?sm00Ss

https://doi.org/10.1101/2020.07.15.205054


35

that CLAMP is a strong regulator ZLD binding, especially in 2-4hr embryos. 601

Furthermore, ZLD is able to bind to many more promoter regions early in development, 602

while CLAMP mainly binds to introns early in development but occupies promoters later 603

in development. Therefore, CLAMP may require ZLD to open up the chromatin of these 604

promoter regions (Schulz et al., 2015). In fact, ZLD is sufficient to activate a subgroup of 605

early genes, although most ZLD bound regions are not active until NC14 (Bosch et al., 606

2006). 607

608

In addition to its role in early embryonic development, CLAMP also plays an 609

essential role in targeting the MSL male dosage compensation complex to the X-610

chromosome (Soruco et al., 2013). Drosophila embryos initiate X chromosome counting 611

in NC12 and start the sex determination cascade piror to the major wave of ZGA at 612

NC14 (Gergen, 1987; Bosch et al., 2006). However, the majority of dosage 613

compensation initiates much later in embryonic development (Prayitno et al., 2019). 614

Therefore, our data support a model in which CLAMP functions early in the embryo prior 615

to MSL complex assembly to open up specific chromatin regions for MSL complex 616

recruitment later (J. Urban et al., 2017; Rieder et al., 2019). Moreover, ZLD likely 617

functions primarily as an early pioneer factor whereas CLAMP has pioneering functions 618

in both early and late embryos. Consistent with this hypothesis, CLAMP binding is 619

enriched at early and late zygotic genes while ZLD binding is localized mainly to early 620

zygotic genes, suggesting a sequential relationship between these two early TFs during 621

ZGA. 622

623



https://www.zotero.org/google-docs/?2esGG0

https://www.zotero.org/google-docs/?nSRka4

https://www.zotero.org/google-docs/?nSRka4

https://www.zotero.org/google-docs/?zsQ5Ar

https://www.zotero.org/google-docs/?DQCOOp

https://www.zotero.org/google-docs/?gqJ0ah

https://www.zotero.org/google-docs/?0QAB8v

https://doi.org/10.1101/2020.07.15.205054


36

The different characteristics of dependent and independent CLAMP and ZLD 624

binding sites also provide insight into how early transcription factors work together to 625

regulate ZGA. At dependent sites, there are often relatively broad peaks of CLAMP and 626

ZLD that are significantly enriched for clusters of motifs for the required protein, 627

suggesting that the required protein may multimerize at its binding sites. Our CLAMP 628

EMSAs and those previously reported (Kaye et al., 2018) also show multiple shifted 629

bands consistent with possible multimerization. CLAMP contains two central disordered 630

prion-like glutamine-rich regions (Q domains) (Kaye et al., 2018), a type of domain that 631

is critical for transcriptional activation and multimerization in vivo in several TFs, 632

including GAF (Wilkins and Lis, 1999). Moreover, glutamine-rich repeats alone can be 633

sufficient to mediate stable protein multimerization in vitro (Stott et al., 1995). Therefore, 634

it is reasonable to hypothesize that the CLAMP glutamine-rich domain also functions in 635

CLAMP multimerization. 636

637

In contrast, ZLD fails to form dimers or multimers (Hamm et al., 2015, 2017), 638

indicating that ZLD most likely binds as a monomer. Although the number of ZLD motifs 639

is significantly enriched at dependent sites compared to independent sites, the motif 640

count median in dependent sites was still close to one (Figure S5E), further suggesting 641

that ZLD binds as a monomer. There is no evidence that CLAMP and ZLD have any 642

direct protein-protein interaction at sites where they depend on each other to bind. Mass 643

spectrometry results of CLAMP-associated proteins did not reveal ZLD (J. A. Urban et 644

al., 2017). Also, no validated protein-protein interactions of ZLD with itself as a multimer 645



https://www.zotero.org/google-docs/?53Jqm4

https://www.zotero.org/google-docs/?9IU8na

https://www.zotero.org/google-docs/?HBIrhr

https://www.zotero.org/google-docs/?DGOlW1

https://www.zotero.org/google-docs/?GZOz2T

https://www.zotero.org/google-docs/?MpXmxX

https://www.zotero.org/google-docs/?MpXmxX

https://doi.org/10.1101/2020.07.15.205054


37

or between ZLD and any other TFs have been identified to date using diverse methods 646

(Hamm et al., 2017). 647

648

649

Taken together, our study suggests that regulating the chromatin landscape in 650

early embryos to drive ZGA requires the cooperation of multiple transcription factors in a 651

sequential manner. Because ZGA is an essential process, it is key to have redundant 652

TFs to protect organisms from lethality that would be caused by mutation of a single 653

non-redundant factor. 654

655



https://www.zotero.org/google-docs/?46kRPq

https://doi.org/10.1101/2020.07.15.205054


38

MATERIALS AND METHODS 656

657

Recombinant Protein Expression and Purification of CLAMP 658

MBP-tagged CLAMP DBD was expressed and purified as described previously (Kaye et 659

al., 2018). MBP-tagged (pTHMT, Peti and Page, 2007) full-length CLAMP protein was 660

expressed in Escherichia coli BL21 Star (DE3) cells (Life Technologies). Bacterial 661

cultures were grown to an optical density of 0.7 to 0.9 before induction with 1 mM 662

isopropyl-β-D-1-thiogalactopyranoside (IPTG) for 4 hrs at 37°C. Cell pellets were 663

harvested by centrifugation and stored at -80°C. Cell pellets were resuspended in 20 664

mM Tris 1M NaCl 10 mM imidazole pH 8.0 with one EDTA-free protease inhibitor tablet 665

(Roche) and lysed using an Emulsiflex C3 (Avestin). The lysate was cleared by 666

centrifugation at 20,000 rpm for 50 min at 4°C, filtered using a 0.2 μm syringe filter, and 667

loaded onto a HisTrap HP 5 mL column. The protein was eluted with a gradient from 10 668

to 300 mM imidazole in 20 mM Tris 1.0 M NaCl pH 8.0. Fractions containing MBP-669

CLAMP full-length were loaded onto a HiLoad 26/600 Superdex 200 pg column 670

equilibrated in 20 mM Tris 1.0 M NaCl pH 8.0. Fractions containing full-length CLAMP 671

were identified by SDS-PAGE and concentrated using a centrifugation filter with a 10 672

kDa cutoff (Amicon, Millipore) and frozen as aliquots. 673

674

In vitro assembly of nucleosome 675

The 240 bp 5C2 DNA fragment used for nucleosome in vitro assembly was amplified 676

from 276 bp 5C2 fragments (50ng/ul, IDT gBlocks Gene Fragments) by PCR (see 276 677

bp 5C2 and primer sequences below) using OneTaq Hot Start 2X Master Mix (New 678



https://www.zotero.org/google-docs/?1LmEqA

https://www.zotero.org/google-docs/?1LmEqA

https://www.zotero.org/google-docs/?f4sCmA

https://doi.org/10.1101/2020.07.15.205054


39

England Biolabs). The DNA was purified using the PCR clean-up kit (Qiagen) and 679

concentrated to 1ug/ul by SpeedVac Vacuum (Eppendorf). The nucleosomes were 680

assembled using the EpiMark® Nucleosome Assembly Kit (New England Biolabs) 681

following the kit's protocol. 682

683

5C2 (276 bp), bold sequences are CLAMP-binding motifs, underlined sequences are 684

primer binding sequences: 685

TCGACGACTAGTTTAAAGTTATTGTAGTTCTTAGAGCAGAATGTATTTTAAATATCAA686

TGTTTCGATGTAGAAATTGAATGGTTTAAATCACGTTCACACAACTTAGAAAGAGAT687

AGCGATGGCGGTGTGAAAGAGAGCGAGATAGTTGGAAGCTTCATGGAAATGAAA688

GAGAGGTAGTTTTTGGAAATGAAAGTTGTACTAGAAATAAGTATTTTATGTATATAG689

AATATCGAAGTACAGAAATTCGAAGCGATCTCAACTTGAATATTATATCG 690

691

Primers (product is 240bp): 692

Forward: TTGTAGTTCTTAGAGCAGAATGT 693

Reverse: GTTGAGATCGCTTCGAATTT 694

695

Electromobility shift assays 696

DNA or nucleosome probe at 35nM (700fmol/reaction) was incubated with MBP-tagged 697

CLAMP DBD protein or MBP-tagged full-length CLAMP protein in a binding buffer. The 698

binding reaction buffer conditions are similar to conditions previously used to test ZLD 699

nucleosome binding (McDaniel et al. 2019) in 20 ul total volume: 7.5ul BSA/HEGK 700

buffer (12.5 mM HEPES, PH 7.0, 0.5 mM EDTA, 0.5 mM EGTA, 5% glycerol, 50 mM 701



https://doi.org/10.1101/2020.07.15.205054


40

KCl, 0.05 mg/ml BSA, 0.2 mM PMSF, 1 mM DTT, 0.25 mM ZnCl2, 0.006% NP-40,) 10 702

ul probe mix (5 ng poly[d-(IC)], 5 mM MgCl2, 700 fmol probe), and 2.5 ul protein dilution 703

(0.5uM, 1uM, 2.5uM) at room temperature for 60 min. Reactions were loaded onto 6% 704

DNA retardation gels (ThermoFisher) and run in 0.5X Tris–borate–EDTA buffer for 2 705

hours. Gels were post stained with Gelred Nucleic Acid Stain (Thermo Scientific) for 30 706

min and visualized using the ChemiDoc MP imaging system (BioRad). 707

708

Fly stocks and crosses 709

To deplete maternally deposited clamp or zld mRNA throughout oogenesis, we crossed 710

a maternal triple driver (MTD-GAL4, Bloomington, #31777) line with a Transgenic RNAi 711

Project (TRiP) clamp RNAi line (Bloomington, #57008) or a TRiP zld RNAi line (from C. 712

Rushlow lab, Sun et al., 2015). We used the MTD-GAL4 line alone as the control line. 713

We validated clamp or zld knockdown in early embryos by western blotting using the 714

Western Breeze kit (Invitrogen) and qRT-PCR (Rieder et al., 2017). 715

716

ATAC-seq in embryos 717

We conducted ATAC-seq following the protocol from Blythe and Wieschaus (2016). 0-718

2hr or 2-4hr embryos were laid on grape agar plates, dechorionated them by 1 min 719

exposure to 6% bleach (Clorox) and then washed them 3 times in deionized water. We 720

homogenized 10 embryos and lysed them in 50 ul lysis buffer (10mM Tris 7.5, 10mM 721

NaCl, 3mM MgCl2, 0.1% NP-40). We collected nuclei by centrifuging at 500 g at 4°C 722

and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment 723

DNA TDE1 Enzyme and Buffer Kits). We incubated samples at 37°C for 30min at 800 724



https://www.zotero.org/google-docs/?IMz3HC

https://doi.org/10.1101/2020.07.15.205054


41

rpm (Eppendorf Thermomixer) for fragmentation, and then purified samples with Qiagen 725

Minelute columns before PCR amplification. We amplified libraries by adding 10 ul DNA 726

to 25 ul NEBNext HiFi 2x PCR mix (New England Biolabs) and 2.5 ul of 25 uM each of 727

Ad1 and Ad2 primers. We used 13 PCR cycles to amplify samples from 0-2hr embryos 728

and 12 PCR cycles to amplify samples from 2-4hr embryos. Next, we purified libraries 729

with 1.2x Ampure SPRI beads. We performed three biological replicates for each 730

genotype (n=2) and time point (n=2). We measured the concentrations of 12 ATAC-seq 731

libraries by Qubit and determined library quality by Bioanalyzer. We sequenced libraries 732

on an Illumina Hi-seq 4000 sequencer at GeneWiz (South Plainfield, NJ) in 2x150-bp 733

mode. ATAC-seq data is deposited at NCBI GEO and the accession number is 734

GSE152596. 735

736

Chromatin Immunoprecipitation-sequencing (ChIP-seq) 737

We performed ChIP-seq as previously described (Blythe and Wieschaus, 2015). We 738

collected and fixed 200-400 embryos from each MTD-GAL4 and RNAi cross 0-2hr or 2-739

4hr after fertilization. We used 3 ul of rabbit anti-CLAMP (Soruco et al., 2013) and 2 ul 740

rat anti-ZLD (from C. Rushlow lab) per sample. We performed three biological ChIP 741

replicates for each protein (n=2), genotype (n=3) and time point (n=2). In total, we 742

prepared 36 libraries using the NEBNext Ultra ChIP-seq kit (New England Biolabs) and 743

sequenced libraries on Illumina HiSeq 2500 sequencer in 2x150-bp mode. ChIP-seq 744

data is deposited at NCBI GEO and the accession number is GSE152598. 745

746

Computational analyses 747



https://www.zotero.org/google-docs/?GpG0eu

https://www.zotero.org/google-docs/?OMP0VY

https://doi.org/10.1101/2020.07.15.205054


42

ATAC-seq analysis 748

Demultiplexed reads were trimmed of adapters using TrimGalore (Krueger, 2017) and 749

mapped to the Drosophila genome dm6 version using Bowtie2 (v. 2.3.0) with option -X 750

2000. We used Picard tools (v. 2.9.2) and SAMtools (v.1.9, Li et al., 2009) to remove 751

the reads that were unmapped, failed primary alignment, or duplicated (-F 1804), and 752

retain properly paired reads (-f 2) with MAPQ >30. Peak regions for accessible regions 753

were called using HMMRATAC (v1.2.10, Tarbell and Liu, 2019). ENCODE blacklist was 754

used to filter out problematic regions in dm6 (Amemiya et al., 2019). DiffBind with the 755

DESeq2 method (v. 3.10, Stark and Brown, 2019) was used to identify differentially 756

accessible regions. We used DeepTools (version 3.1.0, Ramírez et al., 2014) and 757

Homer (v 4.11, Givler and Lilienthal, 2005) to generate enrichment heatmaps (CPM 758

normalization), average profiles, motif searches, peak overlap and peak annotation. 759

Visualizations and statistical tests were conducted in R (R Core Team, 2014). 760

761

ChIP-seq analysis 762

We trimmed ChIP sequencing raw reads with Trim galore (v. 0.5.0, Krueger, 2017) with 763

a minimal phred score of 20, 36 bp minimal read length and Illumina adaptor removal. 764

We then mapped cleaned reads to the D. melanogaster genome (UCSC dm6) with 765

Bowtie2 (v. 2.3.0) with the --very-sensitive-local flag feature. We used Picard tools (v. 766

2.9.2) and SAMtools (v.1.9, (Li et al., 2009) to remove the PCR duplicates. We used 767

MACS2 (version 2.1.1, Zhang et al., 2008) to identify peaks with default parameters and 768

MSPC (v.4.0.0, Jalili et al., 2015) to obtain consensus peaks from 3 replicates. 769

ENCODE blacklist was used to filter out problematic regions in dm6 (Amemiya et al., 770



https://www.zotero.org/google-docs/?LP79uK

https://www.zotero.org/google-docs/?SWSY6m

https://www.zotero.org/google-docs/?evQf8b

https://www.zotero.org/google-docs/?A2bwTD

https://www.zotero.org/google-docs/?cY3aXs

https://www.zotero.org/google-docs/?fTNyFN

https://www.zotero.org/google-docs/?N2tvUN

https://www.zotero.org/google-docs/?CXaoYI

https://www.zotero.org/google-docs/?PhDtfS

https://www.zotero.org/google-docs/?fAvNMk

https://doi.org/10.1101/2020.07.15.205054


43

2019). We identified differential binding and non-differential binding using DiffBind with 771

the DESeq2 method (v. 3.10, Stark and Brown, 2019). We used DeepTools (version 772

3.1.0, Ramírez et al., 2014) and Homer (v 4.11, Givler and Lilienthal, 2005) to generate 773

enrichment heatmaps (SES normalization), average profiles, motif searches, peak 774

overlap and peak annotation. Visualizations and statistical tests were conducted in R (R 775

Core Team, 2014). 776

777

Datasets 778

RNA-seq datasets from wild type and maternal clamp depletion by RNAi were from 779

GSE102922 (Rieder et al., 2017). RNA-seq datasets from wild type and zld germline 780

mutations were from GSE71137 (Combs and Eisen, 2017). ATAC-seq data from wild 781

type and zld germline mutations were from GSE86966 (Hannon et al., 2017). 782

783

ACKNOWLEDGEMENTS 784

785

This work was supported by NIH grant F32GM109663 and K99HD092625 to Dr. Leila 786

Rieder and R35GM126994 to Dr. Erica Larschan, and in part by NSF grant 1845734 787

and NIGMS grant GM118530 (to N. L. F). 788

789

AUTHOR CONTRIBUTIONS 790

791

Conceptualization, L.E.R., J.E.D. and E.N.L.; Methodology, J.E.D., L.E.R. and E.N.L; 792

ChIP-seq Experiment, L.E.R.; ATAC-seq Experiment, J.E.D.; Initial Analysis, W.J.III; 793

Formal Analysis, J.E.D.; Protein Expression: M.M., S.W., and N.L.F.; Gel-shift 794



https://www.zotero.org/google-docs/?fAvNMk

https://www.zotero.org/google-docs/?8QorPJ



https://www.zotero.org/google-docs/?gpinjZ

https://www.zotero.org/google-docs/?PuCdUo

https://www.zotero.org/google-docs/?Nwja3U

https://www.zotero.org/google-docs/?Nwja3U

https://www.zotero.org/google-docs/?tfP35V

https://www.zotero.org/google-docs/?xKa9Lw

https://doi.org/10.1101/2020.07.15.205054


44

Experiment, A.H and J.E.D.; Investigation, J.E.D; Data Curation, J.E.D; Writing--Original 795

Draft, J.E.D. and E.N.L.; Writing--Review & Editing, J.E.D., L.E.R. and E.N.L.; 796

Visualization, J.E.D. and L.E.R.; Funding Acquisition, L.E.R. and E.N.L. 797

798

DECLARATION OF INTERESTS 799

The authors declare no competing interests. 800

801

REFERENCES 802

803

Alekseyenko AA, Peng S, Larschan E, Gorchakov AA, Lee O-K, Kharchenko P, McGrath SD, 804

Wang CI, Mardis ER, Park PJ, Kuroda MI. 2008. A Sequence Motif within Chromatin 805

Entry Sites Directs MSL Establishment on the Drosophila X Chromosome. Cell 134:599–806

609. doi:10.1016/j.cell.2008.06.033 807

Amemiya HM, Kundaje A, Boyle AP. 2019. The ENCODE Blacklist: Identification of Problematic 808

Regions of the Genome. Scientific Reports 9:9354. doi:10.1038/s41598-019-45839-z 809

Bhat KM, Farkas G, Karch F, Gyurkovics H, Gausz J, Schedl P. 1996. The GAGA factor is 810

required in the early Drosophila embryo not only for transcriptional regulation but also for 811

nuclear division. Development 122:1113–1124. 812

Blythe SA, Wieschaus EF. 2015. Zygotic Genome Activation Triggers the DNA Replication 813

Checkpoint at the Midblastula Transition. Cell 160:1169–1181. 814

doi:10.1016/j.cell.2015.01.050 815

Bosch JR ten, Benavides JA, Cline TW. 2006. The TAGteam DNA motif controls the timing of 816

Drosophila pre-blastoderm transcription. Development 133:1967–1977. 817

doi:10.1242/dev.02373 818

Cirillo LA, Lin FR, Cuesta I, Friedman D, Jarnik M, Zaret KS. 2002. Opening of compacted 819



https://www.zotero.org/google-docs/?IBJNba































https://doi.org/10.1101/2020.07.15.205054


45

chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol 820

Cell 9:279–289. doi:10.1016/s1097-2765(02)00459-8 821

Cirillo LA, Zaret KS. 1999. An early developmental transcription factor complex that is more 822

stable on nucleosome core particles than on free DNA. Mol Cell 4:961–969. 823

doi:10.1016/s1097-2765(00)80225-7 824

Combs PA, Eisen MB. 2017. Genome-wide measurement of spatial expression in patterning 825

mutants of Drosophila melanogaster. F1000Research 6:41. 826

doi:10.12688/f1000research.9720.1 827

Farkas G, Gausz J, Galloni M, Reuter G, Gyurkovics H, Karch F. 1994. The Trithorax-like gene 828

encodes the Drosophila GAGA factor. Nature 371:806–808. doi:10.1038/371806a0 829

Fuda NJ, Guertin MJ, Sharma S, Danko CG, Martins AL, Siepel A, Lis JT. 2015. GAGA Factor 830

Maintains Nucleosome-Free Regions and Has a Role in RNA Polymerase II Recruitment 831

to Promoters. PLoS Genet 11. doi:10.1371/journal.pgen.1005108 832

Gergen JP. 1987. Dosage Compensation in Drosophila: Evidence That daughterless and Sex-833

lethal Control X Chromosome Activity at the Blastoderm Stage of Embryogenesis. 834

Genetics 117:477–485. 835

Givler T, Lilienthal P. 2005. Using HOMER Software, NREL’s Micropower Optimization Model, 836

to Explore the Role of Gen-sets in Small Solar Power Systems; Case Study: Sri Lanka 837

(No. NREL/TP-710-36774). National Renewable Energy Lab., Golden, CO (US). 838

doi:10.2172/15016073 839

Hamm DC, Bondra ER, Harrison MM. 2015. Transcriptional Activation Is a Conserved Feature 840

of the Early Embryonic Factor Zelda That Requires a Cluster of Four Zinc Fingers for 841

DNA Binding and a Low-complexity Activation Domain. J Biol Chem 290:3508–3518. 842

doi:10.1074/jbc.M114.602292 843

Hamm DC, Larson ED, Nevil M, Marshall KE, Bondra ER, Harrison MM. 2017. A conserved 844

maternal-specific repressive domain in Zelda revealed by Cas9-mediated mutagenesis 845

















































https://doi.org/10.1101/2020.07.15.205054


46

in Drosophila melanogaster. PLoS Genet 13. doi:10.1371/journal.pgen.1007120 846

Hannon CE, Blythe SA, Wieschaus EF. 2017. Concentration dependent chromatin states 847

induced by the bicoid morphogen gradient. eLife 6:e28275. doi:10.7554/eLife.28275 848

Harrison MM, Li X-Y, Kaplan T, Botchan MR, Eisen MB. 2011. Zelda Binding in the Early 849

Drosophila melanogaster Embryo Marks Regions Subsequently Activated at the 850

Maternal-to-Zygotic Transition. PLOS Genetics 7:e1002266. 851

doi:10.1371/journal.pgen.1002266 852

Iwafuchi-Doi M, Donahue G, Kakumanu A, Watts JA, Mahony S, Pugh BF, Lee D, Kaestner KH, 853

Zaret KS. 2016. The pioneer transcription factor FoxA maintains an accessible 854

nucleosome configuration at enhancers for tissue-specific gene activation. Mol Cell 855

62:79–91. doi:10.1016/j.molcel.2016.03.001 856

Jalili V, Matteucci M, Masseroli M, Morelli MJ. 2015. Using combined evidence from replicates 857

to evaluate ChIP-seq peaks. Bioinformatics 31:2761–2769. 858

doi:10.1093/bioinformatics/btv293 859

Jukam D, Shariati SAM, Skotheim JM. 2017. Zygotic Genome Activation in Vertebrates. Dev 860

Cell 42:316–332. doi:10.1016/j.devcel.2017.07.026 861

Kaye EG, Booker M, Kurland JV, Conicella AE, Fawzi NL, Bulyk ML, Tolstorukov MY, Larschan 862

E. 2018. Differential Occupancy of Two GA-Binding Proteins Promotes Targeting of the 863

Drosophila Dosage Compensation Complex to the Male X Chromosome. Cell Rep 864

22:3227–3239. doi:10.1016/j.celrep.2018.02.098 865

Krueger F. 2017. Trim Galore: a wrapper script to automate quality and adapter trimming as well 866

as quality control. Available online at: 867

https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/. 868

Lee MT, Bonneau AR, Giraldez AJ. 2014. Zygotic genome activation during the maternal-to-869

zygotic transition. Annu Rev Cell Dev Biol 30:581–613. doi:10.1146/annurev-cellbio-870

100913-013027 871



















































https://doi.org/10.1101/2020.07.15.205054


47

Leibovitch BA, Lu Q, Benjamin LR, Liu Y, Gilmour DS, Elgin SCR. 2002. GAGA Factor and the 872

TFIID Complex Collaborate in Generating an Open Chromatin Structure at the 873

Drosophila melanogaster hsp26 Promoter. Molecular and Cellular Biology 22:6148–874

6157. doi:10.1128/MCB.22.17.6148-6157.2002 875

Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 876

1000 Genome Project Data Processing Subgroup. 2009. The Sequence Alignment/Map 877

format and SAMtools. Bioinformatics 25:2078–2079. doi:10.1093/bioinformatics/btp352 878

Li X-Y, Harrison MM, Villalta JE, Kaplan T, Eisen MB. 2014. Establishment of regions of 879

genomic activity during the Drosophila maternal to zygotic transition. eLife 3:e03737. 880

doi:10.7554/eLife.03737 881

Liang H-L, Nien C-Y, Liu H-Y, Metzstein MM, Kirov N, Rushlow C. 2008. The zinc-finger protein 882

Zelda is a key activator of the early zygotic genome in Drosophila. Nature 456:400–403. 883

doi:10.1038/nature07388 884

Mayran A, Drouin J. 2018. Pioneer transcription factors shape the epigenetic landscape. J Biol 885

Chem 293:13795–13804. doi:10.1074/jbc.R117.001232 886

McDaniel SL, Gibson TJ, Schulz KN, Fernandez Garcia M, Nevil M, Jain SU, Lewis PW, Zaret 887

KS, Harrison MM. 2019. Continued Activity of the Pioneer Factor Zelda Is Required to 888

Drive Zygotic Genome Activation. Mol Cell 74:185-195.e4. 889

doi:10.1016/j.molcel.2019.01.014 890

Peti W, Page R. 2007. Strategies to maximize heterologous protein expression in Escherichia 891

coli with minimal cost. Protein Expr Purif 51:1–10. doi:10.1016/j.pep.2006.06.024 892

Prayitno K, Schauer T, Regnard C, Becker PB. 2019. Progressive dosage compensation during 893

Drosophila embryogenesis is reflected by gene arrangement. EMBO Rep 20:e48138. 894

doi:10.15252/embr.201948138 895

R Core Team. 2014. R: A Language and Environment for Statistical Computing. 896

Ramírez F, Dündar F, Diehl S, Grüning BA, Manke T. 2014. deepTools: a flexible platform for 897





















































https://doi.org/10.1101/2020.07.15.205054


48

exploring deep-sequencing data. Nucleic Acids Res 42:W187–W191. 898

doi:10.1093/nar/gku365 899

Rieder LE, Jordan WT, Larschan EN. 2019. Targeting of the Dosage-Compensated Male X-900

Chromosome during Early Drosophila Development. Cell Reports 29:4268-4275.e2. 901

doi:10.1016/j.celrep.2019.11.095 902

Rieder LE, Koreski KP, Boltz KA, Kuzu G, Urban JA, Bowman SK, Zeidman A, Jordan WT, 903

Tolstorukov MY, Marzluff WF, Duronio RJ, Larschan EN. 2017. Histone locus regulation 904

by the Drosophila dosage compensation adaptor protein CLAMP. Genes Dev 31:1494–905

1508. doi:10.1101/gad.300855.117 906

Rosanova A, Colliva A, Osella M, Caselle M. 2017. Modelling the evolution of transcription 907

factor binding preferences in complex eukaryotes. Sci Rep 7. doi:10.1038/s41598-017-908

07761-0 909

Schulz KN, Bondra ER, Moshe A, Villalta JE, Lieb JD, Kaplan T, McKay DJ, Harrison MM. 2015. 910

Zelda is differentially required for chromatin accessibility, transcription factor binding, 911

and gene expression in the early Drosophila embryo. Genome Res 25:1715–1726. 912

doi:10.1101/gr.192682.115 913

Soruco MML, Chery J, Bishop EP, Siggers T, Tolstorukov MY, Leydon AR, Sugden AU, Goebel 914

K, Feng J, Xia P, Vedenko A, Bulyk ML, Park PJ, Larschan E. 2013. The CLAMP protein 915

links the MSL complex to the X chromosome during Drosophila dosage compensation. 916

Genes Dev 27:1551–1556. doi:10.1101/gad.214585.113 917

Soufi A, Garcia MF, Jaroszewicz A, Osman N, Pellegrini M, Zaret KS. 2015. Pioneer 918

transcription factors target partial DNA motifs on nucleosomes to initiate reprogramming. 919

Cell 161:555–568. doi:10.1016/j.cell.2015.03.017 920

Stark R, Brown G. 2019. DiffBind: Differential Binding Analysis of ChIP-Seq Peak Data. 921

Bioconductor version: Release (3.10). doi:10.18129/B9.bioc.DiffBind 922

Stott K, Blackburn JM, Butler PJ, Perutz M. 1995. Incorporation of glutamine repeats makes 923

















































https://doi.org/10.1101/2020.07.15.205054


49

protein oligomerize: implications for neurodegenerative diseases. PNAS 92:6509–6513. 924

doi:10.1073/pnas.92.14.6509 925

Sun Y, Nien C-Y, Chen K, Liu H-Y, Johnston J, Zeitlinger J, Rushlow C. 2015. Zelda overcomes 926

the high intrinsic nucleosome barrier at enhancers during Drosophila zygotic genome 927

activation. Genome Res 25:1703–1714. doi:10.1101/gr.192542.115 928

Tariq M, Wegrzyn R, Anwar S, Bukau B, Paro R. 2013. Drosophila GAGA factor polyglutamine 929

domains exhibit prion-like behavior. BMC Genomics 14:374. doi:10.1186/1471-2164-14-930

374 931

Urban J, Kuzu G, Bowman S, Scruggs B, Henriques T, Kingston R, Adelman K, Tolstorukov M, 932

Larschan E. 2017. Enhanced chromatin accessibility of the dosage compensated 933

Drosophila male X-chromosome requires the CLAMP zinc finger protein. PLOS ONE 934

12:e0186855. doi:10.1371/journal.pone.0186855 935

Urban JA, Urban JM, Kuzu G, Larschan EN. 2017. The Drosophila CLAMP protein associates 936

with diverse proteins on chromatin. PLoS ONE 12:e0189772. 937

doi:10.1371/journal.pone.0189772 938

Wilkins RC, Lis JT. 1999. DNA distortion and multimerization: novel functions of the glutamine-939

rich domain of GAGA factor. Journal of Molecular Biology 285:515–525. 940

doi:10.1006/jmbi.1998.2356 941

Zaret KS, Carroll JS. 2011. Pioneer transcription factors: establishing competence for gene 942

expression. Genes Dev 25:2227–2241. doi:10.1101/gad.176826.111 943

Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, 944

Brown M, Li W, Liu XS. 2008. Model-based analysis of ChIP-Seq (MACS). Genome Biol 945

9:R137. doi:10.1186/gb-2008-9-9-r137946

















































https://doi.org/10.1101/2020.07.15.205054


50

Figure S1. CLAMP and ZLD both activate transcription of zygotic genes

A-B. Effect of maternal CLAMP depletion and CLAMP binding on maternally deposited

(left) and zygotically transcribed (right) gene expression: log2 (clamp-i/MTD) in 0-2hr and

2-4hr embryos. Gene categories were defined in Lott et al. (2011).

C-D. Percentage of CLAMP and ZLD binding sites distributed in maternal (n = 646), early (n

= 69), mid-(n = 73), late- (n = 104), later (n = 74), and silent (n = 921) genes (peaks within a

1kb promoter region and gene body). Gene categories were defined in Li et al. (2014).



https://www.zotero.org/google-docs/?y0cpra

https://doi.org/10.1101/2020.07.15.205054


51

Figure S2. CLAMP regulates chromatin accessibility throughout ZGA

A-B.Pearson correlation of DA calls among replicates of peaks in MTD vs. clamp-i embryos at

0-2hr and 2-4hr time points.

C-D. GO terms for genes that require CLAMP for chromatin accessibility at 0-2hr and 2-4hr

time points.



https://doi.org/10.1101/2020.07.15.205054


52

Figure S3. CLAMP-mediated chromatin accessibility is correlated with early CLAMP-

dependent gene expression

A-B. Heatmap of 1 kb regions centered on CLAMP and/or ZLD ChIP-seq peaks at 0-2 and

2-4 hour time points. Blue represents above and red represents below background

enrichment. Color key values represent the log2 ratio between peak vs. background

normalized ChIP-seq signal.

C. Expression of mRNAs in MTD, clamp-i and zld-i embryos in 0-2hr and 2-4hr embryos.

mRNA levels of clamp and zld were quantified by qRT-PCR. Log2 Fold Change was calculated

using the ΔΔCt method (Rao et al., 2013) and normalized to reference gene pka.

D. Western blot of CLAMP, ZLD and reference control ACTIN in MTD, clamp-i and zld-i

embryos in 0-2hr and 2-4hr embryos.

MTD: MTD-Gal4 line. clamp-i: MTD-Gal4-clamp mRNAi line, zld-i: MTD-Gal4-zld mRNAi line.



https://doi.org/10.1101/2020.07.15.205054


53

Figure S4. CLAMP and ZLD depend on each other for chromatin binding

A-B. Heatmaps of 1 kb regions centered on CLAMP and/or ZLD peaks in 0-2 and 2-4 hour

samples. Blue represents above and red represents below background enrichment. Color key

values represent the log2 ratio between peak vs. background normalized ChIP-seq signal.

C. CLAMP (green) and ZLD (orange) peaks and shared peaks where both CLAMP and ZLD are

present in 0-2hr and 2-4hr embryos. P-values represent the significance (hypergeometric test)

of overlap.

D. Heat maps of the ZLD peak enrichment from MTD embryos versus clamp-i embryos in 0-2hr

(left) or 2-4hr (right). Blue represents above and red represents below background enrichment.

Color key values represent the log2 ratio between peak vs. background.

E. Heat maps of the CLAMP peak enrichment from MTD embryos versus zld-i embryos in 0-2hr

(left) or 2-4hr (right). Blue represents above and red represents below background enrichment.

Color key values represent the log2 ratio between peak vs. background.

F. Venn diagram showing the number of overlap sites between ZLD and CLAMP down-DB or

ZLD and CLAMP non-DB. P-values represent the significance (hypergeometric test) of overlap.

MTD: MTD-Gal4 line. clamp-i: MTD-Gal4-clamp mRNAi line, zld-i: MTD-Gal4-zld mRNAi line.



https://doi.org/10.1101/2020.07.15.205054


54

Figure S5. Transcription of dependent sites is regulated by the required protein via

motifs.

A. Top de novo and known motifs for CLAMP DB peaks.

B. Top de novo and known motifs for non-DB peaks.

C. Top de novo and known motifs for ZLD DB peaks.

D. Top de novo and known motifs for ZLD non-DB peaks.

CLAMP motif 1: CLAMP unique motif; CLAMP motif 2: GA motifs that are recognized by

CLAMP or GAF; unannotated motifs are novel/unknown motifs.

E. Boxplots for CLAMP or ZLD motif enrichment at CLAMP DB and non-DB peaks for MTD vs.

zld-i embryos at 0-2hr and 2-4hr time points.

F. Boxplots for CLAMP or ZLD motif enrichment at ZLD DB and non-DB peaks of MTD vs.

clamp-i embryos at 0-2hr and 2-4hr time points.



https://doi.org/10.1101/2020.07.15.205054


2 zygotic genome activation Drosophila · 15/07/2020 · 19 Mary McKenney [email protected]...

Documents

Transcript of 2 zygotic genome activation Drosophila · 15/07/2020 · 19 Mary McKenney [email protected]...