14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests...

14 Serology DNA.notebook

1

14: Forensic Serology & DNA Analysis


2

Serologythe study of bodily fluids

– blood– semen– vaginal secretion– pre‑ejaculatory fluid– intestinal fluid/vomit– breast milk– mucus– saliva– sebum (skin oil)– sweat– tears– earwax


3

Composition of Blood:• Plasma (55%)> the fluid portion of blood> mostly water

• Solids (45%)> erythrocytes (red blood cells)> leukocytes (white blood cells)> platelets

« do not have nucleus/DNA« cause blood to clot« too low = cause excessive bleeding« too high = cause blood clots/heart attack/stroke


4

Antigens > protein that stimulates the body to produce antibodies against it

> found on the surface of red blood cells

• Blood type A has A antigens on its red blood cell surface• Blood type B has B antigens on its red blood cell surface• Blood type AB has both A and B antigens• Blood type O has neither A nor B antigens

Antibodies

protein in the blood serum that destroys or inactivates a specific antigen


5

1901 ABO Blood Typing discovered by Karl Landsteiner

1937 Rh factor in blood also discovered by Landsteiner« Rh (+) = has the D antigen on the surface of red blood cells

« Rh (‑) = does not have the D antigen« currently there are 30 human blood group systems« The search for more blood facotrs slowed down in favor of Deoxyribonucleic acid (DNA).


6

Blood Type Antigens Antibodies

A A anti‑B

B B anti‑A

AB A and B None

O None anti‑A and anti‑B


7

Forensic Characterization of Blood & Bloodstains

Important Questions:

1) Is it blood?

2) Is it human blood?

3) Whose blood is it?


8

Forensic Tests for Blood:

1) Luminol> extremely sensitive presumptive test for bloodstains> capable of detecting blood dliuted up to 300,000 times> chemiluminescence (emission of light) occurs when reacted with the iron content in hemoglobin

> false positives (substances not of interest that can also produce the same results) include copper, bleach and horseradish


9

2) Phenolphthalein> aka Kastle‑Meyer color test> prelminary/presumptive blood test> reacts with hemoglobin to produce a deep pink color> false positives include broccoli, cauliflower, potatoes, horseradish, etc.


10

3) Hematrace> a confirmatory test for human blood> stain extract is applied to the bottom of the test strip> resembles pregnancy test


11

Forensic Test for Semen

1) Visual examination> look for white crusty substance in an obvious area

2) Alternate Light Source (ALS)> light source with control over wavelength in the Ultraviolet, infrared and visible range

> used to screen large areas for traces of physical evidence> causes most body fluids to glow (semen, saliva, vaginal secretion, etc.)


12

3) Acid Phosphatase (AP) Test> a presumptive color test for semen> acid phosphatase is an enzyme found in high concentration in semen


13

4) Prostate Specific Antigen (PSA) Test> confirmatory test for semen> p30 (a prostate specific protein) produces positive results> resembles home pregnancy test


14

5) Microscopic Sperm Search> confirmatory test for semen> performed under 400X magnification on a light microscope with a color stained slide

> search for the presence of spermatozoa (sperm)> normal male releases 250‑600 million sperms during an ejaculation

Possible reasons for negative sperm search:– sperm may bind tightly to clothing– sperms are extremely brittle when dry– sperms are easily washed off– oligospermia (abnormally low sperm count)– aspermia (no sperm in the seminal fluid)


15

Items often examined for blood & semen:> sexual assault evidence collection kit (rape kit)> clothing> bedding> carpeting> furniture> automotive upholstery> assault weapon


16

Heredity

gene– the basic unit of heredity– consists of a DNA segment on a chromosome

chromosome– a threadlike structure in the cell nucleus

– 46 chromosomes per human cell (except 23 in reproductive cells)


17

X chromosomethe female sex chromosome

Y chromosomethe male sex chromosome

The egg always contains the X chromosome.The sperm cell may contain either X or Y chromosome.

XX g femaleXY g male


18

• Locusthe physical location of a gene on a chromosome

• Allelesone member of a gene pair

• homozygoushaving two identical alleles in a gene pair

• heterozygoushaving two different alleles in a gene pair

• genotypethe particular combination of alleles in a gene

• phenotypethe physical manifestation of a genetic trait (shape,

color, blood type, etc.)


19

Punnet Square

used to determine the genotype/phenotype of offsprings

Mother'sgenotype

A

B

Father'sgenotype

O O

AO

BO BO

AO50% AO A

50% BO B

genotype phenotype

Question:

What are the percent probability of each blood type of a child reproduced by parents whose genotypes are AA and BO?


20

Deoxyribonucleic acid (DNA)

the molecules that carry the genetic information

1868 DNA first discovered by Friedrich Miescher

1953 DNA structure model (the double helix) by Watson and Crick

1985 Dr. Alec Jeffreys discovered that portions of DNA in certain genes are unique to each individual

DNA Fingerprinting (aka DNA profiling or DNA Typing)


21

Complementary Base Pairing

the specific pairing of > Adenine with Thymine> Guanine with Cytosine

Example:

TATT GTAA GTCA

ATAA CATT CAGT

All of the human chromosomes together contain about 3 billion base pairs.


22

More than 30% of the human genome is composed of repeating DNA segments.

tandem repeatregion of a chromosome that contains multiple copies of a repeating DNA sequenceex. GTAAGTAAGTAAGTAAGTAAGTAA

restriction enzymechemical that acts as scissors to cut DNA molecule at specific locations

restriction fragment length polymorphism (RFLP)different length fragment of base pairs formed by cutting a DNA molecule with restriction enzymes


23

Electrophoresis

an old technique used to separate DNA fragments


24

Polymerase Chain Reaction (PCR)> a technique used to copy or multiplying DNA strands> can amplify minute quantities of DNA> requires much shorter DNA strands than RFLP

Short Tandem Repeats (STR)> the latest method of DNA typing> uses a region of DNA molecule containing short segments of 3 to 7 repeating base pairs


25

Electropherogram

a plot resulting from automatic sequencing of DNA data

loci (location on chromosome)

repeats (how many times a sequence is repeated)


26

1) Is this a male or female profile?

2) Which locus is homozygous?


27


28


29

D3S1358 vWA D16S539 D2S1338

D8S1179 D21S11 D18S51

D19S433 TH01 FGA


30

The Combined DNA Index System (CODIS)> a DNA database developed by the FBI> maintains local, state and national databases of DNA profiles> contains the DNA profiles of convicted offenders, unsolved crime‑scene evidence and missing people

> In 1997, the FBI selected 13 STR loci for their national database.

CSF1PO, FGA, THO1, TPOX, VWA, D3S1358, D5S818, D7S820

D8S1179, D13S317, D16S539, D18S51, D21S11

> In 2017, the FBI expanded the selection to 20 STR loci.CSF1PO, FGA, THO1, TPOX, VWA, D3S1358, D5S818, D7S820

D8S1179, D13S317, D16S539, D18S51, D21S11, D1S1656 D2S441, D2S1338, D10S1248, D12S391, D19S433, D22S1045


31

Possible Issues with DNA Evidence:

1) Mixtures> if more than one person contributes to a sample, then 3 or more alleles will likely be observed in at least one of the tested loci.

> often challenging and subject to multiple interpretations.


32


33

2) Degradation> DNA samples degrade when a sample is aged or exposed to harsh conditions such as heat and humidity.

> sometimes difficult to interpret because of the loss of peak height information

> marked by progressively falling peak heights


34

Mitochondrial DNA (mtDNA)

> found outside of the nucleus of the cell> inherited only from the mother> circular or loop configuration> can be used when nuclear DNA is degraded or only present in small quantity

> reference sample can be obtained from any maternally related relative

> more sensitive than nuclear DNA> all individual of the same maternal lineage are indistinguishable> more rigorous, time consuming and costly than nuclear DNA profiling


35

Possible Conclusions in Forensic DNA Analysis:

• Inclusion (with small percent uncertainty)> The questioned DNA sample originated from the Known subject

• Exclusion> The questioned DNA sample did not originate from the known subject

• Inconclusive> mixture> biological child> degradation> not enough sample

14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests...

Documents

Transcript of 14: Forensic Serology & DNA Analysis · 2020. 4. 17. · 14 Serology DNA.notebook 8 Forensic Tests...