10.4 Evidence of Evolution Evidence of Evolution.

11
10.4 Evidence of Evolution Evidence of Evolution

Transcript of 10.4 Evidence of Evolution Evidence of Evolution.

10.4 Evidence of Evolution

Evidence of Evolution

10.4 Evidence of Evolution

The Fossil Record

Comparing fossils with living organisms reveals a pattern of gradual change from past to present.

*We will never find fossils of every species that ever lived.

10.4 Evidence of Evolution

Biogeography

Study of the locations of organisms around the world

Ostrich (Africa) Emu (Australia) Rhea (South America)

10.4 Evidence of Evolution

Movement of land forms can separate a group of organisms into two separate groups

10.4 Evidence of Evolution

10.4 Evidence of Evolution

Embryology

Scientists compare embryos to look for similar patters and structures

10.4 Evidence of Evolution

Anatomy

Scientists compare body structures of different species

– Homologous structures are similar in structure but different in function.

– Evidence of a common ancestor

10.4 Evidence of Evolution

Human hand

Bat wing

Mole foot

Fly wing

– Analogous structures are not evidence of a common ancestor.

– Analogous structures have a similar function.

10.4 Evidence of Evolution

Vestigial structures are remnants of organs or structures that had a function in an early ancestor.

(Ostrich wings, wisdom teeth, appendix, whale pelvic/leg bones)

10.4 Evidence of Evolution

Biochemistry

Comparing genes between species

AGTCCCGTAGGTCGATGTGGGTAAAAGCTTGATCG

AGTCCCGTACGTCGATGTGGGTATAAGCTTGATCG

10.4 Evidence of Evolution

How similar is human DNA to a…?

98%50%