1.) DNA Extraction
description
Transcript of 1.) DNA Extraction
1.) DNA Extraction
Follow Kit Grind sample Mix with solution and
spin Bind, Wash, Elute
Is DNA present? Gel Electrophoresis DNA has negative
charge
DNA Replication In Vivo
DNA unwound (denatured) by enzymes
RNA polymerase makes “primer”
DNA polymerase adds nucleotides
In Vitro DNA unwound by
heat Primers are added
DNA polymerase adds nucleotides
PCR Protocol Primer I (reverse) Primer II ( forward) DNA template Taq DNA polymerase MgCl2 Deoxyribonucleotide triphosphate (dNTP) PCR buffer Deionized water
2) Polymerase Chain Reaction Amplify certain sequence into billionfold Put DNA sample into tube and mix with
ingredients: Stages of PCR process
Denature Anneal Extension
dNTP (Deoxyribonucleotide triphosphate)
OH
5’ 3’
5’3’
1) Denaturation “Unwind Helix”
5’
3’5’
5’
3’
5’
3’3’
2) AnnealingForward PrimerReverse Primer
3) ExtensionAdd dNTP’s
5’
3’
5’
3’
5’
3’
5’ 3’
PCR Clean-Up
Cycle Sequencing Same as PCR
Denature Anneal (forward and reverse primers in separate
reactions) Extension dNTP ddNTP
Different size of DNA fragments
ddNTP a dideoxyribonucleotide triphosphate
(ddNTP), share the same structure as a normal dNTP, with the exception of the 3' OH group, which is replaced by an H:
dNTP
OH
“ddNTP”
H
dNTP & ddNTP
…ddNTP Dideoxynucleotides, or ddNTPs, are nucleotides lacking a 3'-
hydroxyl (-OH) group on their deoxyribose sugar. Since deoxyribose already lacks a 2'-OH, dideoxyribose lacks
hydroxyl groups at both its 2' and 3' carbons. The lack of this hydroxyl group means that, after being added by
a DNA polymerase to a growing nucleotide chain, no further nucleotides can be added as no phosphodiester bond can be created based on the fact that deoxyribonucleoside triphosphates (which are the building blocks of DNA) allow DNA chain synthesis to occur through a condensation reaction between the 5' phosphate (following the cleavage of pyrophospate) of the current nucleotide with the 3' hydroxyl group of the previous nucleotide.
…ddNTP The dideoxyribonucleotides do not have a 3'
hydroxyl group, hence no further chain elongation can occur once this dideoxynucleotide is on the chain.
This can lead to the determination of the DNA sequence. Thus, these molecules form the basis of the dideoxy chain-termination method of DNA sequencing, which was developed by Frederick Sanger (1977).
dNTP & ddNTP Four separate reaction tubes are required, each one containing
radioactively labeled DNA primers, DNA Polymerase II, and an ample amount of all 4 dNTP (dATP, dTTP, dGTP, dCTP) each to be integrated into the DNA strand being synthesized as a nucleotide.
Each reaction tubes contain a different ddNTP, allowing each tube to identify a different nucleotide along the strand.
For example, one tube would contain a ddATP, enabling that reaction tube to identify all the A's being integrated into the synthesizing strand
Thus all the T's in the complementary template strand (recall that T nucleotides are complementary and base pair with A nucleotides).
The above is required for the rest of the tubes with dTTP, dGTP, dCTP
dNTP & ddNTP All 4 dNTPs and a different ddNTP are
added to each reaction tube in a ratio of around 300:1, and Polymerase will randomly integrate either a dNTP or a ddNTP into the synthesizing strand if the ddNTP complements with the nucleotide on the template strand.
Sequencing method
Before the DNA can be sequenced, it has to be denatured into single strands using heat.
Next a primer is annealed to one of the template strands. This primer is specifically constructed so that its 3' end is located next to the DNA sequence of interest.
Either this primer or one of the nucleotides should be radioactively or fluorescently labeled so that the final product can be detected on a gel (Russell, 2002).
Once the primer is attached to the DNA, the solution is divided into four tubes labeled "G", "A", "T" and "C". Then reagents are added to these samples as follows:
….Sequencing method Recap First, anneal the primer to the DNA template (usually single
stranded), Example: 5'-GAATGTCCTTTCTCTAAG 3'-
GGAGACTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAAGATCAAG-5'
Then split the sample into four aliquots, in tubes labeled "G", "A", "T" and "C" and add the following substrates to the respective tubes:
"G" tube: all four dNTP's, ddGTP and DNA polymerase "A" tube: all four dNTP's, ddATP and DNA polymerase "T" tube: all four dNTP's, ddTTP and DNA polymerase "C" tube: all four dNTP's, ddCTP and DNA polymerase
…. Sequencing method When a polymerase (e.g. Klenow fragment) is added
to the tubes, the synthetic reaction proceeds until, by chance, a dideoxynucleotide is incorporated instead of a deoxynucleotide.
This is a "chain termination" event, because there is a 3' H instead of a 3' OH group.
Since the synthesized DNA contains some radiolabeled (or chemically labeled) substrates, the products can be detected and distinguished from the template.
…Sequencing method
As the DNA is synthesized, nucleotides are added on to the growing chain by the DNA polymerase.
However, on occasion a dideoxynucleotide is incorporated into the chain in place of a normal nucleotide, which results in a chain-terminating event.
For example if we looked at only the "G" tube, we might find a mixture of the following products:
Figure 1: An example of the potential fragments that could be produced in the "G" tube. The fragments are all different lengths due to the random integration of the ddGTP's (Metzenberg).
ddNTP = Array of Fragments http://www.dnalc.org/ddnalc/resources/c
ycseq.html
Gel Electrophoresis of PCR Product
Picture of Sequencer
Cycle Sequencing Results Electropherogram - laser reads DNA
fragment Adenine Thymine Cytosine Guanine
Electropherogram Example
Electropherogram Figure - BAD Results
References
Introduction to Biotechnology by W.J. Thieman and M.A. Palladino. Pearson & Benjamin Cummings 2nd edition.
http://en.wikipedia.org http://www.ocf.berkeley.edu/~edy/genome/
sequencing.html http://www.escience.ws/b572/L8/L8.htm http://www.bio.davidson.edu/Courses/Molbio/
MolStudents/spring2003/Obenrader/sanger_method_page.htm
PPT lecture materials- Courtesy DRs T Mc Elroy & PN Achar