1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization...

download 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization Levels.

If you can't read please download the document

Transcript of 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization...

  • Slide 1

1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization Levels Slide 2 Chemical Level Molecules O 2 CO 2 C 6 H 12 O 6 Macromolecules Proteins amino acids Lipids fatty Acids Carbohydrates monosaccharides Nucleic Acids nucleotides Elements H C O Compounds NaCl KCl Ions Na + K + Cl - Ca ++ Mg ++ Slide 3 Cellular Level Chromatin Slide 4 Tissue Level Epithelial Tissue Connective Tissue Muscular Tissue Nervous Tissue Slide 5 Organ Level Gastrointestinal Tract 1. Mouth 2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas Slide 6 Organ System Level Slide 7 Darwin sails around the world and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments Organismic Level Slide 8 Animal Cell Chromatin Slide 9 DNA Base Pairs: A T C G Bases/Base Pairs Nucleotides 3. Nitrogenous Base 1. 2. (deoxyribonucleic acid) Slide 10 DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome Slide 11 Human Chromosomes A Pair of Duplicated Chromosomes Autosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait Sex Chromosomes Slide 12 Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG 1000-2000 genes per chromosome ~25,000 - 30,000 genes per human genome Slide 13 DNA Functions Pass on Genetic Material Replication Mitosis Meiosis Protein Synthesis Transcription Translation Slide 14 Mitosis Slide 15 Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made Slide 16 Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells Embryongenesis - Week 1 Slide 17 Embryogenesis Week 2 Embryonic Germ Cell Layers: Endoderm Mesoderm Ectoderm Multipotent Stem Cells Slide 18 Growth Cone Cell Migration Slide 19 Act like scaffolding to assist movement of neurons during development Radial Glia Slide 20 Differentiation Slide 21 Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization Slide 22 Neurobehavioral Hypothesis Maternal/Fetal Evidence: extensive maternal bleeding prolonged labor delivery complications low birth weight low head circumference body length:body weight multiparity Anectodal Evidence Dutch births during WWII Season of birth effect higher for winter pregnancies parallel with virus exposure Slide 23 Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein Slide 24 From Gene to Protein DNA RNA Protein Slide 25 Genetic Code Codons three base code Code for specific amino acids Slide 26 Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected Slide 27 Point Mutation Mutation is not corrected Mutation is corrected Slide 28 Sickle-Cell Anemia Mutation Slide 29 Slide 30 Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease Slide 31 Cancer in Women Slide 32 Lung Cancer