2 3 4 5 ACCEPTED · 95 (v/v) FCS, 2 mM L-glutamine, 1x non-essential amino acids, 0.075 % (v/v)...
Transcript of 2 3 4 5 ACCEPTED · 95 (v/v) FCS, 2 mM L-glutamine, 1x non-essential amino acids, 0.075 % (v/v)...
1
MDCK SIAT-1 cells show improved isolation rates for recent human influenza 1
viruses compared to conventional MDCK cells 2
3
Running title: Isolating influenza virus in MDCK-SIAT1 and MDCK cells. 4
5
Ding Yuan Oh1,2
, Ian G. Barr1,2
, Jenny A. Mosse2 , Karen L. Laurie
1* 6
7
1WHO Collaborating Centre for Reference and Research on Influenza, 45 Poplar Road, 8
Parkville, Melbourne, Australia, 3052. 9
2School of Applied Sciences and Engineering, Monash University Gippsland Campus, 10
Churchill, Victoria, Australia, 3842. 11
12
*Corresponding author: mailing address: WHO Collaborating Centre for Reference and 13
Research on Influenza, 45 Poplar Road, Parkville, Melbourne, Australia, 3052. 14
Phone:+61-3-9389-1340. Fax:+61-3-9389-1881. Email: [email protected] 15
16
17
ACCEPTED
Copyright © 2008, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.00398-08 JCM Accepts, published online ahead of print on 14 May 2008
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
2
ABSTRACT 18
The ability to isolate and propagate influenza virus is an essential tool for yearly 19
surveillance of circulating virus strains, and to ensure an accurate clinical diagnosis for 20
appropriate treatment. The suitability of MDCK-SIAT1 cells, engineered to express 21
increased levels of α-2,6-linked sialic acid receptors, as an alternative to conventional 22
MDCK cells for isolation of circulating influenza virus was assessed. A higher number of 23
influenza A (H1N1 and H3N2) and B viruses from stored human clinical specimens 24
collected between 2005 and 2007 was isolated following inoculation in MDCK-SIAT1 25
cells compared to MDCK cells. In addition, a higher titre of virus was recovered 26
following culture in MDCK-SIAT1 cells. All A(H1N1) viruses recovered from MDCK-27
SIAT1 cells were able to agglutinate both turkey and guinea pig RBC, whilst half of the 28
A(H3N2) viruses recovered after passage in MDCK-SIAT1 cells lost the ability to 29
agglutinate turkey RBC. Importantly, the HA-1 domain of the haemagglutinin gene was 30
genetically stable after passaging in MDCK-SIAT1 cells, a feature not always seen 31
following MDCK cell- or embryonated chicken egg-passage of human influenza virus. 32
These data indicate that the MDCK-SIAT1 cell line is superior to conventional MDCK 33
cells for isolation of human influenza from clinical specimens and may be used routinely 34
for the isolation and propagation of current human influenza viruses, for surveillance, 35
diagnostic and research purposes. 36
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
3
INTRODUCTION 37
38
The ability to isolate and propagate influenza virus is essential for the yearly surveillance 39
of circulating virus strains and for further studies, such as antigenic and antiviral 40
sensitivity analyses. Historically, embryonated chicken eggs have been used to propagate 41
influenza viruses and are still used by most manufacturers to produce influenza vaccine 42
today (2,3,4). Infection of immortalised mammalian cell lines in vitro with influenza 43
virus has provided an alternative to egg inoculation (10, 13). Following the threat of an 44
avian-derived H5N1 influenza pandemic, vaccine production via cell culture is currently 45
being expanded, allowing more rapid production of influenza vaccine (8, 21, 29, 44). 46
47
Cell culture has been the preferred method for laboratory-based influenza virus isolation 48
since the 1960s, as it is relatively simple, sensitive and cost-effective. Many cell lines 49
have been used, including BHK-21 (14), LLC-MK2 (38), SPJL (40) and Vero cells (11, 50
12). Madin-Darby canine kidney cells (MDCK), however, have proved to be the easiest 51
to handle, most sensitive and most reliable cell line (10, 13, 27, 38) and remain the 52
standard cell line for influenza virus propagation. Both human and avian influenza 53
viruses can be isolated from MDCK culture with high viral titres (27, 42, 43), which may 54
be attributed to the fact that both α−2,6- and α−2,3-linked sialic acid receptors are 55
expressed on the cell surface of MDCK cells and these are the primary receptors for 56
human and avian influenza viruses, respectively (18, 35). However, unlike human 57
respiratory cells, the level of α−2,6-linked sialic acid receptors on MDCK cells is 58
relatively low, thus MDCK are not an ideal in vitro representation of the human 59
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
4
respiratory system (1, 7, 19, 40). Matrosovich and colleagues established a MDCK cell 60
line, MDCK-SIAT1, that was stably transfected with human CMP-N-61
acetylneuraminate:β-galactoside α−2,6-sialyltransferase, an enzyme that catalyses the α-62
2,6-sialylation of galactose on glycoproteins or glycolipids. These MDCK-SIAT1 cells 63
over-expressed the α-2,6-linked sialic acid receptor compared to MDCK cells (25). 64
Enhanced α-2,6-linked receptor levels should increase the number of interactions 65
between human influenza virions and the cell surface, and hence the avidity of the 66
binding. This was indirectly demonstrated with MDCK-SIAT1 cells being more sensitive 67
for assaying human influenza virus susceptibility to neuraminidase inhibitors compared 68
to MDCK cells (25). Increased sensitivity to neuraminidase inhibitors was also seen in 69
viruses passaged through another MDCK cell line transfected with the β-galactosidase α-70
2,6 sialyltransferase I gene (ST6Gal I) (16). In addition, in a small study with 8 A(H3N2), 71
7 A(H1N1) and 5 B viruses collected from 1999 to 2004, ST6Gal I cells showed 72
increased isolation rates with A(H3N2) and B viruses, but not A(H1N1) viruses, as well 73
as enhanced virus growth with all 3 types/subtypes if the samples had previously been 74
grown in MDCK cells (16). However, neither of these studies addressed the potential for 75
in vitro modifications to the virus during culture in cells over-expressing surface α-2,6-76
linked sialic acid receptors, a common feature seen in egg-adaptation of viruses where 77
mutations of the haemagglutinin (HA) gene occur in response to the abundance of α-2,3-78
linked sialic acid moieties (18). 79
80
Possibly for this reason, or because of the lack of further reports on the usefulness of 81
these cell lines for influenza virus isolation, few laboratories have adopted MDCK-82
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
5
SIAT1 or ST6Gal I cells for routine virus isolation or growth. In this study, we further 83
assessed whether MDCK-SIAT1 cells were a viable alternative to conventional MDCK 84
cells for isolation and propagation of recent influenza viruses. We found that MDCK-85
SIAT1 cells gave higher isolation rates and higher growth of influenza virus from human 86
clinical specimens compared to MDCK cells. In addition, there was little change in the 87
sequence of the HA gene on passaging in these modified MDCK cell lines. 88
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
6
MATERIALS AND METHODS 89
90
Cells 91
MDCK cells (CCL-34, ATCC, USA) and MDCK-SIAT1 cells (kindly provided by 92
Professor Hans-Dieter Klenk, University of Marburg, Germany) were passaged in 93
DMEM/HAM’s F12 Coon’s media (SAFC Biosciences, USA), supplemented with 10% 94
(v/v) FCS, 2 mM L-glutamine, 1x non-essential amino acids, 0.075 % (v/v) sodium 95
bicarbonate, 10 mM HEPES, 50 U/ml penicillin, 50 ug/ml streptomycin (SAFC 96
Biosciences, USA) and 20 ug/ml Amphotericin B (FungizoneR, Bristol-Myers Squibb 97
Company, USA). Passage medium for MDCK-SIAT1 cells was further supplemented 98
with 1 mg/ml G418 sulphate (GeneticinR, GIBCO, USA). Viral infection studies were 99
performed in the absence of FCS and G418. Cells were maintained at 37oC prior to 100
infection and at 35oC following infection. 101
102
Clinical specimens and viruses 103
Influenza A(H1N1), A(H3N2) and B viruses were received from WHO National 104
Influenza Centres, WHO Influenza Collaborating Centres and other regional laboratories 105
and hospitals in Australia, New Zealand and the Asia/Pacific region. A full list of 106
recovered viruses is provided in the Supplementary Data. Viruses were received as 107
isolates passaged in cell culture, or as original clinical samples (in which influenza A or 108
B had been detected by immunofluorescence or by RT-PCR). Original clinical samples 109
were collected as throat swabs, nasopharyngeal swabs and throat washes. All clinical 110
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
7
specimens and virus isolates were stored at -80oC prior to use and clinical samples had 111
been thawed at least once previously. 112
113
Virus infection and analyses 114
MDCK and MDCK-SIAT1 cells (5 x 105 per well) were seeded into 12-well plates 115
(Cellstar, Greiner Bio-one) and allowed to grow to confluence overnight at 37 oC, 5 116
%CO2. Monolayers were washed twice with Ca2+
/Mg2+
-free PBS before incubation with 117
50 µl virus sample (clinical isolate inoculated neat, cell- or egg-passaged virus inoculated 118
at 1/100 dilution) at 35oC, 5% CO2 for 30 min. After inoculation, 3 ml medium (without 119
FCS and G418) supplemented with 4 ug/ml trypsin was added to each well and cells were 120
incubated at 35oC, 5% CO2. Wells were monitored daily for virus growth by cytopathic 121
effects (CPE) and after 4 days, supernatant was collected and the presence of virus was 122
assessed by haemagglutination using 1% turkey or guinea pig red blood cells. For serial 123
passaging, cell supernatants were passaged a further 5 times in the same cell line as used 124
for isolation before RNA extraction and sequencing. Viral titres in the supernatant were 125
quantified as 50% tissue culture infectious dose (TCID50 assay) (41), with ten-fold 126
dilutions of supernatant inoculated onto confluent monolayers in 96-well plates and 127
allowed to grow for 4 days before staining with 0.036% (w/v) neutral red. Virus was 128
titred using MDCK cells for viruses that had been grown in MDCK cells and MDCK-129
SIAT1 cells for viruses that had been grown in MDCK-SIAT1 cells. All TCID50 assays 130
were performed in triplicate. 131
132
HA gene sequencing 133
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
8
For RT–PCR, viral RNA was extracted from 140 µl of infected cell culture supernatant or 134
clinical sample using the QIAamp Viral RNA Mini kit (Qiagen). A 5 µl aliquot of RNA 135
was used to amplify the HA-1 domain of influenza HA using gene-specific primers and 136
SuperScriptTM
III One-Step RT-PCR with Platinum Taq (Invitrogen). Fragments 137
amplified (from nucleotide position) were: H3 HA 34–1101, H1 HA 1–1317, B HA 20–138
1119 using primers: H3; forward 5’-GACTATCATTGCTTTGAGCTAC and reverse 5’-139
CTATCATTCCCTCCCAACCAT: H1; forward 5’-AGCAAAAGCAGGGGAWAA and 140
reverse 5’-ACAGCTGTGAATTGAGTGTT or reverse 5’- CCTCATAGTCGGCGAAAT 141
A: B; forward 5’- CTAATATCCACAAAATGAAGGC and reverse 5’- ACCAGCAATA 142
GCTCCGAAGAAA. The RT-PCR consisted of 1 cycle 50°C for 30 min, 94°C for 143
2 min, 35 cycles of 94°C for 30 s, 55°C for 30 s, 68°C for 1 min, followed by a final 144
elongation step of 68°C for 7 min. Amplicons were visualised on a 2% (w/v) agarose gel. 145
PCR products were purified for use in sequencing reactions using Exonuclease I:Shrimp 146
Alkaline Phosphatase (ExoSAP-ITR,USB Corporation, USA). DNA sequencing was 147
carried out using the above primers in a 96-well plate format using ABI Prism Dye 148
Terminator III cycle sequencing kit (Applied Biosystems, USA) followed by the removal 149
of excess dye terminators with BigDyeR XTerminator
TM Purification kit (Applied 150
Biosystems, USA). The sequence was determined using an automated capillary DNA 151
sequencer (ABI Prism 3700 at the Institute of Medical and Veterinary Science, Adelaide, 152
Australia). Sequences were assembled using Lasergene Seqman package IV 153
(DNAStar V7.2.1(1)). The sequences of the HA-1 domain of the HA gene of all original 154
clinical specimens analysed by multiple passaging in the cell lines is available on 155
GenBank/EMBL/DDBJ, with accession numbers provided in Supplementary Data. 156
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
9
157
Statistics 158
The data were analysed using the MINITAB statistical analysis program at a confidence 159
interval (CI) of 95%. Differences were considered statistically significant when p<0.05. 160
Median virus titres were compared using the nonparametric two-tailed Mann-Whitney U-161
test; the number of virus isolates recovered in each cell line was analysed using the chi-162
square test. 163
164
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
10
RESULTS 165
166
Rate of isolation and titre of influenza virus from human clinical specimens is 167
increased after growth in MDCK-SIAT1 cells compared to MDCK cells 168
To determine whether MDCK-SIAT1 cells had a higher isolation rate of recent influenza 169
viruses, MDCK-SIAT1 and MDCK cells were infected with a total of 125 stored clinical 170
specimens (previously confirmed to be influenza-positive) in duplicate, collected during 171
the period from 2003 to 2007 (39 A(H1N1), 53 A(H3N2), 33 B). Following 4 days in 172
culture, supernatants were analysed for influenza virus by TCID50 (performed in the same 173
cell line used for isolation). Viruses were considered to have successfully grown if log10 174
TCID50/ml >2. Of the stored clinical samples 74% of A(H1N1), 91% of A(H3N2) and 175
39% of B viruses were successfully recovered in at least one of the cell lines (Figure 1A). 176
No viruses were isolated exclusively in MDCK cells. Two thirds of the viruses grew in 177
both cell lines and the remaining viruses were recovered only in MDCK-SIAT1 cells 178
(Figure 1A). There was no correlation between year of isolation and cell line recovery, 179
nor any correlation between virus origin and recovery patterns for A(H1N1) and B 180
viruses (data not shown). For A(H3N2) viruses, yearly breakdown revealed that the 181
viruses appeared to be changing in their isolation pattern particularly between 2006 and 182
2007, with a significant reduction in the ability of MDCK cells to isolate 2007 viruses 183
compared to 2006 viruses (p<0.005), unlike MDCK-SIAT1 cells which were able to 184
grow A(H3N2) viruses from both years (Figure 1B). Median viral titres of clinical 185
specimens were significantly higher in MDCK-SIAT1-grown influenza A cultures 186
compared to MDCK-grown cultures for A(H1N1) viruses (p<0.001) and A(H3N2) 187
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
11
viruses (p<0.0005). No significant difference in the titre of B viruses was detected, 188
however this may be due to the small number of B viruses recovered (8 in MDCK cells 189
and 13 in MDCK-SIAT1 cells) (Figure 1C). 190
191
MDCK cell-passaged and egg-passaged influenza viruses propagate in MDCK-192
SIAT1 cells 193
To determine if MDCK-SIAT1 cells could support growth of viruses previously cultured 194
in MDCK cells or embryonated eggs, MDCK-SIAT1 cells (with MDCK cells as a 195
control) were infected in duplicate with 10 MDCK cell-passaged viruses (3 A(H1N1), 4 196
A(H3N2), 3 B/Malaysia/2506/2004-like) and 6 egg-passaged viruses (2 A(H1N1), 2 197
A(H3N2), 2 B/Shanghai/361/2002-like) isolated from 2003 to 2007. Supernatants were 198
collected after 4 days and analysed for virus by TCID50 assay. 9/10 cell-passaged viruses 199
were recovered in MDCK-SIAT1 cells and 10/10 in MDCK cells. One previously cell-200
passaged virus, B/Malaysia/174/2006, did not grow in MDCK-SIAT1 culture and grew in 201
only one of two infected MDCK wells, thus was eliminated from any further analyses. 202
All egg-isolated viruses grew in both cell lines. Median viral titres of cell- and egg-203
passaged viruses were significantly higher in MDCK-SIAT1-grown cultures compared to 204
MDCK-grown cultures for A(H3N2) viruses (p<0.005), but no significant difference in 205
growth of A(H1N1) or B viruses was detected (Figure 1D). 206
207
RBC binding changes after passaging in cell lines 208
RBC agglutination is the method most commonly used to detect influenza virus particles 209
in cell culture supernatants. To investigate changes to HA binding following cell culture 210
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
12
of clinical specimens, randomly selected MDCK-SIAT1- and MDCK-passaged A(H1N1) 211
(n=9) and A(H3N2) (n=25) viruses from 2005 to 2007, that grew in both cells lines, were 212
analysed for their ability to agglutinate turkey and guinea pig RBC. Turkey (and chicken) 213
RBC express high levels of α-2,3-linked sialic acid receptors and lower levels of α-2,6-214
linked sialic acid receptors than human and guinea pig RBC (19, 26). Following passage 215
of A(H1N1) viruses in MDCK cells, the majority of viruses were able to agglutinate both 216
turkey and guinea pig RBC (Figure 2). One virus, A/Singapore/32/2006, was unable to 217
agglutinate either RBC, possibly as the virus titre was very low (data not shown). 218
Following passage of A(H1N1) viruses in MDCK-SIAT1 cells, the majority of samples 219
agglutinated both turkey and guinea pig RBC (Figure 2). One virus, A/Singapore/68/ 220
2005, was able to agglutinate only guinea pig RBC. 221
222
Agglutination patterns were different for A(H3N2) viruses after passage in the two cell 223
lines. The majority of A(H3N2) virus samples passaged in MDCK cells were able to 224
agglutinate both turkey and guinea pig RBC, whilst almost one quarter of viruses could 225
agglutinate only guinea pig RBC (Figure 2). Following passage in MDCK-SIAT1 cells, 226
all A(H3N2) viruses agglutinated guinea pig RBC. Interestingly, agglutination of turkey 227
RBC by A(H3N2) viruses passaged in MDCK-SIAT1 cells was variable. Almost half of 228
the viruses also agglutinated turkey RBC and the remaining viruses had only partial 229
agglutination with turkey red blood cells (Figure 2). This incomplete agglutination was 230
characterised by a difficulty in determining the titre of the virus. Re-passage of 231
‘incomplete’ samples isolated in MDCK-SIAT1 cells into MDCK cells restored the 232
viruses’ ability to agglutinate turkey RBC, whilst re-passage of samples isolated in 233
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
13
MDCK cells into MDCK-SIAT1 cells generally led to loss of the ability to agglutinate 234
turkey RBC (data not shown). These data indicates that the incomplete agglutination 235
patterns observed were a result of the cell passaging and not a property of the individual 236
viruses. 237
238
HA gene remains unchanged following viral passage in MDCK-SIAT1 cells 239
To determine if the passaging of influenza virus in MDCK-SIAT1 cells (or conventional 240
MDCK cells) resulted in virus-cell adaptations, 6 A(H1N1), 5 A(H3N2) and 6 B 241
influenza viruses that grew in both cell lines were passaged five times in each cell line. 242
After each passage, CPE was observed and RBC agglutination measured to confirm virus 243
growth. A(H3N2) samples cultured in MDCK cells agglutinated both turkey and guinea 244
pig RBC after five passages, whilst A(H3N2) samples cultured in MDCK-SIAT1 cells 245
were only able to agglutinate guinea pig RBC after one passage. Comparison of the HA-1 246
domain of the HA gene sequences of isolated viruses at passage 1 and passage 5 to those 247
of viruses from original clinical specimens showed that the HA gene of A(H1N1) viruses 248
did not mutate following a single passage in either cell line. However, two base pair (bp) 249
changes were seen in A(H1N1) viruses following 5 passages in MDCK cells (Table 1). 250
Substitution of G with A at 606 bp, leading to an amino acid change, D190N (H3 251
numbering system), was detected in 4/6 A(H1N1) MDCK-passaged viruses. A mixed 252
population was detected in another sample, with substitution of C with G at 426 bp, 253
producing a N129K mutation. No changes were seen in A(H1N1) viruses cultured 254
multiple times in MDCK-SIAT1 cells compared to the sequence of the original clinical 255
specimen. A synonymous change was detected in one A(H3N2) clinical specimen after 256
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
14
passage in MDCK-SIAT1 cells (T with A) and a single non-synonymous change was 257
detected in one A(H3N2) clinical specimen after passage in MDCK cells (G316A) 258
leading to an alanine to tyrosine change at aa106. These mutations appeared stable in the 259
cell lines and were detected after both single and multiple passages (Table 1). 260
261
Interestingly, for influenza B viruses, 8 base pair (bp) changes resulting in 3 amino acid 262
(aa) changes were observed after initial passage in both MDCK cells and MDCK-SIAT1 263
cells (N197T, S216F and G230D). Two of the non-synonymous mutations were present 264
as mixed populations in some of the cultures (S216F, G230D). Further mutations were 265
detected after five passages in the two cell lines, with one non-synonymous change in 2/6 266
MDCK-passaged viruses (T199I) and a synonymous change in both MDCK-and MDCK-267
SIAT1-passaged viruses (a906g). The HA sequence changes were seen for the same 268
viruses in both cell lines suggesting these represent a general adaptation to cell culture, 269
rather than a specific adaptation to culture in MDCK-SIAT1 cells. 270 ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
15
DISCUSSION 271
In this study, the usefulness of MDCK-SIAT1 cells for isolation of influenza virus from 272
stored human clinical samples compared to conventional MDCK cells was investigated. 273
While previous small studies have demonstrated some improvement in isolation rates, 274
few laboratories routinely use MDCK-SIAT1 or the similar cell line, ST6Gal I (16, 25). 275
The data reported here confirm that MDCK-SIAT1 cells could be used to isolate 276
influenza A(H1N1 and H3N2) and B viruses more efficiently from stored clinical 277
specimens than the parental MDCK cells, in a large number of samples collected in 2006 278
to 2007. The viruses isolated had fewer aa mutations in the HA-1 domain of the HA gene 279
following multiple passages in MDCK-SIAT1 cells than in MDCK cells. In addition, 280
MDCK-SIAT1 cells were able to support higher levels of virus growth for A(H1N1) and 281
A(H3N2) viruses compared to MDCK cells. 282
283
Infection of cells with influenza virus is limited by the number of virions in the clinical 284
specimen and the avidity of the interaction between virions and receptors, which 285
comprises both the individual affinity of the HA for sialic acid-linked receptor and the 286
number of receptors available on the cell (or virion) surface. The increased level of α-2,6-287
linked sialic acid receptors on MDCK-SIAT1 cells should increase the avidity of the 288
interaction, hence is likely to contribute to the higher recovery of human influenza 289
viruses from stored clinical samples by MDCK-SIAT1 cells compared to MDCK cells. 290
No pattern was present between influenza A(H1N1) virus recovery and year or location 291
of clinical specimen. However a yearly breakdown revealed that A(H3N2) viruses 292
appeared to be drifting in their receptor specificity, with more viruses recovered in both 293
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
16
cell lines in 2006 compared to 2007 where the majority of A(H3N2) viruses were 294
recovered only in MDCK-SIAT1 cells. There was no significant difference in the 295
log10TCID50 titres of A(H3N2) samples from 2006 to 2007 recovered in MDCK-SIAT1 296
cells, suggesting that the amount of virus in the samples was not a limiting factor (data 297
not shown). The density of HA on the virion surface may have altered between 2006 and 298
2007 A(H3N2) viruses, a feature seen with some H5N1 viruses (17). Most likely, 299
however, the affinity of the HA for α-2,6-linked sialic acid receptors has altered over 300
time. Reduction in the affinity of A(H3N2) viruses has been reported previously, with a 301
loss of binding to chicken RBC by A(H3N2) viruses seen over the past 10-15 years (15, 302
22, 26, 28). This may be attributed to a reduced affinity for sialic acid-linked receptors, 303
particularly α-2,6-linked receptors, which are at lower levels on chicken (and turkey) 304
RBC compared to guinea pig RBC (26). This antigenic drift appears to be more dramatic 305
in the viruses assessed in this study, particularly between 2006 and 2007. Changes in HA 306
sequence between A(H3N2) viruses from 2006 and 2007 viruses have been observed, 307
particularly K140I, R142G and N144D, which are in antigenic site 3 and lie close to the 308
receptor binding region. Although a direct link between these specific mutations and 309
receptor affinity is yet to be confirmed, these aa are found in a high proportion of 310
A(H3N2) 2007 viruses but rarely in 2006 viruses suggesting they may contribute to 311
observed changes in HA binding characteristics. 312
313
RBC agglutination of viruses isolated from cell- or egg-passage is typically used to assess 314
culture-derived modifications and specificity of viral HA for influenza receptors (18, 15, 315
22, 26, 28). In addition, HA inhibition assays with RBC are routinely used to monitor 316
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
17
antigenic drift of influenza viruses as part of the WHO Global Influenza Programme (5). 317
Therefore any change in the ability of viruses to bind to RBC from different species 318
following passage in MDCK and MDCK-SIAT1 cells is particularly important. 319
Following passage in MDCK-SIAT1 cells, A(H3N2) viruses showed altered 320
agglutination patterns, with the majority of A(H3N2) isolates unable to agglutinate turkey 321
RBC completely. Changes have often been observed in RBC agglutination patterns 322
following passage of viruses in embryonated chicken eggs compared to MDCK cells 323
(18), but this is generally attributed to changes in HA specificity due to the increased 324
proportion of α-2,3-linked receptors in eggs compared to MDCK cells and produces 325
viruses equally capable of binding both chicken and turkey RBC (18). However there 326
were few sequence changes in HA following passage in MDCK-SIAT1 cells compared to 327
the original clinical sample and little variation in HA sequence between MDCK and 328
MDCK-SIAT1-passaged A(H3N2) viruses, despite the altered agglutination patterns. 329
This further suggests agglutination differences are a feature of passage in MDCK-SIAT1 330
cells. Differences in agglutination patterns have also been reported following passage of 331
A(H3N2) viruses in Vero cells compared to MDCK cells (36) where viruses grown in 332
Vero cells lost their ability to agglutinate chicken erythrocytes . While viruses isolated 333
from both cell lines had identical HA-1 (and other gene) sequences, the HA from Vero 334
cell derived viruses had a different glycosylation pattern with oligosaccharides of the 335
high mannose type unlike MDCK derived viruses. When some of these mannose 336
residues were removed enzymatically, the Vero-derived viruses had their ability to 337
agglutinate chicken erythrocytes restored. No such differences were observed with 338
A(H1N1) viruses grown in Vero cells (36). As MDCK-SIAT1 cells were engineered by 339
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
18
transfection with the human CMP-N-acetylneuraminate β-galactoside α-2,6-340
sialyltransferase gene, glycosylation patterns on the HA of budding viruses may also be 341
altered. Thus to ensure accurate detection of A(H3N2) viruses following passage in 342
MDCK-SIAT1 cells, we would advise the use of mammalian RBC for haemagglutination 343
assays. 344
345
As shown here and previously reported, unlike embryonated chicken eggs, influenza 346
virus propagation in MDCK cells results in little genetic variation in the HA-1 gene when 347
compared to the original infecting sample (6, 13, 20, 26, 30, 32, 33, 34, 37, 39). However 348
two interesting aa mutations were detected as a stable change in more than one virus. The 349
D190N mutation has been previously been reported in egg-passaged A(H1N1) viruses (9, 350
31, 33, 24) and shown to dominate in egg-passaged A(H1N1) viruses even if it was 351
originally present as a minor species (33). As the side chain at position 190 of HA 352
interacts with the 9-hydroxyl group of sialic acid (45), the D190N mutation increases 353
binding to chicken embryo chorio-allantoic membranes and decreases the affinity of virus 354
for α-2,6-linked sialic acid receptors (9). N197 (with T199) is a N-linked glycosylation 355
sequon in the HA-1 region of recent influenza B viruses (N-X-T/S – aa196-198 for 356
B/Yamagata-lineage, 197-199 for B/Victoria lineage). Although egg-passaged viruses 357
predominantly select for variants that no longer have this glycosylation site, MDCK cells 358
can support growth of virus with or without the glycosylation at position 197 (6, 37). 359
Studies using cell- and egg-passaged viruses and viruses modified by reverse genetics 360
which contain the mutation, demonstrated that the binding affinity to horse RBC was 361
inhibited by glycosylation, however the loss of the glycosylation site did not affect the 362
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
19
affinity for α−2,3- or α-2,6-linked sialic acid receptors. This suggests a role for steric 363
hindrance at this aa site in the influenza B HA which may also affect the antigenicity of 364
the virus (6, 37). Although we have only sequenced one sample from each passage in our 365
studies, the use of high fidelity Taq and the repeated incidence of the same mutation after 366
multiple passages in MDCK cells confirm the importance of the D190N and 367
N197T/T199I mutations. Analysis of HA sequences from viruses routinely passaged at 368
the WHO Collaborating Centre in Melbourne in the past three years revealed that D190N 369
occurred in 14% (9/64) of randomly selected MDCK-passaged viruses, whilst the 370
N197T/T199I mutations have also been detected in this, and other, laboratories (23). 371
372
This study showed that MDCK-SIAT1 cells, which expressed enhanced levels of α-2,6-373
linked sialic acid receptors, supported isolation of more recent human influenza viruses 374
from a large panel of stored clinical samples and grew viruses to a higher titre than 375
conventional MDCK cells. Most importantly, virus from stored clinical specimens that 376
could not be recovered after inoculation in MDCK cells, was recovered after inoculation 377
in MDCK-SIAT1 cells. Thus, we propose that MDCK-SIAT1 cells or a similar line, such 378
as ST6Gal-1 cells, be used routinely, along with or even in place of conventional MDCK 379
cells to isolate human influenza viruses to ensure an accurate representation of currently 380
circulating influenza strains. This maybe increasingly important if difficulty in isolating 381
A(H3N2) viruses in MDCK cells, as seen in recent years, continues. Further studies will 382
however, be required to determine if MDCK-SIAT1 and other equivalent cell lines are as 383
efficient as MDCK cells in isolating and propagating avian influenza viruses such as 384
A(H5N1) viruses from humans. While these cell lines have been shown to express 385
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
20
slightly lower or similar levels of α-2,3-linked receptors (the receptor for avian influenza 386
viruses) (16, 25), no comprehensive evaluation has been performed to date. 387
388
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
21
ACKNOWLEDGEMENTS 389
The authors thank Professor Hans-Dieter Klenk for providing MDCK-SIAT1 cells and 390
the National Influenza Centres and other submitting laboratories for providing the human 391
clinical specimens used for analysis in this paper. The authors also thank their colleagues 392
at the WHO Influenza Collaborating Centre for expert technical assistance and advice. 393
The Melbourne WHO Collaborating Centre for Reference and Research on Influenza is 394
supported by the Australian Government Department of Health and Ageing. 395
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
22
REFERENCES 396
397
1. Baum, L.G., and J.C. Paulson. 1990. Sialyloligosaccharides of the respiratory 398
epithelium in the selection of human influenza virus receptor specificity. Acta 399
Histochem Suppl. 40:35-8. 400
2. Belsey, M.J., B. de Lima, A.K. Apvlou, and J.W. Savopoulos. 2006. Influenza 401
vaccines. Nat Rev Drug Discov. 5(3):183-184. 402
3. Burnet, F. 1940. Influenza virus infections of the chick embryo by the amniotic 403
route. Aust. J. Exp Biol and Med Sci. 18:353-360. 404
4. Burnet, F. 1941. Growth of influenza virus in the allantoic cavity of the chick 405
embryo. Aust. J. Exp. Med. Sci. 19:291-295 406
5. Centre for Disease Control (CDC), Public Health Service, US Department of 407
Health and Human Services. 1982. Concepts and Procedures for Laboratory-408
based Influenza Surveillance. 409
6. Chen, Z., A. Aspelund, and H. Jin. 2008. Stabilizing the glycosylation pattern of 410
influenza B hemagglutinin following adaptation to growth in eggs. Vaccine. 411
26:361-371. 412
7. Couceiro, J.N., J.C. Paulson, and L.G. Baum. 1993. Influenza virus strains 413
selectively recognize sialyloligosaccharides on human respiratory epithelium; the 414
role of the host cell in selection of hemagglutinin receptor specificity. Virus Res. 415
29(2):155-65. 416
8. Cox, M.M. 2008. Progress on baculovirus-derived influenza vaccines. Curr. 417
Opin. Mol. The. 10(1):56-61. 418
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
23
9. Gambaryan, A.S., J.S. Robertson, and M.N. Matrosovich. 1999. Effects of 419
egg-adaptation on the receptor-binding properties of human influenza A and B 420
viruses. Virology. 258:232-239. 421
10. Gaush, C.R., and T.F. Smith.1968. Replication and plaque assay of influenza 422
virus in an established line of canine kidney cells. Appl. Microbio. 16:588-594 423
11. Govorkova, E.A., N. V. Kaverin, L. V. Gubareva, B. Meignier, and R. G. 424
Webster. 1995. Replication of influenza A viruses in a green monkey kidney 425
continuous cell line (Vero). J. Infect. Dis. 172:250-253 426
12. Govorkova, E.A., G. Murti, B.Meignier, C. de Taisne, and R.G. Webster. 427
1996. African green monkey kidney (Vero) cells provide an alternative host cell 428
system for influenza A and B viruses. J Virol. 70(8):5519-5524 429
13. Govorkova E.A., S. Kodihalli, I.V. Alymova , B. Fanget, and R.G. Webster. 430
1999b. Growth and immunogenicity of influenza viruses cultivated in Vero or 431
MDCK cells and in embryonated chicken eggs. Dev Biol Stand 98:39-51 432
14. Govorkova E.A., M.N. Matrosovich, A.B. Tuzikov, N.V. Bovin, C. Gerdil, B. 433
Fanget, and R.G. Webster. 1999a. Selection of receptor-binding variants of 434
human influenza A and B viruses in baby hamster kidney cells. Virology 435
262(1):31-8. 436
15. Grassauer, A., A.Y. Egorov, B. Ferko, J. Romanova, H. Katinger, and T. 437
Muster. 1998. A host-restriction-based selection system for influenza 438
haemagglutinin transfectant viruses. J. Gen. Virol. 79:1405-1409. 439
16. Hatakeyama, S., Y. Sakai-Tagawa, M. Kiso, H. Goto, C. Kawakami, K. 440
Mitamura, N. Sugaya, Y. Suzuki, and Y. Kawaoka. 2005. Enhanced expression 441
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
24
of an α-2,6-linked sialic acid on MDCK cells improves isolation of human 442
influenza viruses and evaluation of their sensitivity to a neuraminidase inhibitor. 443
J. Clin. Microbiol. 43(8):4139-4146. 444
17. Horimoto, T., S. Murakami, Y. Muramoto, S. Yamada, K. Fujii, M. Kiso, K. 445
Iwatsuki-Horimoto, Y. Kino and Y. Kawaoka. 2007. Enhanced growth of seed 446
viruses for H5N1 influenza vaccines. Virology. 366(1):23-27/ 447
18. Ito T, Y. Suzuki, A. Takada, A. Kawamoto, K. Otsuki, H. Masuda, M. 448
Yamada, T. Suzuki, H. Kida, and Y. Kawaoka. 1997a. Differences in sialic 449
acid-galactose linkages in the chicken egg amnion and allantois influence human 450
influenza virus receptor specificity and variant selection. J Virol. 71(4):3357-62. 451
19. Ito, T., Y. Sazuki, L. Mitnaul, A. Vines, H. Kida, and Y. Kawaoka. 1997b. 452
Receptor specificity of influenza A viruses correlates with the agglutination of 453
erythrocytes from different animals. Virology 227:493-499. 454
20. Katz, J.M., M. Wang, and R.G. Webster. 1990. Direct sequencing of the HA 455
gene of influenza (H3N2) virus in original clinical samples reveals sequence 456
identity with mammalian cell-grown virus. J Virol. 64(4):1808-1811. 457
21. Kistner, O., M.K. Howard, M.Spruth, W. Wodal, P. Bruhl, M. Gerencer, 458
B.A. Crowe, H. Savidis-Dacho, I. Livey, M. Reiter, I. Mayerhofer, C. Tauer, 459
L. Grillberger, W. Mundt, F.G. Falkner and P.N. Barrett. 2007. Cell culture 460
(Vero) derived whole virus (H5N1) vaccine based on wild-type virus strain 461
induces cross-protective immune responses. Vaccine 25(32):6028-6036. 462
22. Lindstrom, S., S. Sugita, A., Endo, M., Ishida, P., Huang, S.H. Xi, and K. 463
Nerome. 1996. Evolutionary characterization of recent human H3N2 influenza A 464
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
25
isolates from Japan and China: novel changes in the receptor binding domain. 465
Arch. Virol. 141(7):1349-1355. 466
23. Macken, C., H. Lu, J. Goodman and L. Boykin. 2001 "The value of a database 467
in surveillance and vaccine selection." in Options for the Control of Influenza IV. 468
A.D.M.E. Osterhaus, N. Cox & A.W. Hampson (Eds.) Amsterdam: Elsevier 469
Science, 103-106. 470
24. Matrosovich, M., A. Tuzikov, N. Bovin, A. Gambaryan, A. Klimov, M.R. 471
Castrucci, I. Donatelli, and Y. Kawaoka. 2000. Early alterations of the receptor-472
binding properties of H1, H2 and H3 avian influenza virus hemagglutinins after 473
their introduction into mammals. J. Virol. 74(18):8502-8512. 474
25. Matrosovich, M., T. Matrosovich, J. Carr, N.A. Roberts, and H.-D. Klenk. 475
2003. Overexpression of the a-2,6-sialyltransferase in MDCK cells increases 476
influenza virus sensitivity to neuraminidase inhibitors. J. Virol 77(15):8418-8425 477
26. Mederios, R., N. Escriou, N. Naffakh, J-C., Manuguerra, and S. van der 478
Werf. 2001. Hemagglutinin residues of recent human A(H3N2) influenza viruses 479
that contribute to the inability to agglutinate chicken erythrocytes. Virology. 480
289:74-85. 481
27. Meguro H., J.D. Bryant, A.E. Torrence, and P.F. Wright. 1979. Canine kidney 482
cell line for isolation of respiratory viruses. J. Clin Microbiol 9(2):175-179 483
28. Nobusawa, E., H. Ishihara, T. Morishita, K. Sato, and K. Nakajima. 2000. 484
Change in receptor-binding specificity of recent human influenza A viruses 485
(H3N2): a single amino acid change in hemagglutinin altered its recognition of 486
sialyloligosaccharides. Virology. 278(2):587-96. 487
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
26
29. Oxford, J.S., C. Manuguerra, O. Kistner, A. Linde, M. Kunze, W. Lange, B. 488
Schweiger, G. Spala, H. Rebelo de Andrade, P.R. Pérez Breña, J. Beytout, L. 489
Brydak, D. Caraffa de Stefano, O. Hungnes, J. Kyncl, E. Montomoli, A. Gil 490
de Miguel, R. Vranckx and A. Osterhaus. 2005. A new European perspective of 491
influenza pandemic planning with a particular focus on the role of mammalian 492
cell culture vaccines. Vaccine. 23(46-47):5440-5449. 493
30. Robertson, J.S., C.W. Naeve, R.G. Webster, J.S. Bootman, R. Newman, and 494
G.C. Schild. 1985. Alterations in the hemagglutinin associated with adaptation of 495
influenza B virus to growth in eggs. Virology 143(1):166-174. 496
31. Robertson, J.S., J.S. Bootman, R. Newman, J.S. Oxford, R.S. Daniels, R.G. 497
Webster, and G.C. Schild. 1987. Structural changes in the hemagglutinin which 498
accompany egg adaptation of an influenza A (H1N1) virus. Virology 160:31-37. 499
32. Robertson, J.S., J.S. Bootman, C. Nicolson, D. Major, E.W. Robertson, and 500
J.M. Wood. 1990. The Hemagglutinin of influenza B viruses present in clinical 501
material is a single species identical to that of mammalian cell-grown virus. 502
Virology. 179(1):35-40. 503
33. Roberston, J.S., C. Nicolson, J.S. Bootman, D. Major, E.W. Robertson, and 504
J.M. Wood. 1991. Sequence analysis of the haemagglutinin (HA) of influenza A 505
(H1N1) viruses present in clinical material and comparison with the HA of 506
laboratory-derived virus. J. General Virol. 72: 2671-2677. 507
34. Rocha, E.P., X. Xu, H.E. Hall, J.R. Allen, H.L. Regnery, and N.J. Cox. 1993. 508
Comparison of 10 influenza A (H1N1 and H3N2) haemagglutinin sequences 509
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
27
obtained directly from clinical specimens to those of MDCK cell- and egg-grown 510
viruses. J. General Virol. 74:2513-2518. 511
35. Rogers, G.N., and J.C. Paulson. 1983. Receptor determinants of human and 512
animal influenza virus isolates: differences in receptor specificity of the H3 513
hemagglutinin based on species of origin. Virology 127(2):361-73. 514
36. Romanova, J., D. Katinger, B. Ferko, R. Voglauer, L. Mochalova, N. Brown, 515
W. Lim, H., Katinger, and A. Egorov. 2003. Distinct host range of influenza 516
H3N2 virus isolates in Vero and MDCK cells is determined by cell specific 517
glycosylation pattern. Virology 307:90-97 518
37. Saito, T., Y. Nakaya, T. Suzuki, R. Ito, T. Saito, H. Saito, S. Takao, K. 519
Sahara, T. Odagiri, T. Murata, T. Usui, Y. Suzuki, and M. Tashiro. 2004. 520
Antigenic alteration of influenza B virus associated with loss of a glycosylation 521
site due to host-cell adaptation. J. Medical Virol. 74:336-343. 522
38. Schepetiuk SK, and T. Kok. 1993. The use of MDCK, MEK and LLC-MK2 cell 523
lines with enzyme immunoassay for the isolation of influenza and parainfluenza 524
viruses from clinical specimens. J. Virol. Methods 42(2-3):241-250 525
39. Schild, G.C., J.S. Oxford, J.C. de Jong, and R.G. Webster. 1983. Evidence for 526
host-cell selection of influenza virus antigenic variants. Nature. 303(5919):706-527
709. 528
40. Seo, S.H., O Goloubeva, R. Webby, and R.G. Webster. 2001. Chacterization of 529
a porcine lung epithelial cell line suitable for influenza virus studies. J. Virol. 530
75(19):9517-9525. 531
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
28
41. Tannock, G.A., J.A. Paul, R. Herd, R.D. Barry, A.L. Reid, M.J. Hensley, R.S. 532
Gillett, S.M. Gillett, P. Lawrance, R.L. Henry and N.A. Saunders. 1989. 533
Improved colorimetric assay for detecting influenza B virus neutralizing antibody 534
responses to vaccination and infection. J Clin Microbiol. 27(3):524-8. 535
42. Tobita, K. 1975. Permanent canine kidney (MDCK) cells for isolation and plaque 536
assay of influenza B viruses. Med Microbiol Immunol 162(1):23-7 537
43. Tobita, K., A. Sugiura, C. Enomote and M. Furuyama. 1975. Plaque assay and 538
primary isolation of influenza A viruses in an established line of canine kidney 539
cells (MDCK) in the presence of trypsin. Med Microbiol Immunol. 162(2):9-14 540
44. Trusheim, H., B. Roth, R. Wilms, S. Jung, R. Muth, M. Eggers, M. Enders, 541
M. Elsen, C. Lenz-Bauer, K. Schwartz, E. Veit, and T. Schaar. 2007. The 542
MDCK 33016-PF cell-line is not only suitable for the production of cell-based 543
influenza vaccine but is also an ideal substrate for influenza virus isolation. 544
Options for the Control of Influenza VI, Toronto, Canada. 545
45. Weiss, W., J.H. Brown, S. Cusack, J.C. Paulson, J.J. Skehel, and D.C. Wiley. 546
1988. Structure of the influenza virus haemagglutinin complexed with its 547
receptor, sialic acid. Nature. 333:426-431. 548
549
550
551
552
553
554
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
29
FIGURE LEGENDS 555
556
Figure 1. Isolation and passaging of influenza samples in MDCK and MDCK-SIAT1 557
cells 558
Human clinical specimens and cell- and egg-passaged influenza virus samples were 559
cultured in duplicate in MDCK or MDCK-SIAT1 cells for 4 days. Supernatants were 560
collected and influenza virus titres measured by TCID50. Shown in A is the total number 561
of human clinical virus isolates recovered in each cell line, B is the recovery of A(H3N2) 562
viruses from stored clinical samples by year of collection, C shows the titres for 563
individual stored clinical samples (average of duplicates) isolated in either MDCK 564
(black) or MDCK-SIAT1 cells (white) and D shows titres for viruses previously isolated 565
in eggs (squares) or MDCK cells (diamonds); re-passaged in MDCK (black) or MDCK-566
SIAT1 (white) cells. The median is indicated by the horizontal bar. ‘N.R.’ indicates not 567
recovered samples. ‘SIAT1’ indicates MDCK-SIAT1 cells. *p<0.001, **p<0.005, 568
***p<0.0005 569
570
Figure 2. RBC agglutination after cell culture 571
Human clinical specimens cultured in MDCK or MDCK-SIAT1 cells were assayed by 572
haemagglutination assay with either guinea pig or turkey RBC. Shown is the number of 573
haemagglutination positive samples (titre >1) for each RBC type from MDCK- or 574
MDCK-SIAT1-cultured A(H1N1) (white) or A(H3N2) (black) viruses. ‘I/C’ indicates 575
incomplete agglutination and thus the titre was not determined. 576
577
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
30
Table 1. Sequence mutations in HA gene after passaging in MDCK or MDCK-578
SIAT1 cells 579
Human clinical specimens were passaged five times in either MDCK or MDCK-SIAT1 580
cells in duplicate. HA-1 domain of the HA gene was sequenced after passage 1 (P1) and 581
passage 5 (P5) and mutations (silent and those resulting in an aa change) recorded where 582
there were changes from the sequence obtained directly from the clinical sample; amino 583
acids (aa) are numbered in accordance with the H3 numbering system; base pairs (bp) are 584
numbered with reference to actual sequence numbers of each subtype. * indicates mixed 585
population 586
587
588
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
31
Table 1 589
590
HA-1
MUTATION CELL PASSAGE
MDCK MDCK-SIAT1 base
pair
amino
acid P1 P5 P1 P5
A(H1N1)
g606a D190N - 4/6 - -
c426g N129K - 1/6* - -
A(H3N2)
g316a A106T 1/5 1/5 - -
t75a - - - 1/5 1/5
B
a590c N197T 2/6 2/6 1/6 2/6
c596t T199I - 2/6 - -
c647t S216F 3/6* 3/6* 3/6* 1/6*
g689a G230D 2/6* 2/6 1/6 2/6
t45g - 1/6 1/6 1/6 1/6
a594g - 1/6 2/6 1/6 2/6
a816g - 1/6 2/6 1/6 2/6
g843a - 1/6 2/6 1/6 2/6
a906g - - 2/6 1/6 2/6
591
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
0
5
10
15
20
25
30
No.
of
viruses
0
2
4
6
8
10
12
14
Log
10T
CID
50/m
l
A A B A A B(H1N1) (H3N2) (H1N1) (H3N2)
A B
C D
2003
2004
2005
2006
2007
*
***
**
Figure 1
A(H1N1)
A(H3N2)
B
+
-
-
+
+
+
N.R.MDCK
SIAT1
+
-
-
+
+
+
N.R.
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from
MDCK
MDCK-SIAT1
0
5
10
15
20
0
5
10
15
20
No.
of
viruses
TURKEYGUINEA PIG
--
I/C+
++
-+
+-
Figure 2
ACCEPTED
on April 9, 2020 by guest
http://jcm.asm
.org/D
ownloaded from