2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria...

8/13/2019 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria Alternata

http://slidepdf.com/reader/full/2-induced-resistance-in-tomato-plants-to-the-toxin-dependent-necrotrophic-pathogen 1/11

Induced resistance in tomato plants to the toxin-dependent necrotrophic

pathogen Alternaria alternata

Mayumi Egusa a, Hajime Akamatsu b,1, Takashi Tsuge c, Hiroshi Otani b, Motoichiro Kodama b,*

a The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japanb Laboratory of Plant Pathology, Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japanc Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa, Nagoya 464-8601, Japan

a r t i c l e i n f o

Article history:

Accepted 3 February 2009

Keywords:

Alternaria alternata

Host-specific toxin

AAL-toxin

Salicylic acid

Jasmonic acid

Induced resistance

Solanum lycopersicum

a b s t r a c t

A necrotrophic pathogen, the tomato pathotype of Alternaria alternata ( Aa) causes Alternaria stem canker

on tomato. Its pathogenicity depends on the production of host-specific AAL-toxin. Pre-inoculation with

nonpathogenic Aa or pretreatment an elicitor prepared from Aa reduced disease symptoms by the

pathogen. Salicylic acid (SA)- and jasmonic acid (JA)-dependent defense responses in tomato are not

involved in the resistance to the pathogen induced by nonpathogenic A a. The results suggest that an

alternative and unknown signaling pathway independent of SA- and JA-signaling might modulate the

induced resistance by activating the expression of the multiple defense genes.

2009 Elsevier Ltd. All rights reserved.

1. Introduction

Plants are exposedto a large numberof microorganisms, most of

which are not able to invade plants because of the preformed

resistance, including cell wall and antimicrobial compounds, and

because of induced resistance, including the elicitor-induced

production of phytoalexin and pathogenesis-related (PR) proteins

[1–4]. There are many reports concerning the resistance conferred

by a specific interaction between the fungal avirulence gene ( Avr )

and the plant resistance gene (R), called gene-for-gene resistance

[1,3,5]. Because gene-for-gene resistance is generally regarded as

race/cultivar specific, this type of resistance is called host resistance

and the products of Avr genes are the specific elicitors [2,3,5]. On

the other hand, the resistance that does not depend on R/ Avr

interaction and is induced in broad range of host plants againstbroad spectrum pathogens has been considered as basal resistance,

general resistance or non-host resistance which is triggered by

non-specific or general elicitors known as microbe-associated

molecular patterns (MAMPs) [1,2,5,6]. Recently, several MAMPs,

including bacterial flagellin (e.g., flg22 highly conserved 22 amino

acids in flagellin [7]), lipopolysaccharide, elongation factor Tu (EF-

Tu [8]), and fungal chitin and b-glucans [9,10] have been well

characterized. MAMPs are constitutively present in microbes and

are essential for viability, for example as main structural compo-

nents of cell walls or membranes, and bacterial motility.

Plant defense responses are activated by the perception of these

elicitors or MAMPs through signal transduction pathways. Salicylic

acid (SA) and jasmonic acid (JA)/ethylene (ET) signaling have been

well demonstrated as playing important roles in both basal and

specific resistance [2,11–13,19]. It is well known that SA signaling is

important for resistance against biotrophic pathogens, whereas JA/

ET signaling is important against necrotrophic pathogens, and that

these signaling pathways interact with each other in a complicated

manner [11–13]. Application of SA and its analogs enhanced

resistance in Arabidopsis or tobacco against Erwinia carotovora,

Peronospora parasitica, Phytophthora parasitica, Pseudomonassyringae pv. maculicola, and tobacco mosaic virus [12–16]. On the

other hand, exogenous JA and methyl jasmonate (MeJA) application

plant induced resistance against Alternaria brassicicola, Botrytis

cinerea and Phytophthora infestans [12,13,17,18]. Furthermore,

expression of SA- or JA-dependent genes was increased infection

with virulent and a virulent pathogens [19].

In addition to this evidence, the isolation of signaling mutants

has helped to elucidate the role of signaling in host defense

responses. Transgenic Arabidopsis plants expressing NahG, which

are unable to accumulate SA and express the SA-dependent PR-

genes [20], npr1/nim1, which have a defect in responding to SA and

* Corresponding author. Tel./fax:þ81 857 31 5364.

E-mail address: [email protected] (M. Kodama).1 Present address: Biological Resources Division, Japan international Research

Center for Agricultural Sciences, 1-1 Ohwashi, Tsukuba, Ibaraki 305-8686 Japan.

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / p m p p

0885-5765/$ – see front matter 2009 Elsevier Ltd. All rights reserved.

doi:10.1016/j.pmpp.2009.02.001

Physiological and Molecular Plant Pathology 73 (2009) 67–77

mailto:[email protected]

http://www.sciencedirect.com/science/journal/08855765

http://www.elsevier.com/locate/pmpp

http://www.elsevier.com/locate/pmpp

http://www.sciencedirect.com/science/journal/08855765

mailto:[email protected]



expressing SA-dependent genes [14,15], and sid2, which fail to

accumulate SA [21], have shown enhanced susceptibility not only

to virulent and a virulent pathogens but also to non-host patho-

gens, including Blumeria graminis, Erysiphe orontii, Peronospora

parasitica, P. syringae pv. maculicola and Uromyces vignae

[12,14,15,21–23]. In contrast, the JA-related tomato mutant def1,

which is defective in the octadecanoid synthesis pathway and in

the systemic wound signaling pathway [24,25], exhibited increased

susceptibility to Fusarium oxysporum f. sp. lycopersici, P. syringae, P.

infestans and Verticillium dahliae [26]. The JA-insensitive Arabi-

dopsis coi1 mutant [27] also showed enhanced susceptibility

against A. brassicicola and B. cinerea [12].

Alternaria alternata (Fries) Keissler ( Aa) is a ubiquitous fungus

that can be found on many kinds of plants and other substrata.

While having a general potential for aggressiveness, most of them

are unable to invade the potential host plants due to basal, general

or non-host resistance [28,29]. However, some of these fungal

pathogens are necrotrophic and produce host-specific toxins (HSTs)

that cause necrotic cell death only on susceptible plant cultivars

[28–31]. HSTs are defined as pathogen effectors that induce toxicity

and promote disease only in the susceptible host plants [32].

The tomato pathotype of Aa, which produces host-specific AAL-

toxins, causes Alternaria stem canker on susceptible tomato culti-vars [28,33]. AAL-toxins have shown to induce the infection of

nonpathogenic Aa, which does not produce these toxins, on

susceptible tomato cultivars at low concentrations [34]. AAL-toxin-

deficient mutants cannot cause symptoms on susceptible tomatoes

[35]. These results indicate that the AAL-toxins play an essential

role in the pathogenicity of the tomato- Aa pathotype. The structure

of the AAL-toxins, which is a chemically related analog of the

mycotoxin fumonisins produced by Fusarium moniliforme, has

already been determined [36,37]. AAL-toxins and fumonisins are

sphinganine-analog mycotoxins that induce apoptotic cell death in

susceptible tomato and mammalian cells by inhibiting ceramide

biosynthesis [38–40]. In the resistant cultivar, insensitivity to AAL-

toxin is conferred by the resistance gene Asc-1 (Alternaria stem

canker), a homolog of the yeast longevity assurance gene (LAG1),which appears to salvage the endoplasmic reticulum-to-Golgi

transportation of glycosylphosphatidylinositol-anchored proteins

by the production of alternative ceramide [41].

Although roles for toxins as effectors of disease susceptibility

have been well characterized in many plant-pathogen interactions,

there is little knowledge on the mechanisms of general, basal or

non-host resistance in host plants against toxigenic and necrotro-

phic pathogens that depend on toxins for their pathogenesis,

except for defense responses in rough lemon against Aa [42–44].

We have analyzed the induced- and basal-defense responses of

plants against Aa, using the Aa/AAL-toxin and tomato interaction as

a model system. Here, we demonstrate that the resistance against

pathogenic Aa was induced by infection with nonpathogenic Aa.

Furthermore, SA- and JA-dependent signaling pathways are notinvolved in host defense against the necrotrophic and toxin-

dependent Aa pathogen. Rather, the induced resistance might be

activated by alternative unknown signaling involving the activated

expression of multiple defense genes.

2. Materials and methods

2.1. Fungal strains and plant materials

The tomato pathotype of A. alternata ( Aa) (synonym A. alternata

f. sp. lycopersici, synonym A. arborescens) strain As-27, which

produces host-specific AAL-toxins, and nonpathogenic strain O-94

producing no AAL-toxin, was maintained on potato dextrose agar

(PDA) (Difco, Detroit, MI, USA) slopes or as 15% glycerol stocks at

80 C. For pathogenicity tests, spores of the fungus were prepared

as previously described [45]. Corynespora cassiicola [46,47] strain

LC93020, which produces the host-specific CCT-toxin, was main-

tained on PDA as described above, and conidia of the fungus were

prepared as described previously [48]. B. cinerea strain O-235 was

maintained on PDA and conidia were prepared by culturing on V-8

Juice agar plates under Black Light Blue (BLB) light for 2 days and

then in the dark for 1 week. Spores formed on the plates were

harvested by brushing the surface of the plates and suspended in

distilled water containing 1% peptone.

Tomato plants (Solanum lycopersicum L.) were grown in steril-

ized soil in a growth chamber (Growth Cabinet MLR-350, Sanyo,

Osaka) with a 16 h photoperiod at 25 C. After 5 weeks of growth,

tomato plants were grown in a greenhouse at 24–26 C. Tomato

cultivar Aichi-first (AF; Toyohashi Seed Co., Aichi, Japan) was highly

susceptible to the tomato pathotype of Aa, and cultivar Micro-Tom

was resistant [48]. The jasmonate biosynthetic mutant def1 [24,25]

was kindly provided by G.A. Howe, and the NahG [20] transgenic

tomato mutant expressing the SA hydroxylase gene was provided

by J. Jones.

2.2. Assay for induced resistance

The detached leaves of tomato cultivar AF (8 weeks old)

were inoculated with spore suspension (106 spores ml1) of the

nonpathogenic strain O-94 using a glass atomizer and incubated in

a moist chamber for 6 h at25 C. The leaves were then washed with

distilled water (DW) and sprayed with spore suspension

(106 spores ml1) of the virulent strain As-27 or spore suspensions

(105 spores ml1) of LC93020. Thenecrotic lesionarea wasobserved

4 days post-inoculation (dpi).

A whole plant of the cultivar Micro-Tom (5-weeks-old) was

inoculated with spore suspension of O-94, covered with a plastic

bag and maintained under the same conditions as described above.

After 24 h, the plant was rinsed with DWand inoculated with spore

suspension (5106 spores ml1) of B. cinerea. The necrotic area was

determined by using ATTO analyzing software (ATTO Densitographseries Version 2.0, ATTO, Tokyo, Japan) at 3 dpi.

2.3. Microscopic observation

Inoculated leaves were fixed and decolorized in ethanol-acetic

acid solution (3:1, v/v) until chlorophyll was removed. The leaves

were then stained with aniline blue (0.1%, w/v) in lactophenol

(1:1:1:1, v/v/v/v, lactic acid/glycerol/phenol/water) at 65 C for 3 h.

The infection behaviors, spore germination, appressorium forma-

tion and infection haypha formation were observed under a light

microscope (Nikon, Tokyo, Japan).

2.4. Real-time PCR

For the estimation of in plant fungal biomass, fungal genomic

DNAs were extracted from 0.1 g of inoculated leaves with DNeasy

Plant Mini Kit (Qiagen, Tokyo, Japan), following the manufacturer’s

instructions. Extracted DNA was diluted 1/100 and used for real-

time PCR template. Real-time PCR was performed using SYBER

Green system on a LightCycler (Roche Diagnostics, Tokyo, Japan).

Five ml of diluted DNA was added to a 20-ml reaction containing 4 ml

SYBER Green Mastermix, 0.5 mM gene specific primers pairs. The

primer pairs (DeH-F, 50-CTCCGCCTGCCAATGTGATTAC-30 and E8T7,

50-GCGTACCAAGGCACGTGCTCAA-30) designed for amplification of

the gene for AAL-toxin biosynthesis ( ALT1) were used for detecting

the tomato pathotype of Aa [34,49]. PCR was performed with an

initial stepof 10 min at 95 C followedby 35cycles of5 sat 95 C,6 s

at68

C,10 s at 72

C, and then melting program of 0 s at 95

C, and

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 67–77 68



slowly heated from 73 to 97 C at0.1 C s1. The primerpairs (CCT-F,

50-GGCGAGCTGATTATTGAAGG-30 and CCT-R, 50-CCTGTGGGAA-

TAAAGTCTGG-30) designed for amplification of the gene for a non-

ribosomal peptide synthetase specifically found in C. cassiicola

strains (M. Kodama, personal communication) were used for

quantifying the DNAs of C. cassiicola. PCR was performed with an

initial stepof 10 min at95 C followed by35 cyclesof 1 s at 95 C,5 s

at 60 C,18 s at 72 C, and then melting program of 0 s at 95 C, and

slowly heated from 65 to 97 C at 0.2 C s1. Standard curve was

created with fungal genomic DNAs as a template, which prepared

from As-27 or LC93020 mycelia by DNeasy Plant Mini Kit (Qiagen).

To analyze the expression of genes for disease resistance in

tomato, a whole plant of AF (5-weeks-old) was inoculated with O-

94 spore suspensions (106 spores ml1) by spray treatment. The

plants were covered with a plastic bag to keep a high-humidity and

incubated at 25 C in a growth chamber. After 6, 12 and 24 h of

incubation, leaveswere harvestedand total RNA was extracted with

RNeasy Plant Mini Kits (Qiagen), following the manufacturer’s

instructions. Total RNA was treated with DNase I (Nippongene,

Toyama, Japan) to remove traces of contaminating DNA and 1 mg of

RNA was converted into cDNA by the RNA PCR kit (AMV) Ver. 3.0

(Takara,Shiga,Japan)using random9 mers primer, according to the

manufacturer’s conditions. Real-time PCR was conducted with 2 mlof the cDNA sample and the specific primers indicated in Table 1 as

described above. PCR was performed with an initial step of 10 min

at 95 C followed by 35 cycles of 1 s at 95 C, 5 s at 58 C, 10 s at

72 C, and then melting program of 0 s at 95 C, and slowly heated

from 63 to 97 C at 0.1 C s1.

2.5. Preparation and treatment Aa elicitor

Spore suspensions (106 spores ml1) of O-94 were dropped in

a moist chamber and incubated at 25 C for 24 h. After incubation,

the spore germination fluids (SGF) were collectedand filtrated withWhatman No.50 filter paper, and then the filtrate was concentrated

20-fold of the original volume by lyophilization and used as the

elicitor. AF leaves were sprayed with the elicitor solution or DWand

incubated in moist chamber at 25 C for 6 h. After rinsing with DW,

the leaves were inoculated with As-27 spore suspensions

(106 spores ml1). AF leaves were also inoculated with As-27 spores

suspended in the elicitor solution. The lesion formation was

observed at 4 dpi.

2.6. Effect of SA or MeJA on Aa

AF plants were treated with SA (0.2 mM) or MeJA (100 mM)

solution by root feeding. After 24 h, AF plants were inoculated with

spore suspension (106 spores ml1) of As-27 using grass atomizer.Necrotic lesion formation was observed at 4 dpi. The leaves of 8-

week-old def1 and NahG plants were inoculated with spore

suspension of O-94 (106 spores ml1). After 4 days, inoculated

leaves were fixed and decolorized, and the infection behaviors of O-

94 were observed as described above.

2.7. SA determination

AF leaves were inoculated with spore suspension of O-94 or As-

27, or treated with elicitor. After 24 h, leaves (0.5 g) were ground in

liquid nitrogen, then SA and SA conjugates were extracted and

analyzed as described Enyedi et al. [50]. HPLC analysis was per-

formed using a Hitachi HPLC system equipped with a F-1050 fluo-

rescence spectrophotometer, L-6000 pump, L-5000 LC controller,

and D-2500 chromato-integrator (Hitachi, Tokyo, Japan). The

sample wasinjectedand chromatographed on an ODS-UG-5column

(4.6150 mm) using methanol/0.1%(v/v) phosphate (75:25, v/v) at

a flow rate of 0.7 ml/min. The excitation and emission wavelengths

were 295 nm and 400 nm, respectively.

2.8. Suppression subtractive hybridization (SSH)

For RNA preparation, AF plants were treated with spores of O-94

(106 spores 1ml) or DW. Tomato leaves were collected at 6, 12 and

24 h after inoculation and total RNA was extracted with the RNeasy

Plant Mini Kit (Qiagen). The mRNA was purified with the Poly-

ATtract mRNA isolation system (Promega, Tokyo, Japan) followingthe manufacturer’s instructions. SSH was performed with the

mRNA from DW-treated leaves as a driver and O-94-inoculated

leaves as a tester according to the protocol for the PCR-Select cDNA

subtraction kit (BD Biosciences Clonetech, Palo Alto, CA). After

cDNA amplification, PCR products were cloned into the pDrive

Cloning vector and transformed into Qiagen EZ Competent Cells

using the PCR Cloning kit (Qiagen) according to the supplier’s

protocol. In total, 262 randomly selected clones were one-pass

sequenced at the Dragon Genomics Center (Takara-Bio, Shiga,

Japan). The sequences of the clones were annotated using the NCBI

(National Center for Biotechnology Information) BlastN and BlastX

searches, and functional classification was performed using the

Arabidopsis thaliana Munich Information Center for Protein

Sequences database (MIPS, http://mips.gsf.de/projects/funcat).

Table 1

Oligonucleotide primers used in this study.

Primer pair Target genea Sequence (50/ 30)

94AF1A05-F AC215459 GTTCCCTTGGCTGTGGTTTC

94AF1A05-R TTAGTGACGCGCATGAATGG

94AF1G04-F AF512549 CCATTTGGTTTACGTAGCAG

94AF1G04-R CTCTCTAACCCTTGCTTCAC

94AF2C04-F BP910076 AGATGAAACAGTACAAGTGG

94AF2C04-R TGTCTTCTCTTTACTCTGTG

94AF2E09-F AK247674 ACGATGAGAGTAAGAACGCA94AF2E09-R GCCGATTATAACCCCTTCAC

94AF2E12-F BY999927 GCAAATTCCCACAAGGTTTC

94AF2E12-R TCTGTTTCACTGTAATGGCT

94AF2F12-F TC194085 GCCCCTGATGATCTGACCTT

94AF2F12-R TACGTGCAGCAAGAGTCTCA

94AF2H06-F BY999940 GGTTGCATATGTTGTTCGCT

94AF2H06-R TCAGTCAGAGAGCTATTGGG

94AF3A06-F BY999943 TCTTTATCCGCGTCTTGCTC

94AF3A06-R ATGGAACAGCCTCGTCTATG

94AF3F08-F L12051 GTTGGCATCACTAGGGTTGT

94AF 3F08-R CTCTGATGTGGGGTACTGTG

94AF 3F09-F BT013028 GACTTGTTTCTGGCACCTCA

94AF 3F09-R TGGCATAGCATCCTGGAAAG

94AF 4D02-F BY999978 CCCTTCCATTTCATTCCCAA

94AF 4D02-R GGAATGAGTGGATCTCCGAA

94AF 4E03-F TC206865 GGTGGTCTTTTCCTGCTATC

94AF 4E03-R TCCATTTGGAACTTAGCCTT

94AF 4G03-F TC206779 TGAGTGATCCGTACAAGACC

94AF 4G03-R CGGGTGATACTGAAGAGCAA

94AF4G11-F AK246682 ACTTGCAATTTGAGAACCTG

94AF4G11-R TGGGTAATCAGACTGCAAAA

94AF 4H04-F BY999995 GTTTGTATTGAAGATTGTGG

94AF 4H04-R ATCCAGAAAGGTATCATATC

94AF4H11-F BY999999 CTCCAAATCCCTAAACCTCT

94AF4H11-R AATGGTGATGATCTGTTGTG

94AF13-F AF230371 GAGCTTTTCGAAACCCTAGA

94AF13-R AAGACCGAGAGTTATCACAG

94AF35-F AF004165 GTGCCTATTACGCTCCTTGA

94AF35-R ATGTGCGGTGAATAGTCTGT

94AF36-F CJ999369 ACTGTAAGCATGATTGTCTC

94AF36-R CCAATCATGACATATCCACT

a Primer pairs were designed from SSH clones and corresponding genes of

tomatoes showing significant identities (more than 95%) by a BlastN search of NCBI

or the TIGR Gene Indices (http://compbio.dfci.harvard.edu/tgi/ ).


http://mips.gsf.de/projects/funcat

http://compbio.dfci.harvard.edu/tgi

http://compbio.dfci.harvard.edu/tgi




Fig. 1. Induced resistance to the tomato pathogens in tomato by pre-inoculation with nonpathogenic Aa. (a) The leaves of susceptible tomato AF were inoculated with

nonpathogenic Aa (O-94), the tomato pathotype of Aa (As-27) or C. cassiicola (LC93020). Tomato leaves pre-inoculated with O-94 were then inoculated with As-27 (Pre-O-94/ As-

27) or LC93020 (Pre-O-94/ LC93020). DW was treated as a control (DW). Lesion formation on the leaves was observed at 4 dpi. (b,c) Fungal biomass of the tomato pathogens in the

infected plants pre-inoculated with O-94 (Pre-O-94) or control (DW) was estimated by quantifying fungal DNA with real-time PCR using primers specific for the As-27 ALT1 gene (b)

and the LC93020 cyclic peptide synthetase gene (c). The results show relative values to control leaves for four independent experiments and error bars indicate standard error (SE).

An asterisk indicates a significant difference between pre-inoculated leaves and control (paired t -test, P < 0.05). RU; relative unit.




3. Results

3.1. Induced resistance to the tomato pathotype in tomato

To assess the effects of pre-inoculation with the non-pathogen

against infection by toxin-dependent pathogens, we inoculated

leaves of the susceptible tomato AF with nonpathogenic Aa strain

O-94 and then the tomato pathotype Aa strain As-27. Necrotic

lesion formation was observed on the leaves inoculated with As-27

(Fig. 1a), while there was no visible lesion, even hypersensitive

response (HR)-like cell death, on the leaves inoculated with O-94

(Fig.1a). Microscopic observation indicated that spore germination

and appressorium formation of O-94 on AF leaves were normal,

whereas infection hypha formation was clearly inhibited (data not

shown). The combination of pathogenic Aa As-27 and resistance

cultivar Micro-Tom also resulted in no visible symptoms and

a suppression of infection hypha formation, as is the case with the

non-pathogen and cultivar AF [48]. The results indicate that

formation of the infection hypha is the most critical step for

successful infection by Aa pathogens. On the other hand, when AF

leaves were inoculated with As-27 following pre-inoculated with

O-94, lesion formation by the pathogen clearly decreased

compared with the control inoculation (Fig. 1a). Because O-94 and

As-27 are morphologically indistinguishable under the microscope,

it is difficult to observe the infection behaviors of the pathogen on

the leaves pre-inoculated with the non-pathogen. The amount of in

planta fungal DNA representing the biomass of As-27 in AF leaves

was quantified by real-time PCR using ALT1 specific primers. Fig. 1b

shows that the amount of fungal biomass of As-27 in AF leaves

inoculated with As-27 following O-94 was 2.1-times less than that

in control leaves (paired t -test, P < 0.05). These results imply that

infection by the pathogen was suppressed by pre-inoculation with

the nonpathogenic strain. The SGF prepared from the germinating

spores of O-94 was used as an elicitor. AF leaves were pretreated

with the elicitor, and after 6 h of incubation the leaves were inoc-

ulated with spores of As-27. Treatment of leaves with the elicitor

alone did not cause any visible change on the leaves (Fig. 2a),

suggesting that the elicitor does not induce HR-like cell death on

tomato leaves. Lesion formation by As-27 was inhibited by

pretreatment of the elicitor, as well as by pre-inoculation with O-94

(Fig. 2a). When AF leaves were inoculated with spores of As-27

suspended in the elicitor solution (i.e., the simultaneous treatment

with elicitor and pathogen), the development of symptoms on the

leaves was not suppressed (Fig. 2a). Infection behaviors of As-27

spores on the inoculated leaves were observed under the micro-

scope. The rates of spore germination and appressorium formation

Fig. 2. Induced resistance to the Aa tomato pathotype in tomato by pretreatment with elicitor. The elicitor was prepared from nonpathogenic Aa spore germination fluids. (a) Leaves

of AF were pretreated with elicitor and then inoculated with As-27 (Pre-elicitor/As-27). AF leaves were inoculated with As-27 with the elicitor simultaneously (Elicitor þAs-27).

Elicitor treatment (Elicitor) and As-27 inoculation (As-27) only were used as controls. Lesion formation was observed at 4 dpi. (b) Infection behaviors of As-27 were observed under

light microscopy 48 h post-inoculation. SG; spore germination, A; appressorium formation, IH; infection hypha formation. Data represent the mean of four independent experi-

ments, and error bars indicate SE. Different letters indicate significant levels of difference (Duncan’s new multiple range test, P <

0.05).




were similar among all treatments and inoculations (Fig. 2b). On

the other hand, infection hypha formation was clearly inhibited by

pretreatment of the elicitor (Fig. 2b).

3.2. Induced resistance in tomato by nonpathogenic Aa to infection

with other necrotrophic pathogens

To evaluate the effectiveness of the induced resistance by

nonpathogenic Aa against infection with other necrotrophic path-

ogens, C. casiicola, a causal agent of target spot of tomato and

a host-specific CCT-toxin producer, was used for a challenge inoc-

ulation. Spore inoculation of a virulent strain LC93020 resulted in

the development of severe symptoms on the leaves (Fig. 1a), but

pre-inoculation with O-94 clearly decreased lesion formation by

LC93020 (Fig. 1a). Fungal biomass of C. casiicola in the infected

plants was estimated by quantifying fungal DNAs with real-time

PCR using primers specific for the pathogen. The amount of fungal

DNA in the leaves pre-inoculated with O-94 was 1.5-fold less than

that in the control leaves (paired t -test, P < 0.05) (Fig. 1c). This

result suggests that induced resistance by nonpathogenic Aa might

be efficient not only against the infection with pathogenic Aa but

also against other HST-producing necrotrophic pathogens.

B. cinerea has been used as a typical necrotrophic pathogen inthe studies of disease resistance in some plants, including tomato

and Arabidopsis [12,18,51,52]. To determine whether the Aa-

induced resistance in tomato is effective against B. cinerea, Micro-

Tom plants were inoculated with O-94 and then challenged with B.

cinera. Necrotic lesions on the infected plants were indistinguish-

able in Aa pre-inoculated and control tomatoes (Fig. 3a and b). This

result indicates that induced resistance by O-94 was not efficacious

against B. cinerea infection.

3.3. SA- and JA-signaling pathways are not involved in the induced

resistance against infection by Aa in tomato

SA and JA have been shown to have a major role in plant defense

against pathogens in tomato, Arabidopsis and other plants [2,11–13,19]. To assess the involvement of SA and JA in the induced

resistance of tomato against HST-producing necrotrophic patho-

gens, AF plants were treated with 0.2 mM of SA or 100 mM of MeJA

solutions and then inoculated with the Aa tomato pathotype As-27.

Expression of the marker genes PR-1 and PI for SA- and JA-signaling

pathways, respectively, increased after treatment with SA and JA,

respectively, indicating that those signaling pathways were acti-

vated in the tomato plants (data not shown). Pretreatment of the

tomato plants with SA and MeJA did not influence lesion formation

on the leaves (Fig. 4a). Likewise, there were no differences in

infection behaviorsof the pathogen on the plants treated with SA or

MeJA (Fig. 4b). The SA levels in the leaves inoculated with

nonpathogenic Aa O-94 or the tomato pathotype As-27 were

quantified by HPLC. The concentration of SA in the leaves was notchanged after inoculation with O-94 or As-27 (Fig. 5).

3.4. Response of NahG and def1 tomatoes to infection with

nonpathogenic Aa

Previous studies have shown that mutants with a defect in SA-

or JA-signaling pathways exhibit increased susceptibility to path-

ogens since SA and JA are closely related to disease resistance in

many plants [12,14,15,21–23,26]. To further determine whether SA-

and JA-signaling pathways in tomato are involved in the resistance

to Aa infection, NahG and def1 mutant tomatoes were inoculated

with spores of a nonpathogenic Aa strain O-94. The NahG tomato is

unable to accumulate SA, due to the degradation of SA by nahG-

encoded SA hydoroxylase [20]. The def1 tomato does not

accumulate JA in response to wounding and pathogen infection,

and it is deficient in the activation of wound or JA-inducible defense

genes [24,25]. Inoculation of these mutant plants with O-94 did not

cause any visible lesions on the leaves of either plant (Fig. 6). Under

microscopic observation, although spore germination and appres-

sorium formation were observed on the mutant leaves, infection

hypha formation, which is the most critical step for establishing the

initial infection of Aa pathogens, was not induced, even on the

mutant tomato leaves (Table 2). The results indicate that the defect

in SA- and JA-signaling in tomatoes does not lead to the induction

of Aa infection. SA and JA may not be important compounds for

basal defense responses in tomato against infection by Aa.

3.5. Induced resistance by nonpathogenic Aa in the def1 tomato

Since def1 tomato and its WT strain of origin, Castlemart, are

susceptible to tomato pathotype Aa, it is possible to assess whether

JA signaling is involved in the resistance to tomato pathotype

induced by nonpathogenic Aa O-94. def1 leaves were pre-inocu-

lated with spores of O-94 and then challenged with virulent strain

Fig. 3. Effect of pre-inoculation with nonpathogenic Aa in tomato on infection by B.

cinera. (a) Micro-Tom tomato was pre-inoculated with nonpathogenic Aa (O-94) and

then inoculated with B. cinera. Pretreatment of DW was used as control (DW). Lesion

formation was observed at 3 dpi. (b) Comparison of necrotic areas between the leaves

pre-inoculated with O-94 (O-94) and control (DW). The proportion of lesion area on

the leaf was estimated. Results indicate relative value to control leaves in three

independent experiments and error bars indicate SE. RU; relative unit.




As-27. After 4 days, necrotic lesions were found on both O-94-pre-

inoculated and control (DW) leaves (Fig. 7a). However, pathogen-

induced development of necrotic lesions on def1 leaves pre-inocu

lated with the non-pathogen significantly decreased compared to

that on control leaves (Fig. 7a). The amount of As-27 DNA in thepre-inoculated leaves estimated by real-time PCR was 6.0-fold less

than in the control leaves (Fig. 7b), indicating a suppression of

pathogen growth by pre-inoculation with nonpathogenic Aa. These

results suggest that the resistance against the tomato pathotype

induced in tomato by nonpathogenic Aa is still active in the absence

of JA-dependent signaling.

3.6. Suppression subtractive hybridization (SSH) identified putative

defense gene(s) associated with induced resistance by

nonpathogenic Aa in tomato

To identify tomato genes that are involved in the resistance to

infection by the tomato pathotype induced by nonpathogenic Aa,

SSH was performed using O-94-inoculated leaves as the tester and

DW-treated leaves as the driver. In total, 262 clones were randomly

picked up from a subtraction library and subsequently sequenced.

The nucleotide sequences of 219 clones were determined. BlastN

analysis (<e5) showed 150 clones were unigenes (57 contigs and

135 singlets) corresponded to known genes, and 27 clones had nomatches in the databases. On the other hand, BlastX (<e5) analysis

indicated that 143 clones had significant homology to known

proteins and that 34 clones were not similar to any known proteins

(Supplemental Table). These clones were divided into functional

categories by the MIPS Functional Catalogue (MIPS, http://mips.gsf.

de/projects/funcat). To analyze the expression of genes in tomato

plants involved in signal transduction and defense or reported to be

included in the defense responses against biotic or abiotic stress in

plants inoculated with nonpathogenic Aa O-94, we randomly

selected nineteen clones that had been categorized as such.

Thirteen clones whose expression was increased from 6 to 24 h

after O-94 inoculation are listed in Table 3. These corresponding

proteins determined by the SSH were known to be involved in both

non-host resistance and host resistance [53–60].

Fig. 4. Effects of SA and MeJA on infection of the Aa tomato pathotype. (a) Leaves of AF were pretreated with 0.2 mM SA (pre-SA/ As-27) or 100 mM MeJA (pre-MeJA/ As-27) and

then inoculated with As-27. Pretreatment with DW was used as control (As-27). Lesion formation on the leaves was observed at 4 dpi. (b) Infection behaviors of As-27 were

observed under light microscopy at 4 dpi. SG; spore germination, A; appressorium formation, IH; infection hypha formation. Data represent the mean of four independent

experiments and error bars indicate SE. There were no significant differences among pretreatment with SA (shaded bar), MeJA (filled bar) and DW (control; open bar).








4. Discussion

Lesion formation on tomato leaves by the Aa tomato pathotype

was reduced by pre-inoculation with nonpathogenic Aa. It is diffi-

cult to observe infection behaviors of the tomato pathotype on the

leaves that were pre-inoculated with nonpathogenic Aa, since there

is no morphological difference between nonpathogenic and path-

ogenic strains of Aa. Thus, fungal biomass of the pathogenic strain

in the infected plants was estimated by quantifying fungal DNA

with real-time PCR using primers specific for the ALT1 gene, which

is involved in toxin biosynthesis and in Aa tomato pathotype

pathogenicity. The amount of fungal pathogen DNA in the pre-

inoculated plants was decreased, indicating that in planta growth of

the Aa tomato pathotype was restricted by the inoculation with the

non-pathogen. Plants defend themselves from pathogens by basaldefenses and induced resistances including anti-fungal properties,

phytoalexins and PR-proteins [1–4]. Although tomato is known to

produce the anti-fungal compound, a-tomatine, Aa has ability to

detoxify it [61]. Until now there has been no report on anti-fungal

compounds effective against infection with Aa.

Pretreatment with the SGF of nonpathogenic Aa O-94 also

protected tomato against infection by the Aa tomato pathotype. The

SGF elicitor from Aa is a mannose-rich heteropolysaccharide with

a molecular weight of about 40,000 Daltons [29]. The resistance-

inducing activity of the SGF elicitor was found not only in tomato

but also in Japanese pear, apple and strawberry against other Aa

pathotypes [29]. This means that SGF from Aa is a non-specific and

general elicitor that induces the defense response in a wide range of

plant species. Moreover, pre-inoculation with O-94 induced resis-tance against infection with the tomato pathogen C. cassiicola that

causes Corynespora target spot. This result also indicates that the

Aa elicitor has resistance-inducing activity against a broad spec-

trum of pathogen species as a general elicitor.

Microscopic observation of infection behaviors of the Aa tomato

pathotype on tomato leaves revealed that reduction of lesion

formation depends on the restriction of infection hypha formation

of the pathogen. An incompatible interaction between Aa and

resistant cultivars does not depend on a specific R-gene and Avr

gene interaction; rather it has been regarded as non-host, general

or basal resistance. Two types of non-host resistance have been

reported. Type I has no visible reaction on the non-host plant, and

type II is accompanied with HR cell death [6,62]. In type II resis-

tance, non-pathogens are restricted in cell death after penetration

in one ora few plant cells,whereas in typeI resistance, invasion andpenetration in plant cell tissues by non-pathogens are not

observed. The interaction between Aa and resistant plants should

be considered to be type I non-host resistance, because neither

visible symptoms nor cell death were detected on the infected

tomato leaves. In the interactions between nonpathogenic Aa and

its potential host, or between Aa pathotypesand a resistant cultivar,

spore germination and appressorium formation are observed as

between the pathogenic Aa and the susceptible cultivar. However,

infection hypha formation is obvious only in the interaction

between pathogenic Aa and the susceptible cultivar. Infection

hypha formation strictly depends on the susceptibility of plants to

HSTs [28]. The formation of infection hypha is the most critical step

for the initial establishment of infection by the Aa pathogens. It was

reported that the infection-inhibiting factor (IIF) that inhibits only

Fig. 5. Accumulation of SA in tomato following pathogen inoculation and elicitor

treatment. Leaves of AF tomato were inoculated with nonpathogenic Aa (O-94), the

tomato pathotype of Aa (As-27), or treated with elicitor. Leaves were collected after

24 h and total SA (conjugated with glucose) and free SA were extracted. Amounts of SA

were quantified by HPLC. Data represent the mean of two independent experiments

and error bars indicate SE.

Fig. 6. Response of SA and JA signaling in mutant tomato plants infected with

nonpathogenic Aa. The leaves of NahG, derived from Moneymaker, and of def1, derived

from Castlemart, were inoculated with O-94. Inoculated leaves were observed at 4 dpi.




infection hypha formation of the Japanese pear pathotypeof Aa was

identified from pear leaves inoculated with nonpathogenic Aa [63].

However, such a compound has not been found in tomato plants

inoculated with nonpathogenic Aa.

There are some reports that MAMPs play an important role in

non-host resistance [1,2,5,6]. MAMPs from filamentous fungidinc

luding oligosaccharides, P-glucan and chitin, which are compo-

nents of fungal cell wallsdhave been characterized [9,10]. Although

the critical structure of the SGF elicitor of Aa is unknown, MAMPs-

like factors might be involved in induced resistance based on non-

host or general resistance of tomato plants against Aa infection.

There have been many reports indicating that SA- and JA-

signaling pathways play important roles in plant defense systems

[2,11–13,19]. However, little is known about the involvement of these signaling pathways in interactions between plants and Aa

pathogens. Pretreatment of host plants with SA or MeJA has been

shown to enhance resistance against infection with A. brassicicola,

B. cinerea, Peronospora parasitica, P. syringae and P. infestans,

Table 2

Infection behaviors of nonpathogenic A. alternata on signaling mutant tomatoes.

Tomato cv.a Infection behavior (%)b

Spore germination Appressorium formation Infection hypha formation

Moneymaker 89.44.6 29.62.5 0

NahG 82.4 4.6 30.31.6 0

Castlemart 83.4 2.3 30.41.4 0

def1 70.6 5.3 28.14.2 0

a Mutant tomato NahG was derived from cv. Moneymaker, and def1 derived from cv. Castlemart. Tomato leaves were inoculated with nonpathogenic Aa O-94. Leaves were

fixed and decolorized for microscopic observation at 3 dpi.b Rates of spore germination, appressorium formation and infection hypha formation were indicated as percentages. Data represent the mean of four independent

experiment and SE. There were no significant differences on infection behaviors among these tomatoes.

Fig. 7. Induced resistance in the tomato JA signaling mutant def1 to the Aa tomato

pathotype pre-inoculated with nonpathogenic Aa. (a) The leaves of def1 were inocu-

lated with the tomato pathotype of Aa (As-27). Tomato leaves pre-inoculated with O-

94 were then inoculated with As-27 (Pre-O-94/ As-27) and lesion formation on the

leaves was observed at 4 dpi. (b) Comparison of As-27 growth in def1 plants pre-

inoculated with O-94 and inoculated with As-27 at 4 dpi. Fungal biomass in the

infected plants was estimated by quantifying fungal DNA with real-time PCR using

primers specific for the As-27 ALT1 gene. Results shows values relative to control leaves

for three independent experiments and error bars indicate SE. An asterisk indicates

a significant difference between pre-inoculation with O-94 and the control (paired t -

test, P <

0.05). RU; relative unit.

Table 3

Functional categorization of SSH clones and their expression profile.

Clone

ID

Accession

No.

Blast

hitaCorresponding protein

(Organism)aEST

length

E-

valueaMIPS

fanction

categoryb

94AF2E09 CJ999324 CAO23453 Unnamed protein

product (Vitis vinifera)

260 3.00E-

25

99

94AF2E12 BY999927 CAE45567 SUMO E2 conjugating

enzyme SCE1(Nicotiana

benthamiana)

403 2.00E-

68

14

94AF2H06 BY999940 AAM13899 Putative 4-coumarate

CoA ligase

( Arabidopsis thaliana)

335 2.00E-

39

1

94AF3A06 BY999943 CAO68296 Putative

metallophosphatase

(Lupinus luteus)

378 1.00E-

54

99

94AF3F08 BY999959 P52884 GTP-binding protein

SAR2 (Solanum

lycopersicum)

324 3.00E-

54

20,30

94AF3F09 BY999960 No hit No hit 338 No hit No hit

94AF4D02 BY999978 AAU00066 Pathogenesis-related

protein 10

(Solanum virginianum)

501 3.00E-

07

32

94AF4E03 BY999983 AAD17230 FtsH-like protein

(Nicotiana tabacum)

317 1.00E-

33

70

94AF4G03 CJ999351 ABC69274 Putative DnaJ protein

(Camellia sinensis)

199 1.00E-

24

32

94AF4G11 BY999994 ABD28590 C2 (Medicago

truncatula)

420 8.00E-

20

99

94AF4H04 BY999995 CAB51914 Profilin Hev b 8

(Hevea brasiliensis)

383 4.00E-

16

40,42,43

94AF13 CJ999355 AAF67141 Allene oxide synthase

(Solanum

lycopersicum)

284 1.00E-

46

99

94AF35 CJ999368 O04973 2-isopropylmalate

synthase A (Solanum

pennellii)

311 3.00E-

34

99

a Corresponding proteins are predicted from BlastX (<e-5) searches.b Functional categorization was performed according to the MPIS catalogue. 1;

metabolism, 14; protein fate, 20; cellular transport, 30; signal transduction, 32; cell

rescue, 40; cell fate, 42; biogenesis of cellular components, 43; cell type differenti-

ation, 70; subcellular localization, 99; unclassified proteins.




[14,15,17,18]. However, pretreatment of SA or MeJA did not reduce

lesion formation in tomato leaves by the tomato pathotype of Aa. In

particular, JA signaling has been known to be involved in resistance

against necrotrophic pathogens [11–13,18,19], while MeJA treat-

ment did not decrease lesion development by the necrotrophic

pathogen Aa tomato pathotype whose infection depends on the

host-specific AAL-toxin [28,34,35]. In addition to JA signaling, ET is

also involved in plant defense systems against necrotorophic

pathogens [52,64]. However, in tomato- Aa tomato pathotype and

AAL-toxin interactions, ET has been shown to promote cell death by

the AAL-toxin [65,66]. Therefore, ET signaling in tomato may

facilitate infection by the tomato pathotype, rather than induce

resistance against the pathogen.

Many studies have shown that SA- and JA-signaling mutants

exhibit increased susceptibility against pathogens or non-patho-

gens [12,14,15,21–23,26]. However, neither of the SA- and JA-

signaling mutant tomatoes, NahG and def1, displayed increased

susceptibility to nonpathogenic Aa. On the other hand, pre-inocu-

lation of JA-related mutant def1 with O-94 induced resistance

against the Aa tomato pathotype, indicating that the defense

response by nonpathogenic Aa is induced in tomato independently

of SA and JA signaling. It has also been reported that Arabidopsis

SA-, JA- and ET-related signaling mutants retain the full induced-resistance responsibility mediated by MAMPs against a bacterial

pathogen [67]. These results suggest that SA- and JA-associated

signal transduction might not be involved in the induced resistance

of tomatoes against infection by Aa. In addition, tomato plants pre-

inoculated with nonpathogenic Aa O-94 did not exhibit induced

resistance against B. cinerea, and SA- and JA-signaling pathways

have been shown to play an important role in plant resistance

against B. cinerea [51,52,12,18]. Taken together, these findings

indicate that induced resistance in tomato against infection with

the tomato pathotype elicited by nonpathogenic Aa might result

from activation of an alternative pathway that is independent of

SA- and JA-signaling. Thuerig et al. [68] also reported that a fungal

elicitor-induced resistance in Arabidopsis independently of the SA-

and JA/ET signaling pathways.To gain insight into factors involved in the resistance induced by

nonpathogenic Aa, the expression of tomato genes induced by

infection with the non-pathogen were profiled using SSH. In our

study, some defense-related PR-protein genes were identified, for

example, PR-1 (94AF2C10, 94AF3C05; GenBank accession nos.

BY999919, CJ999333), PR-5 (94AF1A09, 94AF2A03, 94AF51; Gen-

Bank accession nos. BY999894, CJ999319, CJ999375) and PR-10

(94AF4D02; GenBank accession no. BY999978).2 PR-proteins are

well documented as being involved in defense responses, and some

of them were known as marker genes of SA- or JA-signaling path-

ways [4]. Regulation of tradeoffs between SA- and JA-signaling has

been reported in Arabidopsis inoculated with necrotrophic and

biotrophic pathogens [69]. In this study, however, SSH clones

involved in both SA- and JA-signaling pathways have been, indi-cating that the induced resistance against Aa might not strictly

depend on those signaling pathways. In the MAMP-associated

resistance, although signaling mutants exhibit induced resistance

against bacterial pathogens [67], expression of SA-dependent genes

was induced by MAMPs [70]. The data suggest that although basal,

general or non-host resistance partially depends on SA- and JA-

related pathways, SA- and JA-related defense genes may not be

critical for induced resistance by nonpathogenic Aa in tomato

plants. To further elucidate the role of these candidate genes in the

induced resistance of tomato against infection with Aa, functional

analysis of the defense-related genes identified by SSH will be

required.

In summary, the results indicate that SA- and JA-dependent

defense responses in tomato are not involved in induced resistance

by nonpathogenic Aa against infection with the toxigenic and

necrotrophic pathogen, the tomato pathotype of Aa. This finding

suggests that an alternative and unknown signaling pathway that is

independent of SA and JA signaling may modulate the induced

resistance by nonpathogenic Aa based on basal, non-host or general

resistance in tomato. However, some SA- and JA-dependent genes

were expressed during the induced resistance response, suggesting

the existence of SA- and JA-independent signaling pathways in this

induced defense pathway in tomato. The expression profiling and

functional analysis of SSH clones should reveal the details of the

induced resistance against toxin-dependent necrotrophic

pathogens.

Acknowledgements

We gratefully acknowledge G. A. Howe for providing the seeds

of the def1 tomato line and J. Jones for providing the seeds of the

NahG transgenic tomato mutant. This work was supported by

a Grant-in-Aid for Scientific Research from the Japanese Society for

Promotion of Sciences.

Appendix. Supplementary data

Supplementary data associated with this article can be found in

the online version at doi:10.1016/j.pmpp.2009.02.001.

References

[1] Jones JDG, Dangl JL. The plant immune system. Nature 2006;444:323–9.[2] Nurnberger T, Lipka V. Non-host resistance in plants: new insights into an old

phenomenon. Mol Plant Pathol 2005;6:335–45.

[3] Thordal-Christensen H. Fresh insights into processes of nonhost resistance.Curr Opin Plant Biol 2003;6:351–7.

[4] Van Loon LC, Rep M, Pieterse CMJ. Significance of inducible defense-relatedproteins in infected plants. Annu Rev Phytopathol 2006;44:135–62.

[5] Bent AF, Mackey D. Elicitors, effectors, and R genes: the new paradigm anda lifetime supply of questions. Annu Rev Phytopathol 2007;45:399–436.

[6] Mysore KS, Ryu C- M. Nonhost resistance: how much do we know? TrendsPlant Sci 2004;9:97–104.

[7] Felix G, Duran JD, Volko S, Boller T. Plants have a sensitive perception systemfor the most conserved domain of bacterial flagellin. Plant J 1999;18:265–76.

[8] Kunze G, Zipfel C, Robatzek S, Niehaus K, Boller T, Felix G. The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants.Plant Cell 2004;16:3496–507.

[9] Jurgen E. Oligoglucoside elicitor-mediated activation of plant defense.Bioessays 1998;20:569–76.

[10] Shibuya N, Minami E. Oligosaccharide signalling for defence responses inplant. Physol Mol Plant Pathol 2001;59:223–33.

[11] Glazebrook J. Contrasting mechanisms of defense against biotrophic andnecrotrophic pathogens. Annu Rev Phytopathol 20 05;43:205–27.

[12] Thomma BPHJ, Eggermont K, Penninckx IAMA, Mauch-Mani B, Vogelsang R,Cammue BPA, et al. Separate jasmonate-dependent and salicylate-dependentdefense-response pathways in Arabidopsis are essential for resistance todistinct microbial pathogens. Proc Natl Acad Sci USA 1998;95:15107–11.

[13] Ton J, Van Pelt JA, Van Loon LC, Pieterse CMJ. Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistancein Arabidopsis. Mol Plant Microbe Interact 2002;15:27–34.

[14] Cao H, Bowling SA, Gordon AS, Dong X. Characterization of an Arabidopsismutant that is nonresponsive to inducers of systemic acquired resistance.Plant Cell 1994;6:1583–92.

[15] Delaney TP, Friedrich L, Ryals JA. Arabidopsis signal transduction mutantdefective in chemically and biologically induced disease resistance. Proc NatlAcad Sci USA 1995;92:6602–6.

[16] Friedrich L, Lawton K, Ruess W, Masner P, Specker N, Rella MG, et al. A ben-zothiadiazole derivative induces systemic aquired resistance in tobacco. Plant J1996;10:61–70.

[17] Cohen Y, Gisi U, Niderman T. Local and systemic protection against Phytoph-thora infestans induced in potato and tomato plants by jasmonic acid and

jasmonic methyl ester. Phytopathology 1993;83:1054–62.

2 The nucleotide sequence data reported are available in the DDBJ/EMBL/Gen-

Bank database under the accession numbers BY999892–BY999999 and CJ999310–

CJ999378.


http://dx.doi.org/doi:10.1016/j.pmpp.2009.02.001

http://dx.doi.org/doi:10.1016/j.pmpp.2009.02.001



[18] Thomma BPHJ, Eggermont K, Broekaert WF, Cammue BPA. Disease develop-ment of several fungi on Arabidopsis can be reduced by treatment with methyl

jasmonate. Plant Physiol Biochem 2000;38:421–7.[19] Thomma BPHJ, Tierens KFM, Penninckx IAMA, Mauch-Mani B, Broekaert WF,

Cammue BPA. Different micro-organisms differentially induce Arabidopsisdisease response pathways. Plant Physiol Biochem 2001;39:673–80.

[20] Brading PA, Hammond-Kosack KE, Parr A, Jones JDG. Salicylic acid is notrequired for Cf-2- and Cf-9-dependent resistance of tomato to Cladosporium

fulvum. Plant J 2000;23:305–18.[21] Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, et al. Three

unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J 2000;24:205–18.

[22] Mellersh DG, Heath MC. An investigation into the involvement of defensesignaling pathways in components of the nonhost resistance of Arabidopsisthaliana to rust fungi also reveals a model system for studying rust fungalcompatibility. Mol Plant Microbe Interact 2003;16:398–404.

[23] Zimmerli L, Stein M, Lipla V, Schulze-Lefert P, Somerville S. Host and non-hostpathogens elicit different jasmonate/ethylene responses in Arabidopsis. Plant J2004;40:633–46.

[24] Lightner J, Pearce G, Ryan CA, Browse J. Isolation of signaling mutants of tomato (Lycopersicon esculentum). Mol Gen Genet 1993;241:595–601.

[25] Howe GA, Lightner J, Browse J, Ryan CA. An octadecanoid pathway mutant(JL5) of tomato is compromised in signaling for defense against insect attack.Plant Cell 1996;8:2067–77.

[26] Thaler J, Owen B, Higgins VJ. The role of the jasmonate response in plantsusceptibility to diverse pathogens with a range of lifestyles. Plant Physiol2004;135:530–8.

[27] Feys BJF, Benedetti CE, Penfold CN, Turner JG. Arabidopsis mutants selected forresistance to the phytotoxin coronatine are male sterile, insensitive to Methyl

jasmonate, and resistant to a bacterial pathogen. Plant Cell 1994;6:751–9.[28] Nishimura S, Kohmoto K. Host-specific toxins and chemical structures from

Alternaria species. Annu Rev Phytopathol 1983;21:87–116.[29] Otani H, Kohmoto K, Kodama M, Nishimura S. Role of host-specific toxins in

the pathogenesis of Alternaria alternata. In: Patil SS, Ouchi S, Mills D, Vance C,editors. Molecular strategies of pathogens and host plants. New York:Springer-Verlag; 1991. p. 139–49.

[30] Kohmoto K, Otani H. Host-recognition by toxigenic plant pathogens. Experi-entia 1991;47:755–64.

[31] Otani H, Kohmoto K, Kodama M. Alternaria toxins and their effects on hostplants. Can J Bot 1995;73:S453–8.

[32] Friesen TL, Faris JD, Solomon PS, Oliver RP. Host-specific toxins: effectors of necrotrophic pathogenicity. Cell Microbiol 20 08;10:1421–8.

[33] Gilchrist DG, Grogan RG. Production and nature of a host-specific toxin from Alternaria alternata f. sp. lycopersici. Phytopathology 1976;66:165–71.

[34] Yamagishi D, Akamatsu H, Otani H, Kodama M. Pathological evaluation of host-specific AAL-toxins and fumonisin mycotoxins produced by Alternariaand Fusarium species. J Gen Plant Pathol 2006;72:323–7.

[35] Akamatsu H, Itoh Y, Kodama M, Otani H, Kohmoto K. AAL-toxin-deficientmutants of Alternaria alternata tomato pathotype by restriction enzyme-mediated integration. Phytopathology 1997;87:967–72.

[36] Bottini AT, Bowen JR, Gilchrist DG. Phytotoxins. II. Characterization of a phytotoxic fraction from Alternaria alternata f. sp. lycopersici. TetrahedronLett 1981;22:2723–6.

[37] Bottini AT, Gilchrist DG. Phytotoxins. I. A 1-aminodimethylheptadecapentolfrom Alternaria alternata f. sp. lycopersici. Tetrahedron Lett 1981;22:2719–22.

[38] Gilchrist DG, Wang H, Bostock RM. Sphingosine-related mycotoxins in plantand animal disease. Can J Bot 1995;73:S459–67.

[39] Wang H, Jones C, Ciacci-Zanella J, Holt T, Gilchrist DG, Dickman MB. Fumo-nisins and Alternaria alternata lycopersici toxins: sphinganine analog myco-toxins induce apoptosis in monkey kidney cells. Proc Natl Acad Sci USA1996;93:3461–5.

[40] Spassieva SD, Markham JE, Hille J. The plant disease resistance gene Asc-1prevents disruption of sphingolipid metabolism during AAL-toxin-inducedprogrammed cell death. Plant J 2002;32:561–72.

[41] Brandwagt BF, Mesbah LA, Takken FLW, Laurent PL, Kneppers TJA, Hille J, et al.A longevity assurance gene homolog of tomato mediates resistance to Alter-

naria alternata f. sp. lycopersici toxins and fumonisin B1. Proc Natl Acad Sci USA2000;97:4961–6.

[42] Gomi K, Itoh N, Yamamoto H, Akimitsu K. Characterization and functionalanalysisof class I and II acidic chitinase cDNA from rough lemon. J Gen PlantPathol 2002;68:191–9.

[43] Gomi K, Yamamoto H, Akimitsu K. Characterization of a lipoxygenase gene inroughlemon induced by Alternaria alternata. J GenPlant Pathol 2002;68:21–30.

[44] Gotoh Y, Nalumpang S, Isshiki A, Utsumi T, Gomi K, Yamamoto H, et al. A cDNAencoding polygalacturonase-inhibiting protein induced in citrus leaves bypolygaracturonase of Alternaria citri. J Gen Plant Pathol 2002;68:57–61.

[45] Johnson RD, Johnson L, Itoh Y, Kodama M, Otani H, Kohmoto K. Cloning andcharacterization of a cyclic peptide synthetase gene from Alternaria alternataapple pathotype whose product is involved in AM-toxin synthesis and path-ogenicity. Mol Plant Microbe Interact 2000;13:742–53.

[46] Blazquez CH. Target spot. In: Jones JB, Jones JP, Stall RE, Zitter TA, editors.Compendium of tomato diseases. St. Paul, Minnesota: APS Press; 1991. p. 23.

[47] Wei CT. Notes on Corynespora. Mycol Papers 1950;34:1–10.

[48] Takahashi H, Shimizu A, Arie T, Rosmalawati S, Fukushima S, Kikuchi M, et al.Catalog of Micro-Tom tomato responses to common fungal, bacterial, and viralpathogens. J Gen Plant Pathol 2005;71:8–22.

[49] Akamatsu H, Otani H, Kodama M. Characterization of a gene cluster for host-specific AAL-toxin biosynthesis in the tomato pathotype of Alternaria alter-nata. Abstracts of the 22nd Fungal Genetics Conference, Asilomar, California;2003. p. 121.

[50] Enyedi AJ, Yalpani N, Silverman P, Raskin I. Localization, conjugation, andfunction of salicylic acid in tobacco during the hypersensitive reaction totobacco mosaic virus. Proc Natl Acad Sci USA 1992;89:2480–4.

[51] Audenaert K, De Meyer GB, Hofte MM. Abscisic acid determines basalsusceptibility of tomato to Botrytis cinerea and suppresses salicylic acid-dependent signaling mechanisms. Plant Physiol 2002;128:491–501.

[52] Diaz J, Ten Have A, Van Kan JAL. The role of ethylene and wound signaling inresistance of tomato to Botrytis cinerea. Plant Physiol 2002;129:1341–51.

[53] Wasternack C. Jasmonates: an update on biosynthesis, signal transduction andaction in plant stress responses, growth and development. Ann Bot2007;100:681–97.

[54] Lamb CJ, Lawton MA, Dron M, Dixon RA. Signals and transduction mecha-nisms for activation of plant defenses against microbial attack. Cell1989;56:215–24.

[55] Kobayashi I, Hakuno H. Actin-related defense mechanism to reject penetrationattempt by a non-pathogen is maintained in tobacco BY-2 cells. Planta2003;217:340–5.

[56] McCurdy DW, Kovar DR, Staiger CJ. Actin and actin-binding proteins in higherplants. Protoplasma 2001;215:89–104.

[57] Schutz I, Gus-Mayer S, Schmelzer E. Profilin and Rop GTPases are localized atinfection sites of plant cells. Protoplasma 2006;227:229–35.

[58] Shen G, Adam Z, Zhang H. The E3 ligase AtCHIP ubiquitylates FtsH1,a component of the chloroplast FtsH protease, and affects protein degradationin chloroplasts. Plant J 2007;52:309–21.

[59] Innes R. New effects of type III effectors. Mol Microbiol 2003;50:363–5.[60] Kim CY, Koo YD, Jin JB, Moon BC, Kang CH, Kim ST, et al. Rice C2-domain

proteins are induced and translocated to the plasma membrane in response toa fungal elicitor. Biochemistry 2003;42:11625–33.

[61] Sandrock RW, VanEtten HD. Fungal sensitivity to and enzymatic degradationof the phytoanticipin a-tomatine. Phytopathology 1998;88:137–43.

[62] Oh S-K, Lee S, Chung E, Park JM, Yu SH, Ryu C-M, et al. Insight into Types I andII nonhost resistance using expression patterns of defense-related genes intobacco. Planta 2006;223(1):101–7.

[63] Kodama M, Wada H, Otani H, Kohmoto K, Kimura Y. 3,5-DI-O-caffeoylquinicacid, an infection-inhibiting factor from Pyrus pyrifolia induced by infectionwith Alternaria alternata. Phytochemistry 1998;47:371–3.

[64] Van Loon LC, Geraats BPJ, Linthorst HJM. Ethylene as a modulator of diseaseresistance in plants. Trends Plant Sci 2006;11:184–91.

[65] Moore T, Martineau B, Bostock RM, Lincoln JE, Gilchrist DG. Molecular andgenetic characterization of ethylene involvement in mycotoxin-induced plantcell death. Physiol Mol Plant Pathol 1999;54:73–85.

[66] Moussatos VV, Yang SF, Ward B, Gilchrist DG. AAL-toxin induced physiologicalchanges in Lycopersicon esculentum Mill:role for ethylene and pyrimidineintermediates in necrosis. Physiol Mol Plant Pathol 1994;44:455–68.

[67] Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G, et al. Bacterialdisease resistance in Arabidopsis through flagellin perception. Nature2004;428:764–7.

[68] Thuerig B, Felix G, Binder A, Boller T, Tamm L. An extract of Penicilliumchrysogenum elicits early defense-related responses and induces resistance in

Arabidopsis thaliana independently of known signalling pathways. Physiol MolPlant Pathol 2006;67:180–93.

[69] Spoel SH, Johnson JS, Dong X. Regulation of tradeoffs between plant defensesagainst pathogens with different lifestyles. Proc Natl Acad Sci USA2007;104:18842–7.

[70] Gomez-Gomez L, Felix G, Boller T. A single locus determines sensitivity tobacterial flagellin in Arabidopsis thaliana. Plant J 1999;18:277–84.


2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria...

Documents

Transcript of 2 Induced Resistance in Tomato Plants to the Toxin-Dependent Necrotrophic Pathogen Alternaria...