1 2 Mannitol and the mannitol-specific enzyme llB subunit activate Vibrio cholerae 3 biofilm

1

2

Mannitol and the mannitol-specific enzyme llB subunit activate Vibrio cholerae 3

biofilm formation 4

5

6

Patrick Ymele-Leki‡, Laetitia Houot¥, and Paula I. Watnick* 7

Division of Infectious Diseases 8 Boston Children's Hospital 9

300 Longwood Avenue 10 Boston, Massachusetts 02115 11

12

13

14

*Corresponding author. 15 Mailing address: 16 Division of Infectious Diseases, Boston Children's Hospital, 17 300 Longwood Avenue, Boston, MA 02115. 18 Phone: (617) 919-2918. Fax: (617) 730-0254. 19 E-mail: [email protected] 20 21 ‡Present address : 22 Department of Chemical Engineering 23 Howard University 24 2300 6th Street, NW 25 Washington, DC 20059 26 27 ¥Present address : 28 Laboratoire d’Ingénierie des Systèmes Macromoléculaires 29 Aix-Marseille Université 30 CNRS – UMR7255 31 31 chemin Joseph Aiguier 32 13402 Marseille Cedex 20, France 33 34

35

Running Title: Mannitol activates Vibrio cholerae biofilm accumulation36

Copyright © 2013, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01184-13 AEM Accepts, published online ahead of print on 31 May 2013

on January 12, 2019 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

Abstract 37

Vibrio cholerae are halophilic, Gram-negative bacteria found in marine environments. 38

Strains that produce cholera toxin cause the diarrheal disease cholera. V. cholerae 39

use a highly conserved, multi-component signal transduction cascade known as the 40

phosphoenolpyruvate phosphotransferase system (PTS) to regulate carbohydrate 41

uptake and biofilm formation. Regulation of biofilm formation by the PTS is complex, 42

involving many different regulatory pathways that incorporate distinct PTS 43

components. The PTS consists of the general components enzyme l (El) and 44

histidine protein (HPr), and the carbohydrate-specific enzymes ll. Mannitol transport 45

by V. cholerae requires the mannitol-specific Ell (EllMtl), which is expressed only in 46

the presence of mannitol. Here we show that mannitol activates V. cholerae biofilm 47

formation and transcription of the vps biofilm matrix exopolysaccharide synthesis 48

genes. This regulation is dependent on mannitol transport. However, in the absence 49

of mannitol, we show that ectopic expression of the B subunit of EllMtl is sufficient to 50

activate biofilm accumulation. Mannitol, a common compatible solute and 51

osmoprotectant of marine organisms, is a main photosynthetic product of many 52

algae and is secreted by algal mats. We propose that the ability of V. cholerae to 53

respond to environmental mannitol by forming a biofilm may play an important role in 54

habitat selection.55


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Introduction 56

Vibrio cholerae, a halophilic, Gram-negative rod, is responsible for the millions 57

of cases of the diarrheal disease cholera that are reported annually (1). The life cycle 58

of this pathogen encompasses not only the human intestine, but also estuarine and 59

marine environments. Within these aquatic environments, V. cholerae exists either 60

in the free-swimming, planktonic state or attached to a surface in a biofilm (2, 3). 61

Three types of V. cholerae biofilms have been described. The monolayer 62

biofilm consists of a single layer of cells attached to a surface and depends on 63

motility and the mannose-sensitive hemagglutinin (4). Multilayer biofilms consist of 64

multiple layers of cells anchored to the surface by a base of surface-attached cells. 65

One type of multilayer biofilm depends on Ca2+ to mediate intercellular interactions 66

(5), while another type depends on synthesis of an extracellular matrix comprised of 67

the VPS exopolysaccharide and a number of VPS-associated proteins (4, 6-10). 68

Most of the exopolysaccharide synthesis enzymes and structural biofilm proteins are 69

encoded within a region of the V. cholerae genome known as the VPS island (8). 70

Transcription of these vps genes is tightly regulated by diverse environmental cues 71

such as quorum-sensing autoinducers, polyamines, nucleic acids, phosphate, and 72

carbohydrates (11-20). 73

Specific sugars such as glucose and mannose have recently been shown to 74

play a determining role in activation of V. cholerae biofilm formation (2, 4, 20). 75

Transport of these sugars as well as fructose, mannitol, N-acetylglucosamine, 76

sucrose, and trehalose is dependent on the phosphoenolpyruvate 77

phosphotransferase system (PTS) (21). The PTS is a conserved bacterial multi-78

component signal transduction cascade that monitors the nutritional status of the cell 79

and alters transport and phosphorylation of selected sugars and sugar derivatives in 80


.asm.org/

Dow

nloaded from

http://aem.asm.org/

response to these cues (22). In addition to its role in carbohydrate transport, the 81

bacterial PTS has been implicated in the regulation of a myriad of cellular functions 82

including chemotaxis (23, 24), glycogen catabolism (25, 26), detection of quorum-83

sensing molecules (27), and biofilm formation (20, 28, 29). 84

In V. cholerae, the PTS includes the two general cytoplasmic proteins Enzyme 85

I (EI) and histidine protein (HPr), the fructose-specific HPr homolog FPr, and a 86

number of sugar-specific, multi-subunit proteins that comprise the group of enzymes 87

II (EIIs) (30). EI acquires phosphate from phosphoenolpyruvate (PEP) and transfers 88

it to either HPr or FPr (Figure 1). From here, the phosphoryl group is passed to one 89

of the EIIs, which are sugar-specific and consist of the three covalently or non-90

covalently associated subunits designated as enzyme IIA (EllA), enzyme IIB (EllB), 91

and enzyme IIC (EllC). Transfer of phosphate proceeds sequentially within enzyme II 92

from IIA to IIB to the incoming sugar, which is transported across the membrane by 93

the membrane-spanning IIC domain (22, 30, 31). 94

The phosphorylation state of PTS components reflects the intracellular 95

availability of PEP and the environmental availability of PTS-specific sugars. When 96

PEP is scarce and/or PTS-specific sugars are plentiful, PTS components become 97

dephosphorylated (Figure 1A). In contrast, PTS components are phosphorylated 98

when PEP is plentiful and transported sugars are scarce (Figure 1B). Because the 99

phosphorylation state of PTS components varies with the availability of PEP and 100

environmental carbohydrates, they are ideally poised to serve as sensors of the 101

nutritional status of the cell. The PTS components then communicate this 102

information through direct interactions with other proteins (32-34). 103

We recently reported that mutation of the V. cholerae general PTS 104

components El and HPr results in an increased propensity to associate in biofilms 105


.asm.org/

Dow

nloaded from

http://aem.asm.org/

(20, 30). A comparison of the transcriptomes of wild-type V. cholerae and a ΔPTS 106

mutant, revealed an increase in transcription of the gene encoding the mannitol-107

specific Ell. We previously observed that transcription of the gene encoding this Ell 108

component, in particular, was induced under biofilm-activating conditions (7). 109

Therefore, we investigated the hypothesis that the mannitol-specific Ell component 110

might participate in a biofilm-regulatory signal transduction cascade. Here we 111

describe a role for mannitol and the mannitol-specific EllB component (EllBMtl) in 112

activation of V. cholerae biofilm formation.113


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Materials and Methods 114

Bacterial strains, plasmids, and media. The bacterial strains and plasmids used in 115

this study are listed in Table 1. pFLAG-CTC (Sigma-Aldrich), an expression vector 116

including an isopropyl β-D-1-thiogalactopyranoside (IPTG) inducible promoter and a 117

C-terminal FLAG tag, was used in rescue experiments. Bacteria were cultivated in 118

Luria-Bertani broth (LB) or minimal medium supplemented with mannitol at a 119

concentration of approximately 25 mM unless otherwise indicated. During growth of 120

V. cholerae in LB broth supplemented with mannitol, the pH of the medium 121

decreased from 7 to 6 after 14 hours. The pH subsequently returned to 7 over the 122

next 10 hours. During 24 hours of growth in LB broth alone, the pH of the medium 123

increased from 7 to 9. Where indicated, ampicillin (100 μg/mL) and IPTG (1 mM) 124

were added to the growth medium. A 0.1 M phosphate-buffered saline solution (PBS, 125

pH 7.0) was used to resuspend biofilm cells. 126

Construction of in-frame deletion mutants. The in-frame deletion mutants were 127

constructed as described previously (11, 20). Briefly, for the construction of the mtlA 128

deletion (ΔmtlA) and mtlR deletion (ΔmtlR) mutants, the primers listed in Table 2 129

were used to amplify genome sequences spanning an in-frame deletion in the gene 130

of interest. These DNA fragments were joined by the technique of gene splicing by 131

overlap extension (SOE), cloned into pCR2.1-TOPO, and then subcloned into the 132

suicide vector pWM91 by ligation after digestion with XhoI and SpeI. All other 133

plasmids used in the construction of in-frame deletion mutants were available in our 134

laboratory. Suicide plasmids were used to generate in-frame deletion mutants by 135

double homologous recombination. 136

RNA isolation. Wild-type V. cholerae and ΔPTS mutant strains were cultured in 10 137

static glass tubes, each filled with 2 ml of minimal medium supplemented with 0.5% 138


.asm.org/

Dow

nloaded from

http://aem.asm.org/

glucose (wt/wt). After 24 hrs of incubation at 27°C, planktonic cells were harvested. 139

Two mls of phosphate buffered saline (PBS) along with a small amount of 1 mm 140

glass beads (Biospec, Inc) were added to the remaining biofilm cells. These were 141

dispersed by gentle vortexing. Both biofilm and planktonic cells were pelleted by 142

centrifugation for 15 minutes at 4,000 rpm and then incubated for 5 minutes in 200 µl 143

lysosyme-TE buffer (400 µl/ ml). Total RNA was extracted with the RNeasy kit 144

(Qiagen), and remaining traces of DNA were removed by incubation with 1 µl DNase 145

I (Promega) for 15 min at 37°C. Total RNA was precipitated with ethanol and 146

resuspended in 20 µl RNase-free water. Concentration and purity were determined 147

with absorbance measurements at 260 nm and 280 nm (A260 and A280 respectively; 148

A260/A280 >1.9), as well as by agarose gel electrophoresis to verify the absence of 149

RNA degradation. 150

Microarray data acquisition and statistical analysis. DNA microarrays were 151

obtained from the Pathogen Functional Genomics Resource Center at the J Craig 152

Venter Institute (Vibrio cholerae El Tor N16961, version 2), and experimental 153

procedures were adapted from Institute protocols. Briefly, before use, microarrays 154

were prehybridized in 0.22 μm filtered buffer (5x SSC, 0.1% SDS, 1% BSA) at 42°C 155

for 1 h. They were then washed with 2 L of distilled water, rinsed with isopropyl 156

alcohol, and dried. Eight μg of total RNA purified from wild type V. cholerae or a 157

ΔPTS mutant was used as a template for reverse transcription (RT) reactions. The 158

RT reaction included 5 μg of random hexanucleotide primers (Invitrogen), 10 mM 159

DTT, 500 μM each of dATP, dCTP and dGTP, 100 μM dTTP, 400 μM 5-(3-160

aminoallyl)-dUTP (Sigma), 1x First Strand Buffer (Invitrogen), and 400 U of 161

Superscript III reverse transcriptase (Invitrogen). This reaction was allowed to 162

proceed for 2 h at 42°C. The RNA template was then hydrolyzed with 2 units of 163


.asm.org/

Dow

nloaded from

http://aem.asm.org/

RNase H (Amersham Pharmacia) for 15 min at 37°C. The resulting cDNA was 164

purified on a Microcon-30 microconcentrator (Amicon), ethanol-precipitated, and 165

resuspended in 9 µl of NaHCO3 (0.1M, pH 9). Labelling was performed by incubation 166

with 4.5 µl of Cy3 or Cy5 monofunctional dye (Amersham Biosciences) for 45 min at 167

room temperature. Unincorporated dye was quenched by the addition of 4.5 µl of 4 168

M hydroxylamine and removed with a QIAquick PCR purification kit (Qiagen). Two 169

differentially labelled samples (one with Cy3 and the other with Cy5) of the ΔPTS 170

mutant and the wild type strain were combined, and the mixture was ethanol-171

precipitated. Labelled cDNAs were then resuspended in 30 µl of hybridization buffer 172

(21% formamide, 0.2% SDS, 1x Denhardt’s, 7x SSPE) and heated for 2 min at 173

100°C before being applied to the microarray. 174

DNA microarrays were incubated in hybridization chambers (Corning) at 42°C for 175

18–20 h and then washed to remove non-specific hybridization (once with 2x SSC, 176

0.1% SDS for 5 min, twice with 0.1x SSC, 0.1% SDS for 6 min, twice with 0.1x SSC 177

for 5 min). For each microarray experiment, four independent experimental 178

replicates were performed of which the Cy dyes were swapped in two to control for 179

incorporation bias. Hybridized arrays were immediately scanned using a GenePixTM 180

4000B scanner (Axon Instruments). Image analysis was performed using 181

GenePixTM Pro 4.0. For each spot, the local background fluorescence was 182

subtracted. The signals were analyzed with GENESPRING 5.0.1. (Silicon Genetics), 183

using the global normalization LOWESS method. The final ratio of Cy5/Cy3 intensity 184

was calculated as a mean of the ratio for each spot of the replicated dye swaps. 185

Microarray data have been deposited in the GEO data base (Accession number 186

GSE42674). 187


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Ectopic protein expression. The protocol for protein expression has been 188

previously described (6). Briefly, the ORFs or protein domains of interest were 189

amplified by PCR. For cloning into pFLAG-CTC, NdeI and EcoRI restriction sites 190

were included in the PCR primer pairs. The PCR products were then digested and 191

ligated into the expression vector. The ligation products were transformed into E. coli 192

TOP10 competent cells and selected on LB agar plates supplemented with 193

ampicillin. The presence of the correct insert was confirmed by colony PCR and 194

sequence analysis. Confirmed plasmids were electroporated into V. cholerae. 195

Quantitative analysis of total growth and biofilm formation. Quantification of 196

total growth and biofilm formation in culture tubes was performed as described 197

previously (2). The strains were grown overnight on LB agar plates at 27ºC. To set 198

up biofilm cultures, the resulting colonies were used to inoculate borosilicate tubes 199

filled with 300 μL of LB broth alone or supplemented with mannitol. After incubation 200

for 18 to 24 h at 27 ºC, each planktonic cell suspension was collected, and the 201

planktonic cell density was determined by measuring the optical density at 655 nm 202

(OD655) using a Benchmark Plus microplate spectrophotometer (Bio-Rad). To 203

quantify the surface-attached cells, 300 μL of PBS and a small volume of 1-mm 204

glass beads (Biospec, Inc) were added to the surface-attached cells remaining in the 205

borosilicate tube, and the cells were dispersed by vortexing. The OD655 of the 206

resulting cell suspension was measured. This measurement technique was found to 207

be linearly correlated with the total amount of protein in these biofilm samples, 208

suggesting that it accurately reflects the number of cells in the biofilm (data not 209

shown). The reported total growth was calculated from the sum of the OD655 210

measured for planktonic and surface-associated cell suspensions. All values are the 211

means of at least three experimental replicates. Error bars represent the standard 212


.asm.org/

Dow

nloaded from

http://aem.asm.org/

deviation, and statistical significance was calculated using a two-tailed t test. 213

Differences were considered significant if the p value was less than 0.05. 214

Measurement of vpsL transcription using β-galactosidase assays. Strains were 215

grown overnight on LB agar plates at 27ºC. The following morning, several bacterial 216

colonies were resuspended in LB broth to obtain an initial OD655 of approximately 217

0.05. Cultures were then incubated at 27ºC with shaking until the OD655 reached 218

approximately 1.5. The OD655 of each culture was recorded. One milliliter of each 219

culture was moved into a microcentrifuge eppendorf tube, centrifuged gently to avoid 220

cell lysis, and resuspended in 200 μL of Z-buffer (0.06 M Na2HPO4 7H2O, 0.04 M 221

NaH2PO4 H2O, 0.01 M KCl, and 0.001 M MgSO4, pH 7.0). Three freeze-thaw cycles 222

were performed, and 17 μL of 4 mg/mL ortho-nitrophenyl-β-galactoside (ONPG) 223

were added to each tube. The tubes were then incubated at room temperature until 224

the first tube turned yellow. All tubes were immediately centrifuged to remove 225

cellular debris, 100 µl of each supernatant was moved into a 96-well plate (Nunc), 226

and the OD420 of each well was measured using a Benchmark Plus microplate 227

spectrophotometer (Bio-Rad). We did not find it necessary to stop the reactions by 228

adding bicarbonate because an insignificant amount of color was generated during 229

rapid processing of the samples. β-galactosidase measurements were normalized 230

by dividing by the final OD655 of the respective culture. Because all samples were 231

harvested at the same time, there was no need to normalize with respect to the 232

length of time the reactions were allowed to proceed. Three experimental replicates 233

were performed each time, and every experiment was repeated multiple times. Error 234

bars represent the standard deviation, and statistical significance was calculated 235

using a two-tailed t test. Measurements were considered significant if the p value 236

was less than 0.05. 237

238


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Results 239

Transcriptomic analysis of gene expression in a ΔPTS mutant. We previously 240

demonstrated that, in minimal medium supplemented with glucose, biofilm formation 241

by a ΔPTS mutant, lacking the operon encoding EI (VC0965), HPr (VC0966), and 242

EIIAGlc (VC0964), is increased (20). To describe differences in gene regulation 243

between this mutant and wild-type V. cholerae in both the planktonic and biofilm 244

states, we used microarray analysis (Tables S1 and S2). As compared with the wild-245

type biofilm, five hundred and sixty-three genes were differentially regulated in the 246

ΔPTS biofilm. However, only 218 genes were differentially regulated in the 247

corresponding planktonic experiment. We hypothesize that genes selectively 248

differentially regulated in the biofilm or oppositely regulated in biofilm and planktonic 249

cells reflect the bacterial response to the larger biofilm structure of the ΔPTS mutant. 250

Table 3 lists genes that were significantly differentially regulated in planktonic wild-251

type V. cholerae and ΔPTS mutant cells by 3-fold or more and similarly regulated in 252

the biofilm. The majority of these genes were predicted or known to participate in 253

transport or metabolism of carbohydrates either directly or through regulation of 254

these processes. Furthermore, the most highly differentially regulated genes were 255

Ell components of the PTS. In particular, VC1826 encoding the IIABC mannose 256

permease (EIIMan), mtlA (VCA1045) encoding the IIABC mannitol-specific transporter 257

(EIIMtl) (21, 38), and VC1820 and 1821 encoding hypothetical EllA and EllBC 258

components, respectively, were the most highly induced PTS components in both 259

biofilm and planktonic cells. These genes were also previously found to be 260

transcriptionally activated by the addition of PTS sugars, a condition that increases 261

transcription of biofilm genes (7). We hypothesize that mutation of general PTS 262

components results in a physiological state similar to that found when PTS sugars 263


.asm.org/

Dow

nloaded from

http://aem.asm.org/

are abundant and increased transport of PTS sugars prevents accumulation of 264

phosphate on the downstream Ell PTS components. Because activation of biofilm 265

formation by mannitol has interesting environmental implications for V. cholerae, we 266

investigated the effect of mannitol and EllMtl on V. cholerae biofilm formation. 267

Mannitol increases VPS-dependent biofilm formation. We hypothesized that 268

mannitol might activate biofilm formation. Therefore, we measured biofilm formation 269

by wild-type V. cholerae in the presence of mannitol. As shown in Figures 2A and B, 270

medium supplementation with this sugar increased surface association but did not 271

increase total growth, suggesting that the increase in biofilm formation is 272

independent of bacterial replication. This surface-associated structure was 273

dependent on the vps genes (Figure 2C). Therefore, we conclude that mannitol 274

increases VPS exopolysaccharide-dependent biofilm formation when added to LB 275

broth. 276

Micromolar concentrations of mannitol activate biofilm formation. Mannitol 277

concentrations as high as 700 µM have been found in marine environments (39). To 278

determine if concentrations of mannitol in this range activate V. cholerae biofilm 279

formation, we performed a titration experiment. As shown in Figure 3, V. cholerae 280

formed an increased biofilm in response to levels of mannitol as low as 400 µM. 281

Mannitol-specific Ell is required for activation of V. cholerae biofilm formation 282

in the presence of mannitol. We questioned whether EllMtl might affect biofilm 283

formation by wild-type V. cholerae and PTS mutants. As shown in Figure 4A and B, 284

deletion of mtlA in V. cholerae cultured in LB broth supplemented with mannitol 285

decreased biofilm formation to levels observed in LB broth alone (Figure 4). 286

Furthermore, the increase in biofilm accumulation resulting from deletion of the 287

general PTS component HPr did not require mannitol or EllMtl. MtlR has been shown 288


.asm.org/

Dow

nloaded from

http://aem.asm.org/

to repress E. coli EllMtl by an unknown mechanism (40). We hypothesized that 289

deletion of mtlR might affect biofilm formation indirectly through an effect on EllMtl, 290

but this had no effect on biofilm formation either in the presence or absence of 291

mannitol (Figure 4). 292

Only the EIIBMtl subunit is required for activation of biofilm formation. 293

Expression of MtlA is observed only in the presence of mannitol due to post-294

transcriptional inhibition by the small RNA mtlS (41). We reasoned that we could 295

assess the role of EllMtl in biofilm formation independently of the presence of 296

mannitol by ectopically expressing EllMtl subdomains in wild-type V. cholerae cultured 297

in LB broth alone. To test this hypothesis, we measured biofilm formation by wild-298

type cells transformed with a control plasmid or plasmids encoding the IIA domain of 299

EIIMtl (EIIAMtl), the IIB domain of EIIMtl (EIIBMtl), or MtlR. As controls, we tested the 300

effect on biofilm formation of expression of VC1281, which is an EllB component 301

involved in cellobiose transport (42), and VC1821, which contains fused Ell B and C 302

components of unknown function, and confirmed adequate expression of all 303

ectopically produced proteins by Western analysis. As shown in Figure 5, despite 304

adequate expression of all constructs, only EIIBMtl activated biofilm formation in the 305

absence of exogenous mannitol. These results suggest that the EllBMtl domain 306

mediates increased biofilm accumulation even in the absence of mannitol transport. 307

Furthermore, they suggest that MtlR does not play a role in regulation of biofilm 308

formation by mannitol and EllBMtl. 309

Evidence that only the unphosphorylated form of EIIBMtl regulates biofilm 310

accumulation. Transport of D-mannitol by the V. cholerae PTS requires transfer of 311

the phosphoryl group from the intermediate phosphocarrier protein HPr to EllA and 312

EllB, the cytoplasmic subunits of EIIMtl. Regulatory functions of PTS intermediates 313


.asm.org/

Dow

nloaded from

http://aem.asm.org/

are often coupled to their phosphorylation state. To determine if activation of biofilm 314

formation by EIIBMtl was dependent on its phosphorylation state, we engineered and 315

expressed wild-type EllABMtl as well as the following point mutants: EIIAMtlH564A or 316

EIIABMtlH564A, in which the phosphorylated histidine of EllAMtl is mutated to an 317

alanine, and EIIBMtlC389S or EIIABMtlC389S, in which the phosphorylated cysteine of 318

EllBMtl is mutated to a serine. Each of these mutations prevents phosphorylation of 319

EllBMtl. As shown in Figure 6, EllBMtl and EIIBMtlC389S, which cannot be 320

phosphorylated, induced biofilm formation to similar degrees when overexpressed in 321

either wild-type V. cholerae or a ΔmtlA mutant, but overexpression of wild-type 322

EllABMtl had no effect on biofilm formation. Overexpression of EIIABMtlC389S and 323

EIIABMtlH564A, which are also unphosphorylatable, activated biofilm formation, albeit 324

not to the extent observed for EllBMtl. We hypothesize that these mutants may be 325

less active than the wild-type protein. Furthermore, poor expression or degradation 326

of EIIABMtlC389S may lessen the phenotype induced by this mutant. Taken together, 327

our observations suggest that the unphosphorylated form of EIIBMtl activates biofilm 328

formation. 329

Mannitol and EIIBMtl regulate biofilm formation at the level of transcription. We 330

have shown that EllBMtl activates biofilm formation. To determine whether this 331

occurs at the transcriptional level, we measured β-galactosidase activity in reporter 332

strains carrying a vpsL-lacZ fusion at a neutral site on the chromosome. As shown 333

in Figure 7A, mannitol transport increased vps gene transcription approximately 8-334

fold. Furthermore, in LB broth, overexpression of EllBMtl increased vps gene 335

transcription approximately 6-fold in both wild-type V. cholerae and a ΔmtlA mutant 336

(Figure 7B and C). These results suggest that EllBMtl activates biofilm formation at 337

the transcriptional level. 338

339


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Discussion 340

Because transcription of mtlA, the gene encoding the mannitol-specific 341

enzyme ll, is greatly induced under conditions that favor biofilm formation (7), we 342

hypothesized that mannitol and EllMtl might activate biofilm formation. Here we show 343

that mannitol activates VPS-dependent V. cholerae biofilm formation at the 344

transcriptional level. Concentrations of mannitol as low as 400 µM are sufficient to 345

impact biofilm formation. Furthermore, our studies support a model in which the 346

unphosphorylated form of EllBMtl activates biofilm formation independently of its role 347

in mannitol transport. 348

Transcriptional regulation through interactions with other proteins is a 349

common theme for EllB components of the PTS (43). The glucose-specific EllBC of 350

Escherichia coli blocks the function of the transcription factor Mlc by sequestering it 351

to the membrane (44). Bacillus subtilis MtlR activates mtlA transcription by binding 352

to its promoter (45). Recently, investigators have shown that the unphosphorylated 353

form of the Bacillus subtilis EllBMtl interacts with the C-terminus of MtlR, sequestering 354

it to the membrane (46). This, in turn, potentiates MtlR, leading to increased 355

transcription of EllMtl. The MtlR protein of B. subtilis is not homologous to that of V. 356

cholerae. Unlike the B. subtilis MtlR, the Vibrio MtlR is not believed to function as a 357

classical transcription factor by binding DNA (47). Furthermore, the data presented 358

here suggest that it does not regulate biofilm formation in a manner parallel to that of 359

EllBMtl. Therefore, we hypothesize that EllBMtl interacts with an activator of biofilm 360

formation other than MtlR to increase surface attachment. We have initiated 361

experiments to isolate such an interaction partner. 362

In the high osmolarity environments such as estuaries and oceans where V. 363

cholerae is found, plants, algae, fungi, and bacteria use mannitol as a compatible 364


.asm.org/

Dow

nloaded from

http://aem.asm.org/

solute and osmoprotectant (48). Mannitol is also the main product of photosynthesis 365

by brown algae, and the concentration of mannitol directly above algal mats has 366

been shown to reach levels as high as 700 µM (39, 48). Beyond its association with 367

chitinaceous surfaces, very little is known about the natural habitats of V. cholerae in 368

marine environments. Based on the findings reported here, we propose that 369

mannitol released from marine organisms such as those in algal mats could activate 370

transcription of the vps genes, thus inducing V. cholerae to colonize these 371

environments. A scenario in which mannitol might activate V. cholerae biofilm 372

formation in the marine environment is depicted in Figure 8. Because V. cholerae 373

can transport and utilize mannitol as a carbon source and possibly also as a 374

compatible solute, this regulatory adaptation could provide V. cholerae with a 375

nutritional and osmoadaptive fitness advantage in the marine environment.376


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Acknowledgements 377

This work was supported by NIH AI050032 to P.I.W. Microarrays were obtained 378

from the Pathogen Functional Genomics Resource Center through a grant from 379

NIH/NIAID. 380

381


.asm.org/

Dow

nloaded from

http://aem.asm.org/

References 382

1. Weil AA, Ivers LC, Harris JB. 2012. Cholera: lessons from haiti and beyond. 383

Curr Infect Dis Rep 14:1-8. 384

2. Kierek K, Watnick PI. 2003. Environmental Determinants of Vibrio cholerae 385

Biofilm Development. Appl Environ Microbiol 69:5079-5088. 386

3. Reidl J, Klose KE. 2002. Vibrio cholerae and cholera: out of the water and 387

into the host. FEMS Microbiol Rev 26:125-139. 388

4. Moorthy S, Watnick PI. 2004. Genetic evidence that the Vibrio cholerae 389

monolayer is a distinct stage in biofilm development. Mol Microbiol 52:573-390

587. 391

5. Kierek K, Watnick PI. 2003. The Vibrio cholerae O139 O-antigen 392

polysaccharide is essential for Ca2+-dependent biofilm development in sea 393

water. Proc Natl Acad Sci U S A ;100:14357-14362. 394

6. Absalon C, Van Dellen K, Watnick PI. 2011. A communal bacterial adhesin 395

anchors biofilm and bystander cells to surfaces. PLoS Pathog 7:e1002210. 396

7. Moorthy S, Watnick PI. 2005. Identification of novel stage-specific genetic 397

requirements through whole genome transcription profiling of Vibrio cholerae 398

biofilm development. Mol Microbiol 57:1623-1635. 399

8. Yildiz FH, Schoolnik GK. 1999. Vibrio cholerae O1 El Tor: Identification of a 400

gene cluster required for the rugose colony type, exopolysaccharide 401

production, chlorine resistance, and biofilm formation. Proc. Natl. Acad. Sci. 402

USA 96:4028-4033. 403

9. Fong JC, Yildiz FH. 2007. The rbmBCDEF gene cluster modulates 404

development of rugose colony morphology and biofilm formation in Vibrio 405

cholerae. J Bacteriol 189:2319-2330. 406


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10. Fong JC, Karplus K, Schoolnik GK, Yildiz FH. 2006. Identification and 407

characterization of RbmA, a novel protein required for the development of 408

rugose colony morphology and biofilm structure in Vibrio cholerae. J Bacteriol 409

188:1049-1059. 410

11. Haugo AJ, Watnick PI. 2002. Vibrio cholerae CytR is a repressor of biofilm 411

development. Mol Microbiol 45:471-483. 412

12. Sultan SZ, Silva AJ, Benitez JA. 2010. The PhoB regulatory system 413

modulates biofilm formation and stress response in El Tor biotype Vibrio 414

cholerae. FEMS Microbiol Lett 302:22-31. 415

13. Pratt JT, McDonough E, Camilli A. 2009. PhoB regulates motility, biofilms, 416

and cyclic di-GMP in Vibrio cholerae. J Bacteriol 191:6632-6642. 417

14. Mudrak B, Tamayo R. 2012. The Vibrio cholerae Pst2 phosphate transport 418

system is upregulated in biofilms and contributes to biofilm-induced 419

hyperinfectivity. Infect Immun 80:1794-1802. 420

15. Zhu J, Mekalanos JJ. 2003. Quorum sensing-dependent biofilms enhance 421

colonization in Vibrio cholerae. Dev Cell 5:647-656. 422

16. Mueller RS, Beyhan S, Saini SG, Yildiz FH, Bartlett DH. 2009. Indole acts 423

as an extracellular cue regulating gene expression in Vibrio cholerae. J 424

Bacteriol 191:3504-3516. 425

17. Seper A, Fengler VH, Roier S, Wolinski H, Kohlwein SD, Bishop AL, 426

Camilli A, Reidl J, Schild S. 2011. Extracellular nucleases and extracellular 427

DNA play important roles in Vibrio cholerae biofilm formation. Mol Microbiol 428

82:1015-1037. 429


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18. McGinnis MW, Parker ZM, Walter NE, Rutkovsky AC, Cartaya-Marin C, 430

Karatan E. 2009. Spermidine regulates Vibrio cholerae biofilm formation via 431

transport and signaling pathways. FEMS Microbiol Lett. 432

19. Karatan E, Duncan TR, Watnick PI. 2005. NspS, a predicted polyamine 433

sensor, mediates activation of Vibrio cholerae biofilm formation by 434

norspermidine. J Bacteriol 187:7434-7443. 435

20. Houot L, Watnick PI. 2008. A novel role for enzyme I of the Vibrio cholerae 436

phosphoenolpyruvate phosphotransferase system in regulation of growth in a 437

biofilm. J Bacteriol 190:311-320. 438

21. Houot L, Chang S, Absalon C, Watnick PI. 2010. Vibrio cholerae 439

phosphoenolpyruvate phosphotransferase system control of carbohydrate 440

transport, biofilm formation, and colonization of the germfree mouse intestine. 441

Infect Immun 78:1482-1494. 442

22. Deutscher J, Francke C, Postma PW. 2006. How phosphotransferase 443

system-related protein phosphorylation regulates carbohydrate metabolism in 444

bacteria. Microbiol Mol Biol Rev 70:939-1031. 445

23. Titgemeyer F. 1993. Signal transduction in chemotaxis mediated by the 446

bacterial phosphotransferase system. J Cell Biochem 51:69-74. 447

24. Lux R, Jahreis K, Bettenbrock K, Parkinson JS, Lengeler JW. 1995. 448

Coupling the phosphotransferase system and the methyl-accepting 449

chemotaxis protein-dependent chemotaxis signaling pathways of Escherichia 450

coli. Proc Natl Acad Sci U S A 92:11583-11587. 451

25. Seok YJ, Sondej M, Badawi P, Lewis MS, Briggs MC, Jaffe H, 452

Peterkofsky A. 1997. High affinity binding and allosteric regulation of 453


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Escherichia coli glycogen phosphorylase by the histidine phosphocarrier 454

protein, HPr. J Biol Chem 272:26511-26521. 455

26. Seok YJ, Koo BM, Sondej M, Peterkofsky A. 2001. Regulation of 456

Escherichia. coli glycogen phosphorylase activity by HPr. J Mol Microbiol 457

Biotechnol 3:385-393. 458

27. Pereira CS, Santos AJ, Bejerano-Sagie M, Correia PB, Marques JC, 459

Xavier KB. 2012. Phosphoenolpyruvate phosphotransferase system 460

regulates detection and processing of the quorum sensing signal autoinducer-461

2. Mol Microbiol 84:93-104. 462

28. Loo CY, Mitrakul K, Voss IB, Hughes CV, Ganeshkumar N. 2003. 463

Involvement of an inducible fructose phosphotransferase operon in 464

Streptococcus gordonii biofilm formation. J Bacteriol 185:6241-6254. 465

29. Abranches J, Candella MM, Wen ZT, Baker HV, Burne RA. 2006. Different 466

roles of EIIABMan and EIIGlc in regulation of energy metabolism, biofilm 467

development, and competence in Streptococcus mutans. J Bacteriol 468

188:3748-3756. 469

30. Houot L, Chang S, Pickering BS, Absalon C, Watnick PI. 2010. The 470

phosphoenolpyruvate phosphotransferase system regulates Vibrio cholerae 471

biofilm formation through multiple independent pathways. J Bacteriol 472

192:3055-3067. 473

31. Barabote RD, Saier MH, Jr. 2005. Comparative genomic analyses of the 474

bacterial phosphotransferase system. Microbiol Mol Biol Rev 69:608-634. 475

32. Pickering BS, Smith DR, Watnick PI. 2012. Glucose-specific enzyme IIA 476

has unique binding partners in the Vibrio cholerae biofilm. MBio 3:e00228-12. 477


.asm.org/

Dow

nloaded from

http://aem.asm.org/

33. Lengeler JW, Jahreis K. 2009. Bacterial PEP-dependent carbohydrate: 478

phosphotransferase systems couple sensing and global control mechanisms. 479

Contrib Microbiol 16:65-87. 480

34. Wang G, Sondej M, Garrett DS, Peterkofsky A, Clore GM. 2000. A 481

common interface on histidine-containing phosphocarrier protein for 482

interaction with its partner proteins. J Biol Chem 275:16401-16403. 483

35. Miller VL, Mekalanos JJ. 1988. A novel suicide vector and its use in 484

construction of insertion mutations: osmoregulation of outer membrane 485

proteins and virulence determinants in Vibrio cholerae requires toxR. J 486

Bacteriol 170:2575-2583. 487

36. Waldor MK, Mekalanos JJ. 1994. Emergence of a new cholera pandemic: 488

molecular analysis of virulence determinants in Vibrio cholerae O139 and 489

development of a live vaccine prototype. J Infect Dis 170:278-283. 490

37. Metcalf WW, Jiang W, Daniels LL, Kim SK, Haldimann A, Wanner BL. 491

1996. Conditionally replicative and conjugative plasmids carrying lacZ a for 492

cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35:1-13. 493

38. Kumar S, Smith KP, Floyd JL, Varela MF. 2011. Cloning and molecular 494

analysis of a mannitol operon of phosphoenolpyruvate-dependent 495

phosphotransferase (PTS) type from Vibrio cholerae O395. Arch Microbiol 496

193:201-208. 497

39. Krug PJ, Zimmer RK. 2000. Larval settlement: chemical markers for tracing 498

production, transport, and distribution of a waterborne cue. Marine Ecology 499

Progress Series 207:283-296. 500

40. Figge RM, Ramseier TM, Saier MH, Jr. 1994. The mannitol repressor (MtlR) 501

of Escherichia coli. J Bacteriol 176:840-847. 502


.asm.org/

Dow

nloaded from

http://aem.asm.org/

41. Mustachio LM, Aksit S, Mistry RH, Scheffler R, Yamada A, Liu JM. 2012. 503

The Vibrio cholerae mannitol transporter is regulated posttranscriptionally by 504

the MtlS small regulatory RNA. J Bacteriol 194:598-606. 505

42. Berg T, Schild S, Reidl J. 2007. Regulation of the chitobiose-506

phosphotransferase system in Vibrio cholerae. Arch Microbiol 187:433-439. 507

43. Joyet P, Bouraoui H, Ake FM, Derkaoui M, Zebre AC, Cao TN, Ventroux 508

M, Nessler S, Noirot-Gros MF, Deutscher J, Milohanic E. 2013. 509

Transcription regulators controlled by interaction with enzyme IIB components 510

of the phosphoenolpyruvate:sugar phosphotransferase system. Biochim 511

Biophys Acta. 512

44. Nam TW, Jung HI, An YJ, Park YH, Lee SH, Seok YJ, Cha SS. 2008. 513

Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc 514

inactivation by membrane sequestration. Proc Natl Acad Sci U S A 105:3751-515

3756. 516

45. Joyet P, Derkaoui M, Poncet S, Deutscher J. 2010. Control of Bacillus 517

subtilis mtl operon expression by complex phosphorylation-dependent 518

regulation of the transcriptional activator MtlR. Mol Microbiol 76:1279-1294. 519

46. Bouraoui H, Ventroux M, Noirot-Gros MF, Deutscher J, Joyet P. 2013. 520

Membrane sequestration by the EIIB domain of the mannitol permease MtlA 521

activates the Bacillus subtilis mtl operon regulator MtlR. Mol Microbiol 87:789-522

801. 523

47. Tan K, Clancy S, Borovilos M, Zhou M, Horer S, Moy S, Volkart LL, 524

Sassoon J, Baumann U, Joachimiak A. 2009. The mannitol operon 525

repressor MtlR belongs to a new class of transcription regulators in bacteria. J 526

Biol Chem 284:36670-36679. 527


.asm.org/

Dow

nloaded from

http://aem.asm.org/

48. Iwamoto K, Shiraiwa Y. 2005. Salt-regulated mannitol metabolism in algae. 528

Mar Biotechnol (NY) 7:407-415. 529

530

531


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Figure Legends 532

Figure 1: Schematic view of the phosphorylation state of PTS components. (A) 533

when PTS sugars are abundant, and (B) when PTS sugars are scarce. Bold font is 534

used for species that are more abundant under the specified conditions. 535

Figure 2. Mannitol activates VPS-dependent biofilm formation. (A) Biofilm 536

formation or (B) total growth of wild-type V. cholerae in LB broth alone or 537

supplemented with 0.5% mannitol. * indicates measurements that are significantly 538

different from LB alone. (C) Comparison of biofilm formation by wild-type V. cholerae 539

and a ΔvpsA mutant in LB alone or supplemented with mannitol. Differences in 540

biofilm accumulation between wild-type V. cholerae and the ΔvpsA mutant are 541

significantly different. 542

Figure 3: Mannitol activates biofilm formation at concentrations as low as 430 543

µM. Measurements of biofilm formation by wild-type V. cholerae in LB broth 544

supplemented with various concentrations of mannitol. * indicates measurements 545

that are significantly different from biofilm formation in LB broth alone. 546

Figure 4: Activation of wild-type V. cholerae biofilm formation by mannitol is 547

dependent on mtlA. (A) Photographs of biofilms formed by wild-type V. cholerae 548

(WT) as well as ΔmtlA, ΔmtlR, and ΔHPr mutants in LB broth alone (-) or LB broth 549

supplemented with mannitol (+). Biofilm accumulation (grey bars) and total growth 550

(black bars) in (B) LB broth (-MTL) alone or (C) LB broth supplemented with mannitol 551

(+ MTL) for wild-type V. cholerae (WT) and the indicated mutants. * indicates 552

measurements that are significantly different from that of wild-type V. cholerae. 553

Figure 5. The EllBMtl domain of EllMtl regulates biofilm formation independently 554

of mannitol transport. (A) Measurements of biofilm accumulation in LB broth by 555

wild-type V. cholerae transformed with either an empty vector (pCTL) or the 556


.asm.org/

Dow

nloaded from

http://aem.asm.org/

corresponding vector expressing the A domain of EIIMtl (pEIIAMtl), the B domain of 557

EIIMtl (pEIIBMtl), a wild-type MtlR allele (pMtlR), a wild-type VC1281 allele (pVC1281), 558

and a wild-type VC1821 allele (pVC1821). Protein expression was induced by 559

addition of 1mM IPTG. * indicate measurements that are significantly different from 560

that of wild-type V. cholerae. (B) Western analysis to document expression of the 561

indicated FLAG-tagged proteins by V. cholerae. 562

Figure 6: Evidence that EllBMtl in its unphosphorylated form activates biofilm 563

formation. Biofilm accumulation and total growth were determined for either (A) 564

wild-type V. cholerae or (B) a ΔmtlA mutant transformed with an empty pFLAG-CTC 565

vector (pCTL), a pFLAG plasmid encoding the A domain of EIIMtl (pEIIAMtl); a plasmid 566

expressing EIIAMtlH564A, in which the phosphorylated histidine is mutated to alanine; a 567

plasmid encoding the B domain of EIIMtl (pEIIBMtl); a plasmid encoding EIIBMtlC389S, in 568

which the phosphorylated cysteine is mutated to a serine; a plasmid encoding both 569

the B and the A domains of EIIMtl (pEIIBAMtl); a plasmid encoding EIIBAMtlH564A; or a 570

plasmid encoding EIIBAMtlC389S. Protein expression was induced by addition of 1mM 571

IPTG. The values are the average of three experimental replicates. * indicate 572

measurements that are significantly different from that of wild-type V. cholerae. (C) 573

Assessment of expression of the indicated constructs in wild-type V. cholerae by 574

Western analysis. 575

Figure 7. Mannitol and EllBMtl regulate biofilm formation at the transcriptional 576

level. (A) β-galactosidase activity exhibited by a control V. cholerae strain (WT) 577

carrying a chromosomal vps-lacZ fusion cultured in LB broth alone or supplemented 578

with 0.1 % mannitol. (B) β-galactosidase activity exhibited by a control V. cholerae 579

strain (WT) and ΔHPr and ΔmtlA mutants cultured in LB broth. β-galactosidase 580

activity was measured for either (C) wild-type V. cholerae (WT) or (D) a ΔmtlA 581


.asm.org/

Dow

nloaded from

http://aem.asm.org/

mutant. Both strains were transformed with either an empty vector (pCTL) or a 582

plasmid encoding the A domain of EIIMtl (pEIIAMtl), the B domain of EIIMtl (pEIIBMtl), or 583

the AB domain of EIIMtl (pEIIABMtl). β-galactosidase activity was monitored by 584

addition of ortho-nitrophenyl-β-galactoside (ONPG) in Z-buffer. The values are the 585

average ratio OD420/OD600 for three experimental replicates. Measurements in A-D 586

were collected concurrently as part of one experiment but are separated for clarity. * 587

indicate measurements that are significantly different from that of wild-type V. 588

cholerae. 589

Figure 8: Model for the interaction of V. cholerae with brown algae in the 590

marine environment. (A) Planktonic bacteria in the absence of algae. (B) Secretion 591

of mannitol (Mtl) by algal mats activates the vps genes resulting in biofilm formation 592

by V. cholerae on these surfaces. Grey structures represent an algal mat. The 593

thickness of the bacterial outline corresponds to the amount of VPS 594

exopolysaccharide produced. 595

596


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 1. Bacterial strains and plasmids 597

E. coli strain Genotype or description Source or reference

E. coli SM10λpir

thi thr leu tonA lacY supE recA::RP4-2-Tc::Mu (λpirR6K) Kmr

(35)

V. cholerae strains PW249 MO10 (36) PW357 MO10 lacZ::vpsLplacZ; Smr (11) PW396 MO10 ΔvpsA (4) PW961 MO10 lacZ::vpsLplacZ ΔEI; Smr (20) PW964 MO10 lacZ::vpsLplacZ ΔHPr; Smr (20) PW954 MO10 lacZ::vpsLplacZ ΔFPr; Smr (21) PW1352 MO10 lacZ::vpsLplacZ ΔmtlA; Smr This study PW1353 MO10 lacZ::vpsLplacZ ΔHPrΔEIIMtl; Smr This study PW1356 MO10 lacZ::vpsLplacZ ΔmtlR; Smr This study Plasmids for construction of deletions pWM91 oriR6K mobRP4 lacI pTac tnp mini-Tn10; Kmr Apr (37) pWM91::ΔEIIMTL pWM91 carrying an unmarked, in-frame deletion in

VCA1045 (mtlA); Apr This study

pWM91::ΔMtlR pWM91 carrying an unmarked, in-frame deletion in VCA1047 (mtlR); Apr

This study

Plasmids used in complementation experiments pEIIMtl-FLAG pFLAG-CTC carrying the coding sequence of VCA1045 This study pEIIAMtl-FLAG pFLAG-CTC carrying a fragment of VCA1045 encoding

positions 507 to 649 This study

pEIIAMtlH564A-FLAG

pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 507 to 649 with an H-to-A mutation at position 564

This study

pEIIBMtl-FLAG pFLAG-CTC carrying a fragment of VCA1045 encoding positions 380 to 470

This study

pEIIBMtlC389S -FLAG

pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 380-470 with a C-to-S mutation at position 389

This study

pEIIBAMtl-FLAG pFLAG-CTC carrying a fragment of VCA1045 encoding positions 345 to 649

This study

pEIIBAMtlH564A-FLAG

pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 345 to 649 with an H-to-A mutation at position 564

This study

pEIIBAMtlC389S-FLAG

pFLAG-CTC carrying a variant of a VCA1045 fragment encoding positions 345 to 649 with a C-to-S mutation at position 389

This study

pMtlR-FLAG pFLAG-CTC carrying the coding sequence of VCA1047 This study 598 599

600

601

602


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 2. Primers used 603 Primers used in gene deletions

ΔmtlA GTGTAGGTCTTCCTACTTACGTAT TAACGAGCGGCCGCACATCGCGTCCCCCGTTGG TGCGGCCGCTCGTTATAACGTTTTTGCTCCTGAGGC CCGCGCACCATATTCTCA ΔmtlR CTGTGTGACGGCTTATCTGGG TAACGAGCGGCCGCACATTTTAAGACTACCGATAACCGC TGCGGCCGCTCGTTATAACGTTTAGGTGCACGC AGCGCCCCACACTCTTGTTG Primers used in complementation constructs EIIAMtl CGACCGCATATGCAAAAGGAGAACATTC CTGCAAGAATTCTGCCGCTTGGCTGGEIIAMtlH654A GTACCGGCCGGTACTGTG CACAGTACCGGCCGGTAC EIIBMtl CGACCGCATATGGGCGATAAAGACGCG CTGCAAGAATTCAAGTTGAGTCACTAACTG EIIBMtlC389S GTCGCTAGTGATGCGGGT ACCCGCATCACTAGCGACEIIBAMtl CGACCGCATATGGGCGATAAAGACGCG CTGCAAGAATTCTGCCGCTTGGCTGGTGGC VC1281 CGACCGCATATGAAAAAGATCCTACTC CTGCAAGAATTCGTTAATTAAATCTAAAGC VC1821 CGACCGCATATGGACGAAATCGC CTGCAAGAATTCAGCTTGGATAAGTTC MtlR CGACCGCATATGTCGAGAGCTGTC CTGCAAGAATTCAAACGGGCTGTC

604

605


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 3: Genes differentially regulated in ΔPTS mutant cells 606 in both the planktonic and biofilm states (p < 0.05). 607

608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630

*denotes genes that are PTS components or are in operons with PTS components. 631 632

633

634

Locus Putative or proven function Fold change (ΔPTS/WT)

Biofilm Planktonic Transport and binding proteins *VC1826 Mannose-specific EIIABC 16.65 16.11 *VC1820 Fructose-specific EIIA 13.70 4.83 *VCA1045 Mannitol-specific EIIABC 12.59 6.75 *VC1821 Fructose-specific EIIBC 12.32 8.78 VCA0943 Maltose ABC transporter,

permease 2.47 3.73 Energy Metabolism *VCA1046 Mannitol-1-phosphate 5-

dehydrogenase 14.30 3.34 *VC1827 Mannose-6-phosphate isomerase 13.36 6.41 Regulatory Function *VC1825 Transcriptional regulator 4.95 9.86 VC0606 Nitrogen regulatory protein P-II 0.08 0.30 Other functions VC1742 Hypothetical 0.45 0.23 VC2720 Conserved hypothetical 0.42 0.24


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/

1 2 Mannitol and the mannitol-specific enzyme llB subunit activate Vibrio cholerae 3 biofilm

Documents

Transcript of 1 2 Mannitol and the mannitol-specific enzyme llB subunit activate Vibrio cholerae 3 biofilm